ID: 918476448

View in Genome Browser
Species Human (GRCh38)
Location 1:184930098-184930120
Sequence GTCTGTAAGAGACACATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 193}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918476448 Original CRISPR GTCTGTAAGAGACACATGGA AGG (reversed) Intronic
900299863 1:1971692-1971714 GTCCTCATGAGACACATGGAGGG - Intronic
900967214 1:5967042-5967064 GCCTGTGAGAGCCACCTGGAGGG - Intronic
901020383 1:6252359-6252381 GTCCGTAAGAGACGCAGGGGTGG + Intronic
902363075 1:15952700-15952722 GTGAGTGGGAGACACATGGAGGG + Intronic
903033517 1:20479932-20479954 GTCTGGAGGAGACAGATGAAGGG - Intergenic
904349198 1:29893978-29894000 GCCTGCAAGAGGCAGATGGAGGG - Intergenic
904375956 1:30082633-30082655 GTCTGGGAGAGAAAAATGGAAGG + Intergenic
906236934 1:44217715-44217737 GTCTGTCAGAGACCCAAGGAAGG - Intronic
908999758 1:70204716-70204738 GTGTGTAAGAGAGAGAGGGAGGG - Intronic
909615298 1:77602057-77602079 CTACGTAAGAGAAACATGGAAGG + Intronic
910684995 1:89907018-89907040 GTCTGTAAGAAACAGAAGAATGG + Intronic
912458448 1:109815550-109815572 GTCTGTAAGAGACAACTCCAGGG + Intergenic
913131674 1:115843172-115843194 GTCTCTAAGGGAGACATGAAAGG - Exonic
913391970 1:118324123-118324145 CTCTGTTAGATACACCTGGAGGG - Intergenic
913458140 1:119055160-119055182 GTTTTTAAAAGTCACATGGAAGG + Intronic
916855153 1:168741617-168741639 GTCTGTCAGAGAGAAAAGGAAGG - Intergenic
917751402 1:178056797-178056819 GACTGTAAGGGACACAGAGAAGG - Intergenic
918091119 1:181295947-181295969 GTCTCTAAGAGTTACTTGGAAGG + Intergenic
918476448 1:184930098-184930120 GTCTGTAAGAGACACATGGAAGG - Intronic
921737200 1:218642394-218642416 GTGTGTGAGAGACTCATGGAGGG - Intergenic
923712665 1:236399543-236399565 GACTGTCACAGTCACATGGAAGG + Intronic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
1063497290 10:6521744-6521766 CTCTGCAAGAGATAGATGGAGGG - Intronic
1066224186 10:33366230-33366252 GTTTTTAAGGGAGACATGGAGGG - Intergenic
1066321166 10:34305367-34305389 GTCTGTAAGTGGCCCATGGCTGG + Intronic
1068624240 10:59223545-59223567 ATCTGTAAAACACATATGGATGG + Intronic
1069919583 10:71808342-71808364 GGATGGAAGAGACAGATGGACGG - Intronic
1070538918 10:77402038-77402060 GTCTATAATGGCCACATGGAAGG + Intronic
1073191006 10:101650641-101650663 GTCTGTGACAGACACATGGATGG + Intronic
1073649125 10:105340272-105340294 GTCTGTGAGAGACAGATCCAAGG + Intergenic
1074356384 10:112788531-112788553 GTCTGTAAGAGACACATTTCAGG - Intronic
1075661040 10:124196750-124196772 GTCTGTGAGGGACAGATAGAAGG + Intergenic
1076188766 10:128468466-128468488 ATCTCTAAGAAACCCATGGAAGG + Intergenic
1077427006 11:2485401-2485423 GCCTGCAAGAGAGACATGAAAGG - Intronic
1078130864 11:8613002-8613024 GTCTGGGAGAGACAGAGGGAAGG + Exonic
1078177406 11:8980432-8980454 GTCAGTAAGAGACACCTGAAGGG + Intergenic
1078188974 11:9075908-9075930 TTCTGGAAGGGACACATGGAAGG + Intronic
1078741356 11:14069396-14069418 GACTCTATGAGACACATGGTAGG - Intronic
1081053343 11:38374552-38374574 GTCTGTTGAAGAAACATGGATGG - Intergenic
1081431099 11:42977493-42977515 GTCTGTCAGAATCATATGGAGGG - Intergenic
1081601288 11:44496646-44496668 GTGTGAAAGAGCCACAGGGAGGG - Intergenic
1083591653 11:63898909-63898931 GTCTGTAAGTGGCCCTTGGAGGG + Intronic
1085770346 11:79319989-79320011 GTAGGTGAGAAACACATGGAGGG - Intronic
1087220129 11:95538017-95538039 GTCTGTCAGAAACAAATTGAGGG - Intergenic
1088057747 11:105606046-105606068 GTCTGTAGCAGGAACATGGATGG + Intergenic
1090608759 11:128451699-128451721 GTCTGTGGGAGACAAATGAAAGG - Intergenic
1091129513 11:133133703-133133725 TGGTGTAAGAGACACAGGGATGG - Intronic
1092793942 12:12092392-12092414 CTCTGCTAGAGACACATGGTAGG + Intronic
1094028741 12:25986686-25986708 GACTACAAGAAACACATGGAAGG - Intronic
1096718927 12:53506994-53507016 GTCTGAAAGGGACACAAGCATGG - Intronic
1097720683 12:63017122-63017144 GTTTATAATAGACAAATGGAAGG + Intergenic
1097891827 12:64784373-64784395 GTCTGTAACAAACAAATGCAGGG - Intronic
1098189245 12:67930535-67930557 CATTGTAAGAGACAAATGGAAGG - Intergenic
1102612150 12:114121724-114121746 GTCAGGAAGAGACACAAGGTGGG + Intergenic
1107760810 13:43676482-43676504 GTCTGAAAGAGAAACAGTGAAGG + Intronic
1108184528 13:47875335-47875357 GGCTGTACCAGACACATGGCTGG + Intergenic
1109258086 13:60108643-60108665 GTCTCTAACAGAGGCATGGAGGG + Intronic
1111574101 13:90127620-90127642 GTCTGTGAGGGACACATACATGG + Intergenic
1112389100 13:98966354-98966376 GTGTGTGAGAGACACATGCTGGG - Intronic
1115188336 14:30718304-30718326 CTCTGTCATAAACACATGGATGG + Intronic
1115716926 14:36116054-36116076 GACTGTAAGTTCCACATGGAAGG + Intergenic
1115808904 14:37083781-37083803 ATGCGTAAGAGTCACATGGAGGG - Intronic
1120300111 14:82695234-82695256 GTCCGTATGAGACACATGTGTGG + Intergenic
1124369746 15:29097377-29097399 GTCTGTAAGAGGCACCTGGGAGG - Intronic
1125006970 15:34827665-34827687 GTCTCTAAGAGAAACATTGAAGG - Intergenic
1126098113 15:45103522-45103544 GTCAGGAAGAGAAACGTGGAAGG - Intronic
1126387446 15:48108748-48108770 GTCAGCAAGAGAAACATGAACGG - Intergenic
1131320380 15:91384247-91384269 GTCTCAAAGATACACATGTAGGG - Intergenic
1132835850 16:1953041-1953063 TTCTGGATGAGACACAGGGATGG + Exonic
1132845621 16:1999633-1999655 GTCGTTAATGGACACATGGAGGG - Exonic
1134518195 16:14903920-14903942 GTCCGTAGGAGTCATATGGATGG - Intronic
1134705866 16:16302578-16302600 GTCCGTAGGAGTCATATGGATGG - Intergenic
1134961674 16:18409532-18409554 GTCCGTAGGAGTCATATGGATGG + Intergenic
1134965973 16:18492135-18492157 GTCCGTAGGAGTCATATGGATGG + Intronic
1135888797 16:26338474-26338496 GTCTTTAAGGGACAGATAGAGGG + Intergenic
1135888913 16:26339447-26339469 GTCTTTAAGGGACAGATAGAGGG - Intergenic
1136640552 16:31561161-31561183 GTCTTTCACAGAAACATGGATGG + Intergenic
1137710936 16:50566471-50566493 GACTGTCAGAGGCACAGGGATGG - Intronic
1139764849 16:69219119-69219141 GTATGTATTAGACACTTGGATGG - Intronic
1140128851 16:72140061-72140083 ATCTGTAAGAGCTGCATGGAAGG - Intronic
1141798591 16:86291708-86291730 GTGTGTCAGAGAGACAGGGACGG - Intergenic
1141929980 16:87195956-87195978 AGCTGTAAGAGACAAGTGGATGG + Intronic
1143736242 17:8913808-8913830 AACTGTAAAAGTCACATGGAAGG - Intronic
1144210980 17:13015241-13015263 CTCAATAAGAGACAAATGGATGG + Intronic
1144688884 17:17246067-17246089 GTTTTTAAGAGACAAATGGCAGG - Intergenic
1156850146 18:41716631-41716653 GTCTATTAGAGATACATAGAGGG - Intergenic
1161514861 19:4690823-4690845 GTGTGTAAAACACACATGCATGG + Intronic
1161587596 19:5113960-5113982 TTCTGGAAGAGACCCATGTAAGG - Intronic
1163442755 19:17329887-17329909 GTCTGTATGGGGCACAAGGAAGG - Intronic
925550081 2:5064223-5064245 ATGTGTAAGAAACACATTGATGG - Intergenic
926151059 2:10425787-10425809 GCCTCAAACAGACACATGGAGGG + Intronic
926789973 2:16560691-16560713 ATCTGTAAGAACCAAATGGAGGG - Intronic
927172254 2:20379924-20379946 GTCCCTGAGAGAGACATGGATGG - Intergenic
927815783 2:26216175-26216197 GTCTGTAAGAGCCACATTGGAGG + Intronic
928432132 2:31228945-31228967 GTTTGGAAGAGACACCTGGTGGG + Intronic
929523558 2:42677864-42677886 GTGTGTGAGAGAGACAGGGAGGG - Intronic
931140914 2:59456637-59456659 GTCAGAAAAAGACACAGGGATGG + Intergenic
933212415 2:79586060-79586082 GTCTGAAACCGACCCATGGAGGG + Intronic
935111931 2:100103017-100103039 GCCTGTAAAACACACAAGGACGG - Intronic
936123038 2:109762136-109762158 GCCTGTAAAACACACAAGGACGG + Intergenic
936221647 2:110609328-110609350 GCCTGTAAAACACACAAGGACGG - Intergenic
936694725 2:114932200-114932222 GTCTATCAGAGTCACCTGGAGGG - Intronic
936914928 2:117630492-117630514 GTTTGTAAGAGATACAGAGAAGG - Intergenic
937059706 2:118971857-118971879 GTAGGTAAGAGTCACCTGGAAGG - Intronic
939172091 2:138707983-138708005 TTCAGTAAGAGAGAAATGGAGGG - Intronic
941856543 2:170236827-170236849 CTTTGAAAGAGACATATGGAAGG - Intronic
942666856 2:178328858-178328880 ATCTGTAATATACATATGGAGGG + Intronic
943280311 2:185923916-185923938 ATTTTTCAGAGACACATGGAGGG - Intergenic
943556422 2:189411016-189411038 TTTTCTTAGAGACACATGGAGGG - Intergenic
944866395 2:203866646-203866668 GCCTGAAAGAGGCACGTGGAAGG + Intergenic
946354341 2:219175671-219175693 GTCTGCAAGGGACAGAAGGAAGG + Exonic
947465884 2:230345395-230345417 GCATGTAAGAGACTCATGGTAGG - Intronic
947922299 2:233887879-233887901 GTCTATCAGAGTCACAGGGAGGG + Intergenic
1169703016 20:8469981-8470003 GTCTGGAAGAGACAAATCCATGG - Intronic
1170127500 20:12981102-12981124 ATCTGAAAGAGACACAAGGAAGG - Intergenic
1171415196 20:24973606-24973628 GACTGGAAGAGACACATCGAGGG + Intronic
1172672045 20:36641377-36641399 ATCTGAAAGAGACACAGTGATGG + Exonic
1172992193 20:39044801-39044823 GTCCTTAGGAGACACATGTAAGG + Intergenic
1174297293 20:49557878-49557900 GGCTGTAAGAGAAAGAGGGAAGG - Intronic
1174335285 20:49855417-49855439 AACTGTAAGAGACAGAGGGAAGG - Exonic
1176343446 21:5719180-5719202 TTCTGTACGAGAGACATGCAAGG + Intergenic
1176501381 21:7605276-7605298 TTCTGTACGAGAGACATGCAAGG - Intergenic
1176537767 21:8117249-8117271 TTCTGTACGAGAGACATGCAAGG + Intergenic
1178716885 21:34973112-34973134 GTCTCTAAGAGACAGATGGAGGG - Intronic
1179516513 21:41912077-41912099 GTCTGTAAGAGACCCCACGATGG + Intronic
1181976613 22:26735425-26735447 GGCTGAAAGAGACACCTGGTGGG - Intergenic
1183213705 22:36466223-36466245 GTCTGTCACAAGCACATGGAGGG - Intergenic
1185214993 22:49593683-49593705 GTCTCTGAGACACACATGGATGG + Intronic
1203242713 22_KI270733v1_random:33604-33626 TTCTGTACGAGAGACATGCAAGG + Intergenic
950522192 3:13504073-13504095 CTCTGGGAGAGAGACATGGATGG - Exonic
953285429 3:41602189-41602211 GTCTGTAAGAAAGAAAGGGAAGG + Intronic
958005454 3:87804182-87804204 GTATGTCAGAAACACCTGGATGG - Intergenic
958913619 3:100023343-100023365 GTCTGAAAGTCAAACATGGATGG + Intronic
960215584 3:115032361-115032383 GGCTGCAGGAGACACAAGGAAGG + Intronic
960575255 3:119222810-119222832 GTCTTTAAGAAACACCTTGAAGG - Intronic
961311673 3:126006103-126006125 GTGTGTATGAGAAACCTGGAGGG + Intergenic
962909873 3:139838228-139838250 GACTGTAAGAGATACATAGTGGG + Intergenic
964450882 3:156811775-156811797 TTCAGTAAGAGAAACAGGGAGGG + Intergenic
967639917 3:191849960-191849982 ATGTGTAAGAGACACATATATGG + Intergenic
968885405 4:3328078-3328100 GTCTTTCACAGCCACATGGATGG + Intronic
972106763 4:35497407-35497429 GTCTTTTACAGAAACATGGATGG + Intergenic
973856634 4:55017593-55017615 GTCAGTAAGAGAGACATGTCTGG - Intergenic
974274451 4:59699662-59699684 GTGCGTAAGAGTCACCTGGAAGG - Intergenic
974668977 4:65003563-65003585 ATCTTTAAGAGACAGCTGGAGGG - Intergenic
975079001 4:70252240-70252262 GTCTTGAACAGAGACATGGAAGG + Intergenic
975946460 4:79711254-79711276 ACCTGTAAGGGACACATGGATGG + Intergenic
976834921 4:89361296-89361318 ATCTGAAAGAGACAAAAGGAAGG - Intergenic
977174547 4:93804176-93804198 GTCTGTGATAGTCTCATGGATGG - Intergenic
979004301 4:115270702-115270724 GTGTGTAAAAGAGAGATGGAGGG + Intergenic
980206329 4:129723419-129723441 GTCTTTTACAGAAACATGGAGGG + Intergenic
982091899 4:151887287-151887309 GTATTTAAGAGACACATTCATGG - Intergenic
982537167 4:156621102-156621124 GTCTATAGGAGACACATGCCTGG - Intergenic
985200051 4:187475631-187475653 GTCTTTAAAAAACACATAGAAGG + Intergenic
987403323 5:17500253-17500275 GTGTCTTAGAGACACAAGGAGGG + Intergenic
987410154 5:17606803-17606825 GTGTCTTAGAGACACAAGGAGGG + Intergenic
987413366 5:17636480-17636502 GTGTCTTAGAGACACAAGGAGGG + Intergenic
988327355 5:29787424-29787446 GTCTGTAAGAGATGTAGGGATGG - Intergenic
988327626 5:29790384-29790406 GTCTGTAAAAGATGTATGGATGG + Intergenic
994869263 5:105323858-105323880 GTCTGTGAGAGAGACAAGAAAGG - Intergenic
996687978 5:126305440-126305462 GTCCTTTACAGACACATGGATGG + Intergenic
1000040765 5:157483545-157483567 GTCTGTAACAGAAAAAAGGAAGG + Intronic
1002897228 6:1386454-1386476 GTCTGTAACAAACAGATGCAGGG + Intergenic
1004892678 6:20116490-20116512 GTTTGTAAGGGACAGAAGGAAGG + Intronic
1005129884 6:22494533-22494555 GTGTGTAAAAGAAACATGGTGGG - Intergenic
1005530875 6:26704496-26704518 GTGTGTGAAATACACATGGAGGG - Intergenic
1005539921 6:26797150-26797172 GTGTGTGAAATACACATGGAGGG + Intergenic
1006355810 6:33557085-33557107 ATGTGAGAGAGACACATGGAGGG + Intergenic
1009012738 6:57862066-57862088 GTGTGTGAAATACACATGGAGGG + Intergenic
1009699035 6:67151167-67151189 GTAGGTAAGAGACACAAGGCAGG + Intergenic
1010947653 6:81997027-81997049 CCCTGTAAGAAACACAAGGAAGG - Intergenic
1012279831 6:97315483-97315505 GTCTGTAATATACACATGGCAGG - Intergenic
1013115681 6:107102204-107102226 GCCTGCCAGAGACACATGGTTGG - Intronic
1013184836 6:107748768-107748790 GGCTGTGAGAAACACAGGGAGGG + Intronic
1013674062 6:112437318-112437340 GTCTGCAAGTGACACATTGAAGG - Intergenic
1017455148 6:154594744-154594766 TTCTGTAAAAGACTCAGGGAAGG - Intergenic
1020344605 7:7149405-7149427 GACTGTAAGAGACTAATGGTAGG - Intergenic
1020809385 7:12833080-12833102 GGCTGTAAAAGAAGCATGGATGG + Intergenic
1021463902 7:20920225-20920247 GACCTTAAGAGACACCTGGAAGG - Intergenic
1021490673 7:21217210-21217232 GTCTTTATGAGAAAAATGGAAGG + Intergenic
1024486586 7:49926745-49926767 GTCTGTAAGAGAAAAAGGGAAGG + Intronic
1024800381 7:53071001-53071023 GCCTTTAGGAGAGACATGGAGGG - Intergenic
1024813178 7:53237091-53237113 GTCTGAAAGAGATACCTGTAAGG - Intergenic
1025115941 7:56258130-56258152 GTAGGTAAGAGACAAATGGTTGG + Intergenic
1029288307 7:99481939-99481961 CCCTGTAATAGACACATAGACGG - Intronic
1032730514 7:134637683-134637705 TTCTGTAAATGACACATGGAGGG + Intergenic
1033277590 7:139984361-139984383 ATGTGGAAGGGACACATGGAAGG - Intronic
1033864259 7:145669148-145669170 GTCTTTAACTGACACAAGGAAGG + Intergenic
1034310187 7:150080628-150080650 GTCAGCAAGAGACACCTAGATGG + Intergenic
1034796658 7:154020015-154020037 GTCAGCAAGAGACACCTAGATGG - Intronic
1037696948 8:21231720-21231742 TTCTGTAAGAGACACAGGTAGGG + Intergenic
1038918293 8:32052188-32052210 CTCTGTAAGAGCCATATGGTTGG + Intronic
1040671567 8:49697861-49697883 GTCTGTGAAAGACAGAGGGAAGG + Intergenic
1042338740 8:67656671-67656693 CTCTGTAAGAGAGCCTTGGAGGG + Intronic
1042841318 8:73126717-73126739 GTCTATCAGAAACACTTGGAAGG - Intergenic
1043357959 8:79435967-79435989 TTCTATAAGAGGAACATGGAAGG - Intergenic
1044874223 8:96648420-96648442 GACTGTAACAAACACATGAATGG - Intronic
1046229174 8:111331090-111331112 GTCTGTCAGGGACAGGTGGAGGG - Intergenic
1046758903 8:118000198-118000220 GTGTATAAAAGACAGATGGAAGG + Intronic
1048339277 8:133526238-133526260 GTGTCTAGGAGACACAGGGATGG - Intronic
1050425896 9:5512359-5512381 GTGTGTTAGAGACAGCTGGAAGG - Intronic
1051075961 9:13236579-13236601 GTTTATAAAATACACATGGAGGG - Intronic
1053166459 9:35847098-35847120 GTCTGTAGAAGACACAGTGAAGG - Intronic
1057272493 9:93658803-93658825 ATCGGTAAGAGTCACAGGGAGGG - Intronic
1059860873 9:118460040-118460062 ATCTGTAAGATTCACAGGGATGG - Intergenic
1060901088 9:127258844-127258866 GACAGTAAGAAACAGATGGAAGG - Intronic
1062477874 9:136738265-136738287 GCCTGGAACAGACACTTGGAGGG + Intronic
1203459039 Un_GL000220v1:16687-16709 TTCTGTACGAGAGACATGCAAGG + Intergenic
1186983068 X:14979071-14979093 GTCAGAAAGAGACAGGTGGAGGG + Intergenic
1188142571 X:26569849-26569871 GATGGTAAGAGACACATGGATGG - Intergenic
1188695587 X:33186330-33186352 TTCTGTAAGAGATACAAAGATGG + Intronic
1188983735 X:36751233-36751255 ATCTGCAAGAGATACATAGATGG - Intergenic
1192795709 X:74422629-74422651 GTCTGCAAGAGAGAAAGGGAGGG + Intronic
1193388577 X:80899995-80900017 GGCTGGAGGAGACAGATGGAGGG - Intergenic
1194397269 X:93401812-93401834 GTGTGGAAGAGCCACAGGGATGG + Intergenic
1197299946 X:124766099-124766121 GTCTGTGAGATAGACATGGAAGG + Intronic