ID: 918475435

View in Genome Browser
Species Human (GRCh38)
Location 1:184919275-184919297
Sequence AATCCAAGGCTGCTTCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918475435_918475444 8 Left 918475435 1:184919275-184919297 CCTGCCTGAAGCAGCCTTGGATT 0: 1
1: 0
2: 1
3: 15
4: 149
Right 918475444 1:184919306-184919328 GGAGTTCCCAAAGGGAGCGCTGG 0: 1
1: 0
2: 1
3: 21
4: 143
918475435_918475443 0 Left 918475435 1:184919275-184919297 CCTGCCTGAAGCAGCCTTGGATT 0: 1
1: 0
2: 1
3: 15
4: 149
Right 918475443 1:184919298-184919320 CCAGGGAAGGAGTTCCCAAAGGG 0: 1
1: 0
2: 1
3: 27
4: 247
918475435_918475441 -1 Left 918475435 1:184919275-184919297 CCTGCCTGAAGCAGCCTTGGATT 0: 1
1: 0
2: 1
3: 15
4: 149
Right 918475441 1:184919297-184919319 TCCAGGGAAGGAGTTCCCAAAGG 0: 1
1: 0
2: 1
3: 16
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918475435 Original CRISPR AATCCAAGGCTGCTTCAGGC AGG (reversed) Intronic
900647448 1:3715360-3715382 AACCCAGGGGTGCTTAAGGCGGG + Intronic
901538784 1:9901273-9901295 AAGCCAGGGCTGCCTGAGGCAGG + Intronic
902234226 1:15047472-15047494 AAGCCACGGCAGCTGCAGGCCGG + Intronic
902658414 1:17885247-17885269 GAGCCCAGGCTACTTCAGGCTGG + Intergenic
905104759 1:35557724-35557746 AATCCGCGGCTGCTTCACTCCGG - Intronic
908759538 1:67499142-67499164 AATCCAAGTCTGAAGCAGGCTGG + Intergenic
915290189 1:154878388-154878410 AATCCATGGCTGCTCCGGTCTGG - Intergenic
915625502 1:157111815-157111837 ATTCCAGGGCTGCCTCAGCCAGG - Intergenic
916505859 1:165427736-165427758 AAACCATGACTGATTCAGGCCGG - Intronic
916560892 1:165933525-165933547 AATCCAAGGCTGGTTTGGGGAGG + Intergenic
916568994 1:166008700-166008722 AATCCAAGGCAACTTGGGGCTGG - Intergenic
917670540 1:177269573-177269595 AATCCCAGGCTGCTGCAGTGAGG - Intronic
918475435 1:184919275-184919297 AATCCAAGGCTGCTTCAGGCAGG - Intronic
921608267 1:217180043-217180065 TATCAAAGGCTGCTTCAGGCAGG - Intergenic
922749256 1:228063054-228063076 TCTGCAAGGCTGCTGCAGGCAGG - Intergenic
923368779 1:233289540-233289562 AATACAACTCTGCTTCAGGCAGG + Intronic
923470150 1:234283047-234283069 CATCCAAGGCTGTTTCTGGGTGG - Intronic
1065801514 10:29356973-29356995 ATCCAAAGACTGCTTCAGGCAGG - Intergenic
1066259894 10:33719422-33719444 AACCCACAGCTGCTTCAGGATGG - Intergenic
1066556528 10:36620504-36620526 AATACAAAGATGCTTCTGGCTGG - Intergenic
1067494560 10:46750205-46750227 AACCACAGGCTTCTTCAGGCAGG + Intergenic
1067600097 10:47590192-47590214 AACCACAGGCTTCTTCAGGCAGG - Intergenic
1069744430 10:70706165-70706187 CATCCAAGGCTGATGCTGGCTGG + Intronic
1075234751 10:120716989-120717011 AATTCAAAGCTTCTTTAGGCTGG + Intergenic
1076430223 10:130396604-130396626 GATCCAAGGCTGTGCCAGGCAGG + Intergenic
1080282447 11:30573461-30573483 AAACCCTGGCTGCCTCAGGCAGG + Intronic
1084746754 11:71175358-71175380 AAACCAAGGCTGCTGCTGGGTGG + Intronic
1085460060 11:76688195-76688217 AGTCAAATGCTGCTTCAGTCAGG - Intergenic
1089183905 11:116601985-116602007 AATACAAAGCAGCTTCAGACAGG + Intergenic
1089243789 11:117103506-117103528 AATCCAAAACATCTTCAGGCTGG + Intergenic
1089286885 11:117413045-117413067 ATTCCACGGCTGCCTCAGGCAGG + Exonic
1095919306 12:47513597-47513619 CATCCGAGACTGCTTCAGCCTGG - Intergenic
1096035642 12:48467615-48467637 AATCCATGGTTGCTTCAGGATGG + Intergenic
1097671913 12:62550231-62550253 AGTACAAGGCTGTTTCAGGCTGG + Intronic
1098875138 12:75859095-75859117 AATACAAAGCTGCTTGAAGCAGG - Intergenic
1104061264 12:125270547-125270569 AATCCAAGGCTGCATGACCCAGG + Intronic
1104136507 12:125944691-125944713 AGACCAAGGCAGCTACAGGCTGG + Intergenic
1104759696 12:131289507-131289529 AGTCCAGCGCTGCTTCTGGCAGG - Intergenic
1104821017 12:131677706-131677728 AGTCCAGCGCTGCTTCTGGCTGG + Intergenic
1104876207 12:132036537-132036559 ATTTCATGGCTGCTTCAGGGAGG - Intronic
1105814001 13:24016856-24016878 AATCCAGGGCTGGTGCAGGATGG + Intronic
1113411339 13:110093042-110093064 ACACAAAGGCTGCTTCAGTCAGG - Intergenic
1115645874 14:35368142-35368164 CATGCCAGGCTGCTACAGGCAGG - Intergenic
1118357833 14:65029919-65029941 AATCCAAGCCTTCTTCAACCTGG - Intronic
1118401157 14:65380668-65380690 CCTCCAAGGCTCTTTCAGGCAGG + Intergenic
1118735978 14:68702300-68702322 CAGCCCAGGCTGCCTCAGGCAGG - Intronic
1118768989 14:68929222-68929244 AGACCAAGGCTGCCCCAGGCTGG - Intronic
1119619123 14:76118426-76118448 AACCCAAGGCTGGTTGGGGCAGG - Intergenic
1119685105 14:76625067-76625089 ATTCGAAGGCTGCCTGAGGCAGG - Intergenic
1119738771 14:77000361-77000383 AATGCCAGCCAGCTTCAGGCTGG - Intergenic
1121275852 14:92667054-92667076 AGTCCACAGCTGGTTCAGGCAGG + Intronic
1125732924 15:41904209-41904231 AATCCACGGCCCCTGCAGGCTGG - Intronic
1125743597 15:41984306-41984328 AAGCCAAGGTTGGCTCAGGCTGG + Intronic
1125762191 15:42104224-42104246 CACCCATGGCAGCTTCAGGCAGG - Intergenic
1126200450 15:45979501-45979523 AATGCAGGGCTTCTTTAGGCAGG - Intergenic
1134113683 16:11532209-11532231 AAAAGAAAGCTGCTTCAGGCCGG - Intergenic
1135471317 16:22734092-22734114 AACCCAAAGCTGTTTCACGCTGG + Intergenic
1137346529 16:47666835-47666857 AATCAAAGGATGATTCAGCCAGG - Intronic
1138739461 16:59290997-59291019 TATCAAAGGCTGCTGCATGCTGG - Intergenic
1141064066 16:80899851-80899873 ACTCCAAGGATACTCCAGGCTGG + Intergenic
1142525494 17:537425-537447 AAGGGAAGGCTGTTTCAGGCAGG - Intronic
1144084404 17:11795878-11795900 TGACCAAGGGTGCTTCAGGCTGG - Intronic
1144187907 17:12813826-12813848 ATTCCCAGGCTGCTGCAGGCTGG + Intronic
1145175756 17:20699125-20699147 AAACCAATTATGCTTCAGGCTGG - Intergenic
1147036332 17:37684221-37684243 AAACCAAGGCTGAGTCAGGAAGG - Intergenic
1152230795 17:79113084-79113106 AATACCAGGCTGCTTGGGGCAGG + Intronic
1153083782 18:1259395-1259417 AATCCAAGGCTCCTTTTGGTTGG - Intergenic
1155495303 18:26436640-26436662 AAGCAAAGGGTGTTTCAGGCAGG - Intergenic
1156499337 18:37547262-37547284 CACCCAAGGCTGCTCCAGCCTGG - Intronic
1156783201 18:40877318-40877340 AATCCAAGTCTGGTTCAAACTGG + Intergenic
1158955086 18:62530054-62530076 AATCCAAGAGTGCTCCAGTCTGG - Intronic
1161480661 19:4508767-4508789 GCTCCAGGACTGCTTCAGGCTGG - Exonic
1162934142 19:13972793-13972815 GATCCAAGGCGGCTACATGCTGG - Exonic
1163375595 19:16928245-16928267 AAACCAAGGCTGCTGGACGCTGG + Intronic
1165858752 19:38895456-38895478 AATGAATGCCTGCTTCAGGCTGG + Intronic
1166561635 19:43736506-43736528 AATCTGTGGCTGCTTCAGGCAGG + Intronic
1166861893 19:45815967-45815989 AATCCATGGCTTCCTCAGACGGG + Exonic
1167188443 19:47964985-47965007 TATACAAGGGTCCTTCAGGCTGG + Intergenic
1168382442 19:55935284-55935306 AATCACAGGATTCTTCAGGCTGG + Intergenic
1168668226 19:58220530-58220552 AATGCAAGAATGCTTCAGGCCGG + Intergenic
927407569 2:22789069-22789091 ATTAACAGGCTGCTTCAGGCTGG - Intergenic
928396048 2:30944095-30944117 AAAACAAGCCTGCCTCAGGCAGG - Intronic
931689481 2:64823109-64823131 ATTCCAAGGCTGCTTCTGCCAGG + Intergenic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
932886402 2:75553092-75553114 AAACCAGGGCTGCTTCAAGAAGG - Intronic
938100892 2:128497608-128497630 AAACCAAGGCTCCTTCTGGCTGG - Intergenic
938407720 2:131041777-131041799 GATGGAAGGCTGCTGCAGGCTGG - Intronic
938926802 2:136050592-136050614 AATCCAAGGGTAATTCAGGTTGG + Intergenic
939122961 2:138140447-138140469 AAGCCAAGGCTGCATGAGGACGG - Intergenic
939820009 2:146946025-146946047 TAGCCAAGGTTGCTTTAGGCAGG + Intergenic
943090095 2:183363856-183363878 GATAAAAGGTTGCTTCAGGCTGG - Intergenic
944897266 2:204177877-204177899 CTTCCAAAGCTGCTTCAGGCAGG - Intergenic
1170477948 20:16735062-16735084 AATCCCAGGCTCTTTCTGGCTGG - Intronic
1171145030 20:22774259-22774281 AATCCAGGGCAGCTGCAGGAGGG - Intergenic
1171307021 20:24115506-24115528 AGTCCAGGGTTGCTTCAGGTAGG + Intergenic
1173328240 20:42052770-42052792 AGTCCAGGGCTCCTGCAGGCTGG + Intergenic
1174435821 20:50506022-50506044 ATTCAAAGGCTACTCCAGGCTGG + Intergenic
1176307443 21:5131256-5131278 AATCCAACGCTGCAACCGGCTGG + Exonic
1179479300 21:41667406-41667428 AACCCCAGGCTGCTTCTGGTGGG - Intergenic
1179849617 21:44130774-44130796 AATCCAACGCTGCAACCGGCTGG - Exonic
1180745716 22:18087648-18087670 TTTCCAAGGCTGCTTCAGAAGGG + Intronic
1182009967 22:26992468-26992490 AATCAGAGGCTGCTTCTGGTGGG - Intergenic
1184265946 22:43346090-43346112 AAACCAAGGGTGCTCCTGGCAGG - Intergenic
1184474089 22:44711366-44711388 AAGCCAGGGCAGCTTCAGCCTGG + Intronic
1184607002 22:45579947-45579969 TTTTCAGGGCTGCTTCAGGCTGG - Intronic
950638167 3:14330617-14330639 ATTCCAAGGCTACTACACGCTGG - Intergenic
952438689 3:33300083-33300105 AATCATAAGCAGCTTCAGGCAGG + Intronic
953696909 3:45166820-45166842 AATCAAGGGCTGCTGCAGCCTGG - Intergenic
954441866 3:50526450-50526472 TTTCCAAGGCTGCCTCAGCCAGG + Intergenic
954783945 3:53079750-53079772 AATTCAAAGCTGCTTCTGGCAGG + Intronic
962076561 3:132088451-132088473 TCTCCAAGGCTGTTTCTGGCAGG - Intronic
962685654 3:137845219-137845241 ATTCCAAGGCAGCTTCAGAGAGG + Intergenic
963047802 3:141116176-141116198 AGCCCCAGGCTGCTTCAGGAAGG + Intronic
963447891 3:145438798-145438820 GATCAAAGGCTCCTTCACGCAGG - Intergenic
964636780 3:158866573-158866595 AATACAAGCCTGCTTCAGACAGG - Intergenic
965729896 3:171760717-171760739 CATCCTAGGCTGACTCAGGCTGG - Intronic
966354847 3:179069054-179069076 AATCTAAGGCTGTATGAGGCAGG - Intronic
972735846 4:41840441-41840463 CAACCAAGGCTGCTTGTGGCAGG + Intergenic
981538691 4:145825995-145826017 AAGGCAAGGCAGCTTAAGGCTGG + Intronic
987492167 5:18594926-18594948 TATCTAAGGCTGCATCAGCCTGG + Intergenic
993664857 5:90683446-90683468 ACTACAAGACTGCTGCAGGCAGG - Intronic
994405313 5:99338481-99338503 AATGAAAGGATGGTTCAGGCTGG + Intergenic
995876392 5:116794448-116794470 AATCCAATGCTTATTCAGGCTGG + Intergenic
996517049 5:124382422-124382444 ATTCCAAGGCAGATTCAAGCAGG + Intergenic
997341148 5:133145590-133145612 TATCCAAGACAGCTTCCGGCTGG + Intergenic
997868467 5:137486019-137486041 AATCCAGGGCTGCTAAGGGCAGG + Intronic
999090995 5:148935681-148935703 CATCCAAGGCTGGTGCAAGCTGG - Intronic
1007111382 6:39315089-39315111 GAGCCAAGGCGGCTCCAGGCAGG - Exonic
1007950768 6:45870118-45870140 ACTTCAAGGCTGCTTGAGGGAGG + Intergenic
1008456143 6:51713348-51713370 AGCCCAAGCCTGCCTCAGGCTGG + Intronic
1014966199 6:127755323-127755345 AATCCAAAGCTTCTTTAGGCTGG - Intronic
1015823655 6:137289749-137289771 CAGCGATGGCTGCTTCAGGCGGG - Intergenic
1019529832 7:1497856-1497878 AATCCAAGGGTCCTACAGCCAGG + Intronic
1019934590 7:4246029-4246051 ATTCCAAGGCTGATTCATGGAGG + Intronic
1020784757 7:12558875-12558897 AATAAAAAGCAGCTTCAGGCCGG - Intergenic
1022663037 7:32384320-32384342 AATACCTGTCTGCTTCAGGCTGG - Intergenic
1023398909 7:39777220-39777242 AATCAATGGCTGCCTAAGGCTGG - Intergenic
1023718942 7:43073163-43073185 AATCCAAGGCTGCTGGCAGCAGG - Intergenic
1025133734 7:56393272-56393294 AATCAATGGCTGCCTAAGGCTGG + Intergenic
1026044472 7:66897066-66897088 AATCCATGGTTGCCTGAGGCTGG - Intergenic
1026467539 7:70667525-70667547 AATCCAAGTAAGCTTCAGCCAGG + Intronic
1026843016 7:73681422-73681444 TAAACAAGGCTGCTTGAGGCTGG - Exonic
1027794715 7:82678203-82678225 CATCAAAAGCTGCTACAGGCAGG - Intergenic
1029957962 7:104659448-104659470 AATCCAAGGCTGCCCCAGCAGGG + Intronic
1030133136 7:106220077-106220099 AATCTAGGGCTGCATCAGGGAGG - Intergenic
1031146905 7:118006712-118006734 ATTCCAAGGCTGCTTGGGTCTGG - Intergenic
1032267583 7:130380018-130380040 TCCCCAAGGCAGCTTCAGGCAGG - Intergenic
1035010409 7:155710813-155710835 GATGCAAGGCTGCTACAGGGAGG + Intronic
1036601536 8:10265267-10265289 ACTCCATGTCTGCTCCAGGCTGG - Intronic
1040288303 8:46111562-46111584 ACTCCAGGGCTGTCTCAGGCAGG - Intergenic
1040294247 8:46141092-46141114 AACCCAGGGCTGTCTCAGGCGGG - Intergenic
1042460996 8:69068367-69068389 AAGCCCAGGCTGGTTCAAGCAGG + Intergenic
1045011045 8:97958607-97958629 AACCCAAAGCTACTTCAGCCCGG + Intronic
1046103793 8:109644174-109644196 AATCCGAGGCTGCGTGCGGCTGG - Exonic
1047007495 8:120635875-120635897 CATCCTTTGCTGCTTCAGGCTGG + Intronic
1047290030 8:123521789-123521811 ATGGCAAGGCTGCTTGAGGCTGG - Intronic
1048060290 8:130912442-130912464 AATGTAAGGCTGCCTCAGGCAGG - Intronic
1052122804 9:24738725-24738747 AATTCAAGCCTGGTGCAGGCAGG - Intergenic
1052938722 9:34115027-34115049 AATTCAAGGGTGTTTCAGACTGG + Intronic
1053072049 9:35107532-35107554 AAGCGAAGGCTGCTTCCTGCTGG - Exonic
1053095644 9:35325751-35325773 AATTCATGGTTGCTACAGGCTGG - Intronic
1055794862 9:79964893-79964915 AAACTAAGGCTGATTCAGGGAGG + Intergenic
1060583729 9:124772766-124772788 AATCCTTGGCTCCTTCAAGCTGG + Intergenic
1061047934 9:128177452-128177474 AATGCATGGCTGCTTGGGGCAGG + Intronic
1061744901 9:132732531-132732553 AATGCAAGGCTGATCCAAGCCGG + Intronic
1198136290 X:133753934-133753956 TGTCCAAGGCTGAATCAGGCAGG + Exonic