ID: 918478578

View in Genome Browser
Species Human (GRCh38)
Location 1:184952481-184952503
Sequence TGGGATTCCCCGGGCCACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1662
Summary {0: 1, 1: 1, 2: 17, 3: 529, 4: 1114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918478574_918478578 -5 Left 918478574 1:184952463-184952485 CCAGGGGTGTCCAGTCTTTGGGA 0: 1
1: 1
2: 19
3: 171
4: 374
Right 918478578 1:184952481-184952503 TGGGATTCCCCGGGCCACATTGG 0: 1
1: 1
2: 17
3: 529
4: 1114
918478566_918478578 24 Left 918478566 1:184952434-184952456 CCATGACGTTTGAGGTTTTAAGG 0: 1
1: 0
2: 2
3: 5
4: 103
Right 918478578 1:184952481-184952503 TGGGATTCCCCGGGCCACATTGG 0: 1
1: 1
2: 17
3: 529
4: 1114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918478578 Original CRISPR TGGGATTCCCCGGGCCACAT TGG Intronic
900140504 1:1137564-1137586 TTGGCTTCCCTGGGCCACATTGG + Intergenic
900280740 1:1866556-1866578 TTGGCTTCCCTGGGCCACATTGG + Intronic
900994726 1:6114405-6114427 TCGGCTTCCCTGGGCCACACTGG + Intronic
901152683 1:7114366-7114388 TTGGCTTCCCTGGGCCACACTGG + Intronic
901255277 1:7819871-7819893 TTGGCTTCCCTGGGCCACACTGG - Intronic
901304943 1:8226093-8226115 TTGGCTTCCCTGGGCCATATTGG - Intergenic
901371299 1:8800159-8800181 TTGGCTTCCCTGGGCCACATTGG - Intronic
901428206 1:9196975-9196997 TGGGATTCCCTGGGACATGTGGG - Intergenic
901683976 1:10933477-10933499 TTGGCTTCCCTGGGCCACAGTGG - Intergenic
901864613 1:12096325-12096347 TCGGCTTCCCTGGGCCACATTGG + Intronic
901952931 1:12762841-12762863 TTGGCTTCCCTGGGCTACATTGG + Exonic
902131705 1:14267284-14267306 TTGGCTTCCCTGGGCCACACTGG + Intergenic
902163079 1:14547956-14547978 TTGGATTCCCTGGGCCACACTGG + Intergenic
902200867 1:14832527-14832549 TTGGCTTCCCTGGGCCACACTGG + Intronic
902284201 1:15395867-15395889 TTGGCTTCCCTGGGCCACACTGG - Intronic
902866009 1:19280003-19280025 TTGGTTTCCCTGGGCCACACTGG - Intergenic
902927387 1:19705107-19705129 TTGGCTTCCGTGGGCCACATTGG + Intronic
903299771 1:22370403-22370425 TTGGCTTTCCTGGGCCACATTGG + Intergenic
903587234 1:24425392-24425414 TTGGCTTCCCTGGGCCACATTGG - Intronic
903630624 1:24766948-24766970 TTGGCTTCCCTGGGCCACACTGG + Intronic
903669484 1:25027090-25027112 TGGGATTCCCCTCGCCTGATCGG - Intergenic
903715095 1:25359432-25359454 TTGGCTTCCCTGGGCCATATTGG + Intronic
903738919 1:25546900-25546922 TTGGCTTCCCTGGGCCACACTGG - Intronic
903930572 1:26859707-26859729 TTGGCTTCCCTGGGCCACATTGG - Intergenic
904033011 1:27544840-27544862 TGGAATTCCCCAGGCCACCGTGG - Intronic
904049463 1:27630434-27630456 TTGGCTTCCCTGGGCCGCATTGG - Intronic
904405042 1:30282926-30282948 TTGGCTTCTCTGGGCCACATTGG - Intergenic
904511857 1:31017596-31017618 TTGGCTTCCCTGGACCACATTGG - Intronic
905330959 1:37196885-37196907 TTGGCTTCCCTGGGCCACATTGG - Intergenic
905367151 1:37458807-37458829 TTGGCTTCCCTGGGCCACACTGG + Intergenic
905373994 1:37505559-37505581 TTGGTTTCTCTGGGCCACATTGG - Intronic
905672061 1:39798254-39798276 TTGGCTTCCCTTGGCCACATTGG + Intergenic
905746888 1:40425792-40425814 TTGGCTTCCCTGGGCCACATTGG + Intergenic
906075365 1:43048214-43048236 TTGGCTTCCCTGGGCCACATTGG - Intergenic
906390981 1:45416023-45416045 TTGGCTTCCCTGGGCCATATTGG - Intronic
906543014 1:46602722-46602744 TTGGCTTCCCTGGGCCACATTGG - Intronic
906820541 1:48925593-48925615 TTGGCTTCCCTGGGCCACATTGG - Intronic
906872213 1:49495433-49495455 TTGGATTCCCTGGGCCATGTTGG - Intronic
907086016 1:51674827-51674849 TTGCCTTCCCTGGGCCACATTGG + Intronic
907441443 1:54481053-54481075 TTGGCTTCCCTGGGCCACACTGG - Intergenic
907541242 1:55216478-55216500 TTGGCTTCCCTGGGCTACATTGG + Intergenic
907601767 1:55778889-55778911 TTGGCTTCCCTGGGCCACAGTGG - Intergenic
907895860 1:58690752-58690774 TTGGCTTCCCTGGGCCACACTGG - Intronic
908091818 1:60694200-60694222 TTGGCTTCCTTGGGCCACATTGG - Intergenic
908197464 1:61759279-61759301 TTGGCTTCCCTGGGCCACATTGG - Intronic
908249777 1:62256137-62256159 TTGGCTTCCCTGGGCCACATTGG - Intronic
908357542 1:63337371-63337393 TTGGCTTCCCCGGGCCACACTGG + Intergenic
908366979 1:63434688-63434710 TTGGCTTCCCTGGGCCACACTGG - Intronic
908679123 1:66640129-66640151 TTGGCTTCCCTAGGCCACATTGG - Intronic
908794965 1:67821986-67822008 TTGGCTTCCCTGGGCCACACTGG + Intronic
908979899 1:69943053-69943075 CTGGCTTCCCTGGGCCACATTGG - Intronic
909330684 1:74406396-74406418 TTGGCTTCCCTGGGCCACACTGG - Intronic
909389173 1:75098683-75098705 TTGGCTTCCTTGGGCCACATTGG - Intergenic
909443287 1:75721487-75721509 TTGGCTTCCCTGGGCCACACTGG - Intergenic
909475965 1:76081204-76081226 TTGGCTTCCTTGGGCCACATTGG + Intronic
909613306 1:77576696-77576718 TTGGCTTCCCCGGGCTACATTGG + Intronic
909630813 1:77768021-77768043 TTGGCTTCCCTGGGCCACACTGG - Intergenic
909747684 1:79119065-79119087 TTGGTTTCCCTGGGCCACATTGG + Intergenic
909987682 1:82182972-82182994 TTGGCTTCCCTGGGCCACATTGG - Intergenic
910109279 1:83665174-83665196 TTGGCTTCCCCTGGTCACATTGG - Intergenic
910209623 1:84779771-84779793 TTGGCTTCCCTGGGCCACTTTGG - Intergenic
910275838 1:85448211-85448233 TCGGCTTCCCTGGGCCACATTGG - Intronic
910730579 1:90391644-90391666 TTGGCTTCCCTGGGCCACACTGG + Intergenic
910823528 1:91379386-91379408 TTGGCTTCCCTGGGCCACACTGG + Intronic
910863394 1:91765125-91765147 TTGGCTTCCCTGGGCCACATTGG - Intronic
911141069 1:94503131-94503153 TTGGTTTCCCTGGGCCACACTGG - Intronic
911236193 1:95415086-95415108 TTGGATTCCCTGGGCCACACTGG - Intergenic
911555209 1:99335950-99335972 TGGGATGCCCAGGCCCACAAAGG + Intergenic
911586261 1:99694847-99694869 TTGGCTTCCCTGAGCCACATTGG + Intergenic
911651773 1:100397111-100397133 TTAGCTTCCCTGGGCCACATTGG - Intronic
911680854 1:100713504-100713526 TTGGCTTCCCTGGGCCACATTGG + Intergenic
911809123 1:102251548-102251570 TTGGCTTCCCTGAGCCACATTGG + Intergenic
911868224 1:103055782-103055804 TTGGCTTTCCTGGGCCACATTGG - Intronic
911933774 1:103939777-103939799 TTGGCTTCCCTGGGCCACATTGG + Intergenic
912328208 1:108789393-108789415 TTGGCTTCCCTGGGCCACACTGG - Intronic
912933949 1:113986614-113986636 TTGGCTTCCCTGGGTCACATTGG + Intergenic
913061052 1:115208477-115208499 TTGGCTTTCCGGGGCCACATTGG + Intergenic
913088328 1:115459100-115459122 TAGCATTCCCTGGGCCACAAAGG - Intergenic
913235162 1:116774684-116774706 TTGGCTTCCCTGGGCCACACTGG - Intergenic
913394275 1:118349252-118349274 TTGGCTTCCCTGGGCCACATTGG - Intergenic
913703867 1:121398540-121398562 TTGGCTTCTCAGGGCCACATTGG + Intergenic
913942518 1:125121043-125121065 TTGGCTTCTCAGGGCCACATTGG + Intergenic
913980218 1:143500246-143500268 TTGGCTTCTCAGGGCCACATTGG + Intergenic
914074567 1:144325734-144325756 TTGGCTTCTCAGGGCCACATTGG + Intergenic
914104609 1:144640712-144640734 TTGGCTTCTCAGGGCCACATTGG - Intergenic
914145824 1:144994045-144994067 TTGGTCTCCCTGGGCCACATTGG - Intronic
915155844 1:153875280-153875302 TTGGCTTCCCTGGGCCACAATGG + Intronic
915215297 1:154336366-154336388 TTGGCATCCCTGGGCCACATTGG + Intronic
915617398 1:157049755-157049777 TTGGCTTCCCTGGGCCACACTGG - Intergenic
915667116 1:157455295-157455317 TTGGCTTCCCTTGGCCACATTGG + Intergenic
915882424 1:159685908-159685930 TTGGCTTCCCTGGGCCGCATTGG + Intergenic
915933189 1:160072990-160073012 TTGGTTTCCCTGGGCCACATTGG + Intergenic
916049837 1:161028568-161028590 TTGGCTTCCCTGGGCCACACTGG + Intronic
916430614 1:164724386-164724408 TTGGCTTCCCTGGGCCACAATGG + Intronic
916531589 1:165661443-165661465 TTGGCTTCCCTGGGCCACACTGG + Intronic
916743552 1:167666931-167666953 TTGGTTTCCCTGGGCCACAGTGG - Intronic
917806982 1:178622601-178622623 TTGGCTTCCCTGGGCCACACTGG + Intergenic
917919545 1:179739616-179739638 TTGGCTTCTCTGGGCCACATTGG - Intergenic
918310331 1:183281131-183281153 TTGGCTTCCCTGGGCAACATTGG - Intronic
918385062 1:183997484-183997506 TTGGCTTCCCTGGGCCACACTGG + Intronic
918478578 1:184952481-184952503 TGGGATTCCCCGGGCCACATTGG + Intronic
918527956 1:185485730-185485752 TTGGCTTCCCTGGGCCACACTGG + Intergenic
918540392 1:185625868-185625890 TTGGCTTCCCTGGGCCACACTGG - Intergenic
918733190 1:188023631-188023653 TTCGCTTCCCTGGGCCACATTGG + Intergenic
918737286 1:188080944-188080966 TGGGCTTCCCTGGGTCACATTGG + Intergenic
919005234 1:191890639-191890661 TTGGCTTCCCTGGGCCACACTGG + Intergenic
919447831 1:197731628-197731650 TTGGCTTCCCTGGGCCACAGTGG + Intronic
919499735 1:198322739-198322761 TTGGCTTCCCTGGGCCACATTGG + Intergenic
919537150 1:198801498-198801520 TTGGCTTCCCTGGGCCACATTGG + Intergenic
919633854 1:199985152-199985174 TTGGCTTCCCTGGGCCACACTGG + Intergenic
919736323 1:200954162-200954184 TTGGCTTCCCTGGGCCATATTGG + Intergenic
919952356 1:202377046-202377068 TTGGCTTCCTTGGGCCACATTGG - Intronic
920013496 1:202887417-202887439 TTGGCTTCCCTGGGCCATATTGG - Intronic
920202930 1:204271199-204271221 TTGGCTTCCCTGGGCCACACTGG - Intronic
920268602 1:204745649-204745671 TTGACTTCCCTGGGCCACATTGG + Intergenic
920318214 1:205095452-205095474 TTGACTTCCCTGGGCCACATTGG - Intronic
920347976 1:205318867-205318889 TGGGATTATCAGGGCCAGATGGG - Intronic
920479052 1:206304419-206304441 TTGGTCTCCCTGGGCCACATTGG + Intronic
920493315 1:206436158-206436180 TTGGCTTCCCTGGACCACATTGG - Intronic
920497514 1:206465905-206465927 TTGGCTTCTCTGGGCCACATTGG - Intergenic
920608480 1:207413540-207413562 TTGGCTTCCCTGGGCCACATTGG + Intergenic
920613706 1:207468425-207468447 TTGGCTTCCCTGGGCAACATTGG - Intronic
920717789 1:208357321-208357343 TTGGCTTCCCTGGGCCACATTGG - Intergenic
920892809 1:210008943-210008965 TTGGCTTCCCTGGGCCACATGGG + Intronic
921118389 1:212115701-212115723 TTGGCTTCCCTGGGCCACATTGG + Intergenic
921141323 1:212309740-212309762 TTGGCTTCCCTGGGCCACATTGG + Intronic
921331799 1:214046363-214046385 TTGGCTTCCCTGGGCCACATTGG - Intergenic
921432143 1:215078033-215078055 TTGGCTTCCTTGGGCCACATTGG + Intronic
921472461 1:215565986-215566008 TTGGCTTTCCTGGGCCACATTGG - Intergenic
921596389 1:217057895-217057917 TTGGCTTCCCTGGGCCACGTTGG - Intronic
921660174 1:217791985-217792007 TTGGCTTCCCTGGGCCACACTGG + Intronic
921688640 1:218121317-218121339 TTGGTTTCTCTGGGCCACATTGG - Intergenic
921784887 1:219218575-219218597 TTGGCTTCCCTGGGCCACACTGG - Intergenic
921808687 1:219486655-219486677 TTGGCTTCCCTGGGCCACACTGG - Intergenic
921935232 1:220789355-220789377 TTGGCTTCCCTGGGCCACATTGG + Intronic
922237101 1:223730417-223730439 TTGGCTTCCCTGGGCCACACTGG - Intronic
922307748 1:224358653-224358675 TTGGCTTCCCTGGGCCACACTGG - Intronic
922435985 1:225607151-225607173 TTGGCTTCCCTGGGCCACACTGG + Intronic
922641346 1:227234988-227235010 TTGGCTTCCTTGGGCCACATTGG - Intronic
922809730 1:228408812-228408834 TGGGAGTCCCCGGGCCCTAGTGG + Intronic
922884067 1:229004596-229004618 TGTGCTTCCCCGGCCCACCTGGG + Intergenic
923116752 1:230947479-230947501 TTGGCTTCCCTGGGCCACATTGG + Intronic
923329672 1:232911073-232911095 TTGGCTTCCCTGGGCCACACTGG - Intergenic
923570460 1:235108623-235108645 TTGGTTTCCCTGGGCCACACTGG - Intergenic
923717136 1:236434621-236434643 TGGGCTTCCCTGGGCCACATTGG - Intronic
923764263 1:236878534-236878556 TTGGTTTCCCCGGGCCACATTGG + Intronic
923827639 1:237517414-237517436 TTTGCTTCCCTGGGCCACATTGG + Intronic
923941035 1:238827522-238827544 TTGGCTTCCCTGGGCCACATTGG + Intergenic
924146023 1:241075515-241075537 TTGGCTTCCCTGAGCCACATTGG + Intronic
924359651 1:243224375-243224397 TCGGCTTCCCCGGGCCACACTGG + Intronic
924376230 1:243412295-243412317 TTGGCTTCCCTGGGCCACACTGG + Intronic
924519765 1:244795786-244795808 TTGGCTTCCCTGGGCCACATTGG + Intergenic
924588583 1:245381570-245381592 TCGGCTTCCCTGGGCCACATTGG - Intronic
924666174 1:246074141-246074163 TTGGCTTCCCTGGGCCACACTGG - Intronic
924953461 1:248906496-248906518 TGGGATTCCGAGGGCCGCAAGGG + Intronic
1063136092 10:3217631-3217653 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1063215955 10:3925600-3925622 TGGGATTCACCGGGAGGCATGGG + Intergenic
1063403582 10:5771499-5771521 TTGGCTTCCCTGTGCCACATTGG - Intronic
1063405282 10:5788512-5788534 TTGGCTTCCCTGGGCCACGTTGG + Intronic
1063524533 10:6772624-6772646 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1063536311 10:6887113-6887135 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1063617565 10:7614555-7614577 TTGGCTTCCCTGGGCCACACTGG - Intronic
1063738729 10:8793408-8793430 TTGACTTCCCTGGGCCACATTGG - Intergenic
1064051313 10:12062079-12062101 TTGGCTTCCCTGGGCCACAGTGG + Intergenic
1064054137 10:12083200-12083222 TTGGCTTCCCTGGGCCACATTGG + Intronic
1064140893 10:12789294-12789316 TTGGTTTCCCTGGGCCACAGTGG - Intronic
1064512475 10:16110614-16110636 TCTGCTTCCCTGGGCCACATTGG + Intergenic
1064862242 10:19839436-19839458 TTGGCTTCCCTGGGCCACATTGG - Intronic
1064918254 10:20486596-20486618 TTGGCTTCCCTGGGCTACATTGG - Intergenic
1065053901 10:21823655-21823677 TTGGCTTCCCTGGGCCACAGTGG + Intronic
1065248364 10:23783106-23783128 TTGGCTTCCCTGGGCCACACTGG + Intronic
1065275502 10:24081631-24081653 TTGGCTTCCCTGGGCCACATTGG + Intronic
1065354272 10:24824070-24824092 TGGGCTTCCCTGGGCTACATTGG + Intergenic
1065607236 10:27430393-27430415 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1065674989 10:28164744-28164766 TTGGGTTCCCTGGGCCACATTGG - Intronic
1065718702 10:28603157-28603179 TTGGCTTCCCTGGGCCACATTGG + Intronic
1065796427 10:29312459-29312481 TTGGCTTCCCTGGGCCATATTGG - Intronic
1065926053 10:30434427-30434449 TGGGAATCCCCGGGGCACCCAGG - Intronic
1066128378 10:32364980-32365002 TTGGCTTCCCTGGGCCACATTGG - Intronic
1066176083 10:32907741-32907763 TTGGCTTCCCTGGGCCACACTGG + Intronic
1066246408 10:33587470-33587492 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1066250618 10:33629390-33629412 TTGGCTTCCCTGGGGCACATTGG + Intergenic
1066264469 10:33762314-33762336 TTGGCTTCCCTGGGCTACATTGG - Intergenic
1066283556 10:33941747-33941769 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1066291450 10:34017835-34017857 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1066296520 10:34058721-34058743 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1066302272 10:34107566-34107588 TTGGCTTCCCTGGGCCACGTTGG + Intergenic
1066326904 10:34369411-34369433 TTGGCTTCCCTGGGCCACACTGG - Intronic
1066359556 10:34717033-34717055 TTGGTATCCCCGGGCCACACTGG - Intronic
1066443330 10:35459476-35459498 TTGGTTTCCCTGGGCCACAATGG - Intronic
1066443456 10:35460408-35460430 TTGGCTTCCCTGGGCCACATTGG + Intronic
1066780981 10:38944046-38944068 TTGGCTTCTCAGGGCCACATTGG + Intergenic
1066953901 10:42148074-42148096 TTGGCTTCTCAGGGCCACATTGG - Intergenic
1067137804 10:43626639-43626661 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1067138431 10:43632887-43632909 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1067486631 10:46656695-46656717 TTGGCTTCCCTGGGCCACAACGG + Intergenic
1067608120 10:47684967-47684989 TTGGCTTCCCTGGGCCACAACGG - Intergenic
1068036764 10:51769766-51769788 TTGGCTTCCCTGGCCCACATTGG + Intronic
1068525137 10:58120119-58120141 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1068637870 10:59367837-59367859 TTGGCTTCCCTGGGTCACATTGG - Intergenic
1069204173 10:65661144-65661166 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1069261597 10:66404849-66404871 TTGGCTTCCCTGGGCCACAGTGG - Intronic
1069575736 10:69527213-69527235 TTGGCTTCCCTGGGCCACGTTGG + Intergenic
1070260343 10:74848628-74848650 TTGGCTTCCCTGGGCCACACTGG - Intronic
1070368831 10:75762431-75762453 TTGGCTTCCCTAGGCCACATTGG - Intronic
1070787997 10:79173361-79173383 TTGGCTTCCCTGGGCCACATTGG - Intronic
1071555031 10:86594968-86594990 TTAGCTTCCCTGGGCCACATGGG - Intergenic
1071623717 10:87146677-87146699 TTGGCTTCCCTGGGCCACAATGG - Intronic
1071793026 10:88976119-88976141 TTAGCTTCCCTGGGCCACATTGG + Intronic
1071837795 10:89436696-89436718 TTGGCTTCCCTGGGCCACATTGG + Intronic
1072022884 10:91421417-91421439 TTGGCTTCCCTGGGCCACATTGG + Intronic
1072034052 10:91548458-91548480 TTGGTTTCCCTGAGCCACATTGG - Intergenic
1072095667 10:92177019-92177041 GTGGCTTCCCTGGGCCACATTGG - Intronic
1072150777 10:92681005-92681027 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1072262939 10:93699053-93699075 TTGGCTTTCCTGGGCCACATCGG - Intronic
1072443486 10:95477772-95477794 TTGGCTTCCCTGGGCCATATTGG + Intronic
1072536158 10:96365032-96365054 TTGGCTTCCCTGGGCCACATTGG + Exonic
1072786850 10:98289580-98289602 TTGGTTTCTCTGGGCCACATTGG - Intergenic
1072793243 10:98334666-98334688 TTGGGTTCTCTGGGCCACATTGG - Intergenic
1072844184 10:98810672-98810694 TTGGCTTCCCTGGGCCACACTGG + Intronic
1072937203 10:99724654-99724676 TTGGCTTCCCTGGGCCACACTGG + Intronic
1073052410 10:100676489-100676511 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1073074154 10:100812939-100812961 TTGGCTTCCCTGGGCCACTTTGG + Intronic
1073210306 10:101795732-101795754 TTGGCTTCCCTGGGCCACACTGG + Intronic
1073303078 10:102482698-102482720 TTGGCTTCCCTGGGCCACATTGG + Intronic
1073407808 10:103313222-103313244 TTGGCTTCCCTGGGCCACACTGG + Intronic
1073727326 10:106248285-106248307 TTGGCTTCCCTGGGCCGCATTGG - Intergenic
1074014201 10:109516843-109516865 TTGGCTTCCCTGGGTCACATTGG + Intergenic
1074075948 10:110124997-110125019 TTGACTTCCCTGGGCCACATTGG - Intronic
1074118052 10:110472502-110472524 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1074650147 10:115513117-115513139 TTGGCTTCCCTGGGCCACAGTGG - Intronic
1074754156 10:116612003-116612025 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1074764141 10:116688069-116688091 TTGGCTTCCGTGGGCCACATTGG - Intronic
1075405281 10:122191429-122191451 TTGGCTTCCCTGGGCCACATTGG + Intronic
1075755767 10:124810136-124810158 TTGGCTTCCCTGGGCCACATTGG - Intronic
1076071489 10:127493478-127493500 TGGGATGCCCTGTGCCACCTCGG + Intergenic
1076075837 10:127533290-127533312 TTGGCTTCCCCAGGCCACATTGG - Intergenic
1076210769 10:128642867-128642889 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1076602470 10:131667734-131667756 GGAGAATCCCCGGGCCACCTTGG + Intergenic
1077050692 11:565240-565262 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1077943202 11:6866458-6866480 TTGGCTTCCCTGGGCCACATGGG - Intergenic
1078061324 11:8046830-8046852 TTGGCTTCCTTGGGCCACATTGG + Intronic
1078282102 11:9912660-9912682 TTGGCTTCCCTGGGCCACATTGG - Intronic
1078343423 11:10519893-10519915 TTGGCTTCCCTGGGCCACACTGG + Intronic
1078572549 11:12472138-12472160 TTGGCTTCCCTGGGCCACATTGG + Intronic
1078682235 11:13487681-13487703 TTGGTTTCCCTGGGCCACAATGG - Intergenic
1078701875 11:13693111-13693133 TTGGCTTCCCTGGGCCACATTGG + Intronic
1079192760 11:18294749-18294771 TTGGCTTCCCCGGGCCACATGGG + Intronic
1079332559 11:19545838-19545860 TTGGCTTCCCTGGGCCACATTGG - Intronic
1080547413 11:33334564-33334586 TTGGCTTCCCTGGGCCACATTGG + Intronic
1080755497 11:35193168-35193190 TTGGCTTCCCTGGGCCACATTGG + Intronic
1080856817 11:36119019-36119041 TTGGCTTCCCTGGGCCATATTGG + Intronic
1081047092 11:38289143-38289165 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1081228542 11:40555610-40555632 TTGGCTTCCCTGGGCCACACTGG + Intronic
1081270791 11:41079857-41079879 TTGGCTTCCCTGGGCAACATTGG - Intronic
1081296485 11:41396112-41396134 TTGGCTTCCCTGGGCCACATTGG - Intronic
1081739248 11:45426639-45426661 TTGGTTTCCCTGGGCTACATTGG + Intergenic
1082089674 11:48079073-48079095 TTGGTTTCCCTGGGCCACACTGG + Intronic
1082221281 11:49640709-49640731 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1082671124 11:56037799-56037821 TAGGATTGCCTGGGCTACATGGG - Intergenic
1082847235 11:57736260-57736282 TTGGCTTCCCTGGGCCACATTGG + Intronic
1082930988 11:58604808-58604830 TTGGCTTCCCTGGGCCACACTGG - Intronic
1083015401 11:59447975-59447997 TTGGCTTCCCTGGGCAACATTGG + Intergenic
1083052238 11:59787657-59787679 TTGGCTTCCCTGGGCCACATTGG + Intronic
1083148319 11:60774602-60774624 TTGGAGTTCCCAGGCCACATGGG + Intronic
1083492326 11:63022140-63022162 TGGGATTTCCAGGGCCCCAAAGG - Intergenic
1083537895 11:63488751-63488773 TAGGCTTCCCTGGGCCACACTGG - Intronic
1084139841 11:67218949-67218971 TTGGCTTCCCTGGGCCACACTGG - Intronic
1084300444 11:68247210-68247232 TTGGCTTCCCTGAGCCACATTGG + Intergenic
1084340039 11:68491787-68491809 TTGGCTTCCCTGGGCCACATTGG + Intronic
1084540941 11:69786785-69786807 TTGGATTCCCTGGGCCACACTGG - Intergenic
1084877933 11:72147582-72147604 TTGGCTTCCCTGGGTCACATTGG + Intergenic
1084925441 11:72507773-72507795 TTGGCTTCCCTGGGCCACAGTGG - Intergenic
1085054825 11:73397551-73397573 TTGGTTTCTCTGGGCCACATTGG - Intergenic
1085113526 11:73909862-73909884 TTGGCTTCCCTGGGCCACATTGG + Intronic
1085178765 11:74514146-74514168 TTGGCTTCCCTGGGCCACATTGG + Intronic
1085470563 11:76754800-76754822 TTGGCTTCCCAGGGCCACACTGG + Intergenic
1086208743 11:84292826-84292848 TTGGCTTCCCTGGGCCACATTGG + Intronic
1086226988 11:84524022-84524044 TTGGCTTCCTTGGGCCACATTGG + Intronic
1086576767 11:88347480-88347502 TTGGCTTCACTGGGCCACATTGG + Intergenic
1086627761 11:88978391-88978413 TTGGCTTCCCTGGGCCACACTGG + Intronic
1087200984 11:95344485-95344507 TTGGCTTCCCTGGGCCATATTGG - Intergenic
1087600299 11:100305862-100305884 TTGGCTTCCCTGGGCCACACTGG + Intronic
1087700834 11:101434635-101434657 CTGGCTTCCCTGGGCCACATTGG - Intergenic
1087706060 11:101493172-101493194 TTGGCTTCCCTGGGCCACATTGG + Intronic
1088157454 11:106825370-106825392 TTGGCTTCCCTGAGCCACATTGG + Intronic
1088202779 11:107358261-107358283 TTGGCTTCCCTGGGCCACATTGG + Intronic
1088275818 11:108084061-108084083 TTGGCTTCCCTGGGCCACACTGG - Intronic
1088299578 11:108342167-108342189 TTGGATTCCCTGGGCCACACTGG - Intronic
1088373521 11:109116650-109116672 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1088446234 11:109931745-109931767 TTGGGTTCCCTGAGCCACATTGG - Intergenic
1088941925 11:114468049-114468071 TTGGCTTTCCTGGGCCACATTGG + Intergenic
1089898843 11:121960356-121960378 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1090091742 11:123704019-123704041 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1090151618 11:124390376-124390398 TTGGCTTCCCTAGGCCACATTGG + Intergenic
1091270741 11:134310133-134310155 TTGGCTTCCCTGGGCCACACTGG + Intronic
1091459012 12:630004-630026 TTTGTTTCCCTGGGCCACATTGG - Intronic
1091648737 12:2293642-2293664 TTGGCTTCCCTGGGCCACATTGG - Intronic
1091701962 12:2669264-2669286 TTGGCTTCTCTGGGCCACATTGG + Intronic
1091945059 12:4532167-4532189 TTGGCTTCCCTGGGCCACACTGG - Intronic
1092066029 12:5590285-5590307 CTGGCTTCCCTGGGCCACATTGG - Intronic
1092115102 12:5995131-5995153 TTGGCTTCCCTGGGCCACACTGG - Intronic
1092343491 12:7696305-7696327 TTGGCTTCCCTGGGTCACATTGG - Intergenic
1092411253 12:8254671-8254693 TGGGATGCCCCTGCCCAAATTGG - Intergenic
1092788433 12:12050714-12050736 TTGGCTTCCCTGGGCCACACTGG + Intronic
1092848811 12:12608674-12608696 TGTTACTCCCTGGGCCACATGGG - Intergenic
1093262347 12:16954275-16954297 TTGGCTTCCCTGGGTCACATGGG - Intergenic
1093396472 12:18689518-18689540 TTGGCTTCCCTGGGCCACGTTGG - Intronic
1093485798 12:19651044-19651066 TTGGCTTCCCTGGGCCACATTGG + Intronic
1093574486 12:20710988-20711010 TTGGGTTCCCTGGGCCACATTGG + Intronic
1093636046 12:21469449-21469471 TTGGCTTCCCTGAGCCACATTGG - Exonic
1093636060 12:21469758-21469780 TTGGCTTCCCTGAGCCACATTGG - Exonic
1093662949 12:21778024-21778046 TTGGCTTCCCTGGGCCATATTGG - Intergenic
1093697098 12:22172839-22172861 TTGGCTTCCCTGGGCCACACTGG + Intronic
1093972791 12:25390513-25390535 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1093999044 12:25674658-25674680 TGGGCTTCCCCGGGCTACATTGG + Intergenic
1094032975 12:26034330-26034352 TTGGCTTCCCTGGGCCACATTGG + Intronic
1094211054 12:27892088-27892110 TTGGCTTTCCTGGGCCACATTGG - Intergenic
1094487226 12:30934724-30934746 TTGGCTTCCCTGGGCCTCATTGG - Intronic
1094618523 12:32058205-32058227 TCGGCTTCCCTGGGCCCCATTGG + Intergenic
1094800756 12:34031951-34031973 TTGGCTTCCCTGGGCCATATTGG - Intergenic
1095113542 12:38326281-38326303 TTGGCTTCCCTGGGCCACACTGG - Exonic
1095202682 12:39402826-39402848 TTGGCTTCCCTGGGTCACATTGG - Intronic
1095277915 12:40311533-40311555 TGGGACTGCCCAGGCCAAATAGG - Intronic
1095372756 12:41489164-41489186 TTGGCTTCCCTGGGCTACATTGG - Intronic
1095475454 12:42582892-42582914 TTGGCTTCCCTGGGCCACATTGG - Intronic
1095546197 12:43373424-43373446 TTGGCTTCCCTGGGCCACACTGG + Intronic
1095662323 12:44751871-44751893 CTGGATTCCCTGGGCCACATTGG + Intronic
1095700536 12:45186595-45186617 TTGGCTTCCCTGGGCCACAATGG + Intergenic
1095824652 12:46518471-46518493 TGGGACTCCCCTGGTCACATGGG - Intergenic
1096190238 12:49612608-49612630 TTGGCTTCCCTGGGCCACACTGG - Intronic
1096532643 12:52251299-52251321 TTGGCTTCCCTGGGCCACACTGG + Intronic
1096726184 12:53564961-53564983 TTGGCTTCCCTGGGCCACATTGG - Intronic
1097133747 12:56834593-56834615 TTGGTTTCCCTGGGCCACACTGG + Intergenic
1097742648 12:63262210-63262232 TGGGCTTCCCTGGGCCACACTGG - Intergenic
1097849069 12:64393834-64393856 TTGACTTCCCTGGGCCACATTGG - Intergenic
1098037188 12:66316483-66316505 TTGGCTTCCCTGGGCCACACTGG + Intronic
1098064172 12:66594561-66594583 TTAGCTTCCCTGGGCCACATTGG - Intronic
1098241829 12:68475739-68475761 TTGGCTTCCCGGGGCCACATTGG - Intergenic
1098345489 12:69498632-69498654 TTGGCTTCCCTGGGCCACATTGG - Intronic
1098381370 12:69873161-69873183 TTGGCTTCCCTGGGCCACATCGG + Intronic
1098781912 12:74698365-74698387 TTGGCTTCCCTGGGTCACATTGG - Intergenic
1098790799 12:74819431-74819453 TTGGCCTCCCTGGGCCACATAGG + Intergenic
1098834755 12:75409203-75409225 TTGGCTTCCCTGGTCCACATTGG - Intronic
1098915028 12:76248530-76248552 TTGGCTTTCCTGGGCCACATTGG - Intergenic
1099205265 12:79719567-79719589 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1099363701 12:81741712-81741734 TTGGCTTCCCTGGGCCACATTGG - Intronic
1099384238 12:81995420-81995442 TTGGCTTCCCTGGGCCGCATTGG - Intergenic
1099469446 12:83029396-83029418 TTGGCTTCCCTGGGCCACATTGG - Intronic
1099471234 12:83051373-83051395 TTGGCTTCCCTGGGCCACATTGG - Intronic
1099967185 12:89461053-89461075 TGGCTTTCCCTGGGCCACATTGG + Intronic
1100056406 12:90516532-90516554 TTTGCTTCCCTGGGCCACATTGG - Intergenic
1100314062 12:93427237-93427259 TTGGCTTCCCTGGGCCACAGTGG - Intronic
1100419698 12:94420662-94420684 TCGGCTTCCCTGGGCCACACTGG - Intronic
1100435350 12:94566053-94566075 TTGGCTTCCCGGGGCCATATTGG - Intergenic
1100903765 12:99273958-99273980 TTGGCTTCCCTGGGACACATTGG - Intronic
1100963163 12:99985055-99985077 TGGAGTTCCCCGGGCCGCGTCGG + Intergenic
1101008793 12:100428612-100428634 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1101140557 12:101791378-101791400 TTGGCTTCCCTGGGCCACAGTGG + Intronic
1101285235 12:103305011-103305033 TTGGCTTCCCTGGGCCACATAGG + Intronic
1101641178 12:106586655-106586677 TTGAGTTCCCCGGGCCGCATCGG + Intronic
1101688950 12:107056651-107056673 TTGGCTTCCCTGGGCCACATTGG - Intronic
1101714877 12:107302057-107302079 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1102052512 12:109873100-109873122 TTGGATTCCCAGGGCCACACTGG - Intronic
1102545755 12:113654083-113654105 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1102766035 12:115433771-115433793 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1102837615 12:116080100-116080122 TTGGCTTCCCTGGGCCATATTGG - Intronic
1103219237 12:119229781-119229803 TTGGCTTCCCTGAGCCACATTGG - Intergenic
1103285746 12:119799912-119799934 TTGGCTTCCTTGGGCCACATGGG - Intronic
1103926331 12:124425497-124425519 TTGGCTTCCCCAGGCCACACTGG - Intronic
1103947392 12:124534008-124534030 TTGGCTTCCCTGGGCCACATTGG - Intronic
1104304279 12:127595090-127595112 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1104391310 12:128392701-128392723 TTGGCTTCCCTGGGCCACACTGG + Intronic
1104410405 12:128553069-128553091 TTGGCTTCTCTGGGCCACATTGG + Intronic
1104751811 12:131244892-131244914 TGGGAAGCCCAGGGTCACATGGG - Intergenic
1104780082 12:131414183-131414205 TGGGAAGCCCAGGGTCACATGGG + Intergenic
1104788305 12:131466048-131466070 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1105056822 12:133108958-133108980 TTGGCATCCCTGGGCCACATTGG + Exonic
1105254292 13:18731213-18731235 TTGGCTTCCCTGGACCACATTGG - Intergenic
1105327239 13:19381927-19381949 TTGGCTTCCCTGGGCCACAATGG - Intergenic
1105378567 13:19865147-19865169 TTGGCTTCCCGGGGCCACATTGG + Intergenic
1105459242 13:20567930-20567952 TTGGCTTCCCTGGGCCACATCGG + Exonic
1105480233 13:20768653-20768675 TTGGCTTCCCTGGGCCACATTGG - Intronic
1105784839 13:23738382-23738404 TTGGCTTCCCTGGGCCACATTGG - Intronic
1105864406 13:24446413-24446435 TTGGCTTCCCTGGGCCACAGTGG + Intronic
1105909305 13:24846615-24846637 TTGGTTTCTCTGGGCCACATTGG + Intronic
1105909557 13:24849519-24849541 TTGGCTTCCCTGGGCCACACTGG - Intronic
1105973993 13:25456892-25456914 TTGGCTTCCCTGGGCCACATTGG + Intronic
1106089768 13:26580096-26580118 TTGGCTTCCCTGGGCCACACTGG - Intronic
1106204457 13:27577464-27577486 TTGGCTTCCCTGGGCCACACGGG + Intronic
1106274704 13:28193003-28193025 TTGGCTTCCTTGGGCCACATTGG + Intronic
1106286262 13:28320622-28320644 TTGGCTTTCCTGGGCCACATTGG - Intronic
1106573715 13:30955091-30955113 TTGGCTTCCCTGGGCCACAGTGG + Intronic
1106622776 13:31387298-31387320 TTGGCTTCCTTGGGCCACATTGG - Intergenic
1106699548 13:32214507-32214529 TTGGCTTCCCTGGGCCACACTGG - Intronic
1106741484 13:32648001-32648023 TGAGATTCTCTGGGCCACTTAGG + Intronic
1106793645 13:33182507-33182529 TTGGCTTCCCCGGACCACATTGG + Intronic
1106981861 13:35294971-35294993 TTGGCTTCCCTGGGCCACACTGG + Intronic
1107120810 13:36794111-36794133 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1107155557 13:37163207-37163229 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1107445423 13:40466200-40466222 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1107694586 13:42987649-42987671 TTGGCTTCCTGGGGCCACATGGG - Intronic
1107871598 13:44751436-44751458 TTGGATTCCCTGGACCACATTGG + Intergenic
1108222332 13:48248628-48248650 TTGGCTTTCCTGGGCCACATTGG + Intronic
1108538094 13:51406980-51407002 TTGGCTTCCCAGGGGCACATTGG - Intronic
1108675635 13:52735586-52735608 TTGGCTTCCCTGGGCCACAATGG + Intronic
1108722468 13:53146133-53146155 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1108845066 13:54668227-54668249 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1108863176 13:54888160-54888182 TCGGCTTCCCTTGGCCACATTGG + Intergenic
1109229960 13:59744596-59744618 TTGGCTTCCCTGGGCCACATTGG - Intronic
1109257538 13:60101596-60101618 TTGGCTTCCCTGGGCCACATTGG - Intronic
1109584909 13:64386947-64386969 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1109744310 13:66602115-66602137 TTGGTTTCCCTGGGCCACATTGG + Intronic
1109835407 13:67850487-67850509 TGGGCATCCCCAGGCCACATTGG + Intergenic
1109987304 13:70005548-70005570 TTGGCTACCCTGGGCCACATTGG - Intronic
1110145423 13:72184820-72184842 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1110294045 13:73841316-73841338 TTGGCTTCCCTGGGCCACAACGG + Intronic
1110335928 13:74329759-74329781 TTGGCTTCCCTGGGCCACGTTGG - Intergenic
1110354520 13:74551965-74551987 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1110357188 13:74580565-74580587 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1110613444 13:77514666-77514688 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1111191512 13:84813603-84813625 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1111306932 13:86426783-86426805 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1111324371 13:86673342-86673364 TTGGCTTCCCTGGGTCACATTGG + Intergenic
1111601080 13:90475543-90475565 TTGCCTTCCCTGGGCCACATTGG - Intergenic
1111652519 13:91109798-91109820 TTGAATTCCCTGGGCCACGTTGG + Intergenic
1111665018 13:91256149-91256171 TGGGCTTCCCTGGGCGACTTTGG - Intergenic
1112011782 13:95299649-95299671 TTGGGTTCCCTGGGCCACACTGG - Intronic
1112036311 13:95499841-95499863 TTGGCTTCTCTGGGCCACATTGG + Intronic
1112115284 13:96345756-96345778 TTGGCTTCCCTGGACCACATTGG + Intronic
1112184087 13:97111663-97111685 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1112307044 13:98284260-98284282 TTGGTTTCCCTGGGCCACACTGG - Intronic
1112345104 13:98582879-98582901 TGGGATTACAAGGACCACATGGG - Intergenic
1112392308 13:98996756-98996778 TTGGCTTCCCTGGGCCACACTGG - Intronic
1112417961 13:99219660-99219682 TTGGTTTCCCTGGGCCACACTGG - Intronic
1112904149 13:104396702-104396724 TTGGCCTCCCTGGGCCACATTGG + Intergenic
1112921759 13:104621959-104621981 TCGGCTTCCCTGGGCCACAGTGG + Intergenic
1113354329 13:109563930-109563952 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1113877408 13:113602893-113602915 TTGTTTTCCCTGGGCCACATTGG + Intronic
1113912797 13:113852256-113852278 TTGGCTTCCGTGGGCCACATTGG - Intronic
1114138318 14:19880135-19880157 TTGGCTTCTCTGGGCCACATTGG - Intergenic
1114261018 14:21036352-21036374 TTGGCTTCCCTGGGCCACATTGG + Intronic
1114856624 14:26454079-26454101 TTGGCTTCCCTGGGCCACACTGG + Intronic
1114898672 14:27027651-27027673 TTGGCTTCTCTGGGCCACATGGG + Intergenic
1115273927 14:31585155-31585177 TTGGCTTTCCTGGGCCACATTGG + Intronic
1115711070 14:36051297-36051319 TTGGCTTCTCCGAGCCACATTGG - Intergenic
1115749030 14:36469614-36469636 TTGATTTCCCTGGGCCACATAGG - Intergenic
1115898100 14:38113312-38113334 TTGGCTTCCCTGGGTCACATTGG + Intergenic
1116331936 14:43608121-43608143 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1116527983 14:45930882-45930904 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1117117816 14:52534475-52534497 TTGGCTTACCTGGGCCACATCGG - Intronic
1117177079 14:53155740-53155762 TTGGCTTTCCTGGGCCACATCGG + Intergenic
1117235894 14:53774234-53774256 TTGGCTTCCCTGGGGCACATTGG - Intergenic
1117939802 14:60950671-60950693 TTGGCTTCCCTGGGCCACAGTGG - Intronic
1117962944 14:61180427-61180449 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1117979777 14:61330872-61330894 TTGGCTTCCCTGGGCCACGTTGG + Intronic
1118237364 14:64020251-64020273 TTGGCTTCCCTGGGCCATATTGG + Intronic
1118391700 14:65301241-65301263 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1118417808 14:65562107-65562129 AGGGTTTCCCTGGGCCACACTGG - Intronic
1118898570 14:69967535-69967557 TTGGCTTCCCTGGGCCACACTGG - Intronic
1118987082 14:70765670-70765692 TCGGCTTCCCTGGGCCATATTGG + Intronic
1119055193 14:71412373-71412395 TTGGCTTCCCTGGGCCACAGTGG - Intronic
1119148322 14:72335655-72335677 TTGTATTCCCTGGGCCACAATGG + Intronic
1119291679 14:73500353-73500375 TTGGCTTCCCTGGGCCACAATGG - Intronic
1119349430 14:73951724-73951746 TTGGCTTCCCCAGGCCACAGTGG - Intronic
1119574699 14:75708891-75708913 TTGGCTTCCCTGGGCCACATTGG + Intronic
1119906754 14:78311619-78311641 TTGGCTTCCCTTGGCCACATTGG - Intronic
1119954009 14:78775541-78775563 TTGGCTTCCCTGGGTCACATCGG - Intronic
1120049459 14:79848521-79848543 TTGGCTTCCCTGGGCCACAGTGG - Intronic
1120114716 14:80601363-80601385 TTGGCTTCCCTGGGCCACACTGG + Intronic
1120172888 14:81263652-81263674 TTGGCTTCCCTGGGCCACATAGG - Intronic
1120541884 14:85761194-85761216 TTGGGTTCCCTGGGCCACATTGG - Intergenic
1121037707 14:90720100-90720122 TTGGCTTCCCTGGGCCACATTGG - Intronic
1121185105 14:91960324-91960346 TAGGCTTCCCTGGGCCACACTGG - Intergenic
1121716044 14:96076533-96076555 TTTGCTTCCCTGGGCCACATTGG + Intronic
1121760833 14:96443672-96443694 TCGGCTTCCCTGGGCCACATTGG + Intronic
1121801408 14:96777287-96777309 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1121922181 14:97892378-97892400 TTGGCTTCCCTAGGCCACATTGG - Intergenic
1122171375 14:99878128-99878150 TTGGTTTCCCTGGGCCACATTGG - Intronic
1122195284 14:100080146-100080168 TTGGCTTCCCTGGGCCACATTGG + Intronic
1122285315 14:100648332-100648354 TTGGTTTCCCTGAGCCACATTGG + Intergenic
1122530608 14:102423550-102423572 TTGGCTTCCCTGGGCCACATTGG - Intronic
1122673517 14:103390504-103390526 TTGGCTTCCCCGGGCCACATTGG + Intronic
1122732127 14:103808368-103808390 TGGGCTTCCCTGGGCCACACTGG + Intronic
1122937096 14:104965133-104965155 TTGGCTTCCCTGGGCTACATTGG - Intronic
1123393538 15:19900785-19900807 TTGGCTTCTCAGGGCCACATTGG + Intergenic
1123466063 15:20516862-20516884 TTGGTTTCCCTGGGCCACACTGG + Intergenic
1123652051 15:22484177-22484199 TTGGTTTCCCTGGGCCACACTGG - Intergenic
1123739763 15:23225755-23225777 CGGGGTCCCCCGGGCCACCTGGG + Intergenic
1123742471 15:23293037-23293059 TTGGTTTCCCTGGGCCACACTGG - Intergenic
1123760854 15:23431449-23431471 TTGGTTTCCCTGGGCCACACTGG + Intergenic
1123886182 15:24730247-24730269 TTGGCTACCCTGGGCCACATTGG + Intergenic
1124143774 15:27101758-27101780 TCGGCTTCCCTGGGCCACACTGG + Intronic
1124276787 15:28332838-28332860 TTGGTTTCCCTGGGCCACACTGG + Intergenic
1124290988 15:28454728-28454750 CGGGGTCCCCCGGGCCACCTGGG + Intergenic
1124305913 15:28578768-28578790 TTGGTTTCCCTGGGCCACACTGG - Intergenic
1124485538 15:30111750-30111772 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1124518038 15:30385517-30385539 TTGGCTTCCCTGGGCCACACTGG - Intronic
1124540615 15:30580736-30580758 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1124602393 15:31145837-31145859 TTGGCTTACCTGGGCCACATTGG + Intronic
1124758038 15:32426845-32426867 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1124826488 15:33101376-33101398 TTGGCTTCCCTGGGCCACATTGG + Intronic
1125841655 15:42806895-42806917 TTGGCTTCCCTGGGCCACACTGG - Intronic
1125843060 15:42823810-42823832 TTGGCTTCCCTGGGCCACATTGG - Intronic
1126066807 15:44832026-44832048 TTGGCTTCCTTGGGCCACATTGG - Intergenic
1126093024 15:45068529-45068551 TTGGCTTCCTTGGGCCACATTGG + Intronic
1126228443 15:46297685-46297707 TTGGCTTCCCTGAGCCACATTGG + Intergenic
1126367687 15:47912928-47912950 TTTGCTTCCCTGGGCCACATTGG - Intergenic
1126614607 15:50564175-50564197 TTGGCTTCCCTGGGCCACATTGG - Intronic
1126619230 15:50620385-50620407 TTGGCTTTCCTGGGCCACATTGG - Intronic
1126698613 15:51347494-51347516 TTGGCTTCCCTGGGCCACAATGG - Intronic
1126823363 15:52526940-52526962 TTGGCTTCCCTGGGCCACACTGG + Intronic
1126830029 15:52592579-52592601 TTGGCTTCCCTGGGCCACACTGG + Intronic
1126830421 15:52597750-52597772 TTGGCTTCCCTGGGCCACACTGG + Intronic
1127008881 15:54600904-54600926 TTGACTTCCCTGGGCCACATTGG + Intronic
1127061389 15:55189682-55189704 TTGGCTTCCCTGGGCCACATTGG - Intronic
1127218391 15:56849454-56849476 TTGGCTTCCCTGGGCCACATAGG - Intronic
1127274673 15:57431809-57431831 TTGGCTTCCCTGGGCCACATTGG - Intronic
1127387749 15:58480794-58480816 TTGGCTTCCCTGGGCCACATTGG - Intronic
1127467192 15:59255616-59255638 TTGGCTTCCCTGGGCCACACTGG + Intronic
1128227171 15:66010088-66010110 TTGGCTTCCCAGGGCCACATTGG + Intronic
1128439367 15:67690091-67690113 TTGGCTTCCCTGGGCCACATTGG - Intronic
1128606707 15:69041951-69041973 TTGGCTTCCCTGGGTCACATTGG - Intronic
1128856401 15:71020962-71020984 TTGGTTTCCTTGGGCCACATTGG + Intronic
1128894798 15:71362897-71362919 TTGGCTTCCCTGGGCCACATTGG + Intronic
1129078392 15:73017898-73017920 TTGGCTTCCCTAGGCCACATTGG - Intergenic
1129117501 15:73373251-73373273 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1129131966 15:73507434-73507456 TTGGCTTCCCTGGGCCACCTTGG - Intronic
1129282424 15:74496267-74496289 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1129375195 15:75125919-75125941 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1130007698 15:80116846-80116868 TTGGCTTCCCTGGGCCACAGTGG - Intronic
1130066990 15:80613164-80613186 TTTGGTTTCCCGGGCCACATTGG - Intergenic
1130078076 15:80707482-80707504 TTGGCTTCCCTGGGCCACATTGG + Intronic
1130109824 15:80954916-80954938 TTGGCTTTCCTGGGCCACATTGG - Intronic
1130247573 15:82266053-82266075 TTGGCTTCCCTGGGCCACATTGG + Intronic
1130371649 15:83289688-83289710 TTGGCTTCCCTGGACCACATTGG - Intergenic
1130372627 15:83298662-83298684 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1130452575 15:84071452-84071474 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1130521129 15:84661382-84661404 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1130957312 15:88636895-88636917 TGTGACCCCCCAGGCCACATTGG + Intronic
1131024755 15:89130829-89130851 TTGGCTTCCCTGGGCCACTTTGG - Intronic
1131079099 15:89519478-89519500 CTGGCTTCCCTGGGCCACATGGG - Intergenic
1131086818 15:89582689-89582711 TGGGAATCCCCAGACCACCTTGG + Exonic
1131575010 15:93580120-93580142 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1131861226 15:96655523-96655545 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1132280957 15:100614660-100614682 TTGGCTTCCCTGGGCCACACTGG + Intronic
1132416564 15:101624427-101624449 TTGGCTTCCCTGGGCCACATTGG + Intronic
1132493171 16:245584-245606 TTGGCTTCCCTGGGCCACGTTGG + Intronic
1133318251 16:4897434-4897456 TCTGATTCCCCAGGTCACATGGG - Intronic
1133338042 16:5019248-5019270 TTGGCTTCCCTGGACCACATTGG - Intergenic
1133961495 16:10497453-10497475 TTGGCTTCCCTGGGCCACATGGG + Intergenic
1134022744 16:10932561-10932583 TTGGCTTCCCTGGGCCACAGTGG + Intronic
1134067689 16:11239742-11239764 TGGGATGCCCTGTGCCACCTTGG - Intergenic
1134604518 16:15559851-15559873 TTGTCTTCCCTGGGCCACATTGG + Intronic
1134627734 16:15734820-15734842 TTGGCTTCCCTTGGCCACATTGG - Intronic
1134765503 16:16754086-16754108 TTGGCTTTCCTGGGCCACATTGG + Intergenic
1134980547 16:18605126-18605148 TTGGCTTTCCTGGGCCACATTGG - Intergenic
1135043818 16:19138112-19138134 TTGGCTTCCCTGGGCCACACTGG - Intronic
1135183713 16:20296836-20296858 TTGGCTTCCCTGGGCCACAGTGG - Intergenic
1135334167 16:21586799-21586821 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1135533413 16:23274128-23274150 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1135542488 16:23342581-23342603 TTGGCTTCCCTGGACCACATTGG + Intronic
1135977473 16:27118450-27118472 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1136426590 16:30172018-30172040 TTGGCTTCCCCGGACCACATTGG + Intergenic
1136696031 16:32083033-32083055 TTGGCTTCTCAGGGCCACATTGG - Intergenic
1136699541 16:32118155-32118177 TTGGCTTCTCAGGGCCACATTGG + Intergenic
1136768117 16:32809769-32809791 TTGGCTTCTCAGGGCCACATTGG - Intergenic
1136771376 16:32844745-32844767 TTGGCTTCTCAGGGCCACATTGG - Intergenic
1136796525 16:33026287-33026309 TTGGCTTCTCAGGGCCACATTGG - Intergenic
1136868184 16:33772475-33772497 TTGGCTTCTCAGGGCCACATTGG + Intergenic
1136899203 16:34016701-34016723 TTGGCTTCTCAGGGCCACATTGG + Intergenic
1136902429 16:34052597-34052619 TTGGCTTCTCAGGGCCACATTGG + Intergenic
1136957929 16:34805337-34805359 TTGGCTTCTCGGGGCCACATTGG + Intergenic
1137083979 16:36099914-36099936 TTGGCTTCTCAGGGCCACATTGG - Intergenic
1137331974 16:47506730-47506752 TTGGCTTCCCTGGGCCATATGGG + Intronic
1137544821 16:49395534-49395556 TTGGCTTCCCTGGGCCACATTGG - Intronic
1137931607 16:52593204-52593226 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1137942149 16:52698802-52698824 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1138027442 16:53533208-53533230 TTGGCTTCCCTGGACCACATTGG + Intergenic
1138029085 16:53545378-53545400 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1138030653 16:53557051-53557073 TGGGCTTCCCTGGACCACATTGG + Intergenic
1138048472 16:53751065-53751087 TTGGCTTCCCTGGGCCACAATGG + Intronic
1138093387 16:54194331-54194353 TGGGCAGCCCCGGGCCACACGGG + Intergenic
1138128857 16:54461395-54461417 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1138222201 16:55261362-55261384 TTGGCTTTCCTGGGCCACATTGG - Intergenic
1138355513 16:56375247-56375269 TTGGCTTCCCTGGGCCACATTGG - Intronic
1138356159 16:56382428-56382450 TTGGCTTCCCTGGGCCACACTGG + Intronic
1138443521 16:57049019-57049041 TTGGCTTCCCTGGGCCACATTGG + Intronic
1138485862 16:57343075-57343097 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1139332471 16:66204052-66204074 TTGGCTTTCCTGGGCCACATTGG + Intergenic
1139460646 16:67119395-67119417 TTGGCTTCCCTGGGCCACATTGG + Intronic
1139808460 16:69590775-69590797 TGGGATTCCCCGCCCCATCTGGG + Intronic
1140133133 16:72181885-72181907 TTGGCTTCCCTGAGCCACATTGG + Intergenic
1140525005 16:75615395-75615417 TTGGCTTCCCTGGGCCACATTGG + Intronic
1140806074 16:78533338-78533360 TTGGCTTCCCTGGGCCACATTGG + Intronic
1141298827 16:82794253-82794275 TTGGCTTCCCTGGGCCACAGTGG - Intronic
1141401988 16:83756628-83756650 TTGGCTTCCCTGGGCCACATTGG - Intronic
1141491435 16:84376611-84376633 TTGGCTTCCCTGGGCCACATTGG - Intronic
1141717992 16:85738035-85738057 TTGGCTTCCCTGGGCCACACTGG - Intronic
1141729586 16:85812690-85812712 TGGCATGGCCCGGGCCACATGGG + Intergenic
1141872324 16:86795788-86795810 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1141942611 16:87287953-87287975 TTGGCTTCTCTGGGCCACATTGG - Intronic
1141980053 16:87544584-87544606 TGGGATGCCCTGTGCCACTTGGG + Intergenic
1142194227 16:88732217-88732239 TGGGTTTGCCTGGGCCACAGAGG - Intronic
1203070507 16_KI270728v1_random:1071789-1071811 TTGGCTTCTCAGGGCCACATTGG - Intergenic
1203073800 16_KI270728v1_random:1106855-1106877 TTGGCTTCTCAGGGCCACATTGG - Intergenic
1203103989 16_KI270728v1_random:1343800-1343822 TTGGCTTCTCAGGGCCACATTGG - Intergenic
1203129525 16_KI270728v1_random:1618568-1618590 TTGGCTTCTCAGGGCCACATTGG + Intergenic
1142777521 17:2153239-2153261 TTGGCTTCCCTGGGCCACATTGG - Intronic
1142838793 17:2610547-2610569 TTGACTTCCCTGGGCCACATTGG + Intronic
1143236565 17:5406688-5406710 TTGGCTTCCCTGGGCCACACTGG + Intronic
1143251608 17:5527166-5527188 TTGGCTTCCCTGGGTCACATTGG + Intronic
1143691673 17:8572573-8572595 TTGGCTTCCCTGGGCCACACTGG - Intronic
1144096003 17:11901344-11901366 TTGGCTTCCCCGGGCCACACTGG + Intronic
1144274406 17:13651833-13651855 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1144420585 17:15094345-15094367 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1144471966 17:15551750-15551772 TTGGTTTCCCTGGGCCACAGTGG - Intronic
1144514902 17:15910701-15910723 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1144621777 17:16822795-16822817 TGGGACTCCCGGGGCCCCATGGG - Intergenic
1144822822 17:18087588-18087610 TTGGCTTCTCTGGGCCACATTGG - Intergenic
1144876920 17:18402542-18402564 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1144884645 17:18449919-18449941 TGGGACTCCCGGGGCCCCATGGG + Intergenic
1144924511 17:18792959-18792981 TTGGTTTCCCTGGGCCACAGTGG + Intronic
1145089417 17:19974470-19974492 TTGGCTTCCCTAGGCCACATTGG - Intronic
1145147582 17:20494458-20494480 TGGGACTCCCAGGGCCCCATGGG - Intergenic
1145155309 17:20541869-20541891 TTGGCTTCCCTGGGACACATTGG - Intergenic
1145392463 17:22466238-22466260 TTGGTTTTCCTGGGCCACATTGG + Intergenic
1145690450 17:26733184-26733206 TTGGCTTCTCAGGGCCACATTGG + Intergenic
1145710223 17:26964341-26964363 TTGGCTTCTCAGGGCCACATTGG + Intergenic
1145741345 17:27277344-27277366 TTGGCTTCCCCAGGCCACGTTGG + Intergenic
1145766953 17:27464857-27464879 TTGGCTTCTCAGGGCCACATTGG + Intronic
1145832503 17:27928293-27928315 TTGGCTTCCCTGGTCCACATTGG - Intergenic
1146056997 17:29586400-29586422 TTTGCTTCCCTGGGCCACATTGG - Intronic
1146070291 17:29674705-29674727 TTGGCTTCCCTGGGCCACATCGG + Intronic
1146212584 17:30953949-30953971 TTGCCTTCCCTGGGCCACATTGG - Intronic
1146596183 17:34171160-34171182 TTGGCTTCCCCGGTCCACAACGG + Intronic
1146714943 17:35077821-35077843 TTGGCCTCCCTGGGCCACATTGG - Intronic
1146778348 17:35643096-35643118 TTGGCTTCCCTGGGCCACATTGG + Intronic
1146975056 17:37104039-37104061 TTGGCTTCCTTGGGCCACATTGG + Intronic
1147560151 17:41503775-41503797 TTGGCTTCCCTGGGCCACATTGG + Intronic
1147712115 17:42475593-42475615 TTGGCTTCCCTGGGCCACATTGG - Intronic
1148631294 17:49111392-49111414 TTGGCTTCCCTGGCCCACATTGG + Intergenic
1148815334 17:50323929-50323951 TTGGCTTCCTTGGGCCACATTGG - Intergenic
1148825796 17:50393069-50393091 GTGGCTTCCCTGGGCCACATTGG - Intronic
1148949104 17:51293578-51293600 TTGGCTTCCCTGGGCCACAACGG - Intronic
1148952398 17:51325084-51325106 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1149271312 17:54981030-54981052 TTGGCTTCCCCAGGTCACATTGG - Intronic
1149333691 17:55612091-55612113 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1149711739 17:58749328-58749350 TTGGTTTCCCCAGGCCACATTGG - Intergenic
1149893364 17:60409751-60409773 TTGGCTTCCCTGGGTCACATTGG + Intronic
1149905409 17:60521850-60521872 TTGGCTTCCCTGAGCCACATTGG - Intronic
1150171428 17:62999698-62999720 TTGGCTTTCCCGGGCCACAGTGG - Intergenic
1150179223 17:63097483-63097505 TTGGCTTCCCTGGGCCACATTGG + Intronic
1150364259 17:64567589-64567611 TTGGCTTCCCTGGGCCACACTGG + Intronic
1150563504 17:66316603-66316625 TTGGCTTCCCTGGGCCACACTGG - Intronic
1150628717 17:66860928-66860950 TTGGCTTCCCTGTGCCACATTGG - Intronic
1150699083 17:67432146-67432168 TTGGCTTCCTTGGGCCACATTGG + Intronic
1150843241 17:68629069-68629091 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1150943072 17:69714372-69714394 TTGGATTCCCTGGGCCACATTGG + Intergenic
1151045280 17:70912714-70912736 TTGGCTTCCCTGGGCCACATGGG - Intergenic
1151233137 17:72699187-72699209 TTGGCTTCCCTGGGCCACACTGG + Intronic
1151663984 17:75535075-75535097 TGGGCTTCCCAGGGCGACATGGG + Intronic
1151776757 17:76209567-76209589 TTGGGTTCCCTGGGCCACATTGG - Intronic
1151832233 17:76560354-76560376 TTGGCTTCCCTGTGCCACATTGG + Intergenic
1152210825 17:79002216-79002238 TTGGCTTCCCTGGGCCACATTGG - Intronic
1152659989 17:81537634-81537656 TGGAACTCCCCGAGCCACGTGGG + Intergenic
1152838009 17:82547306-82547328 TAGGCTTTCCTGGGCCACATTGG + Intronic
1153038232 18:785228-785250 TTGGCTTCCCTGGGCCATATTGG - Intronic
1153141270 18:1975059-1975081 TTGGCTTCCCTGGGCCTCATTGG + Intergenic
1153407282 18:4754948-4754970 TTGGCTTCCCTGGGCTACATTGG - Intergenic
1153993001 18:10416600-10416622 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1154022175 18:10673822-10673844 TTGGGTTCGCTGGGCCACATTGG + Intronic
1154202234 18:12307905-12307927 TGGGACCCCGCGGGCCACGTCGG + Intronic
1154408652 18:14122110-14122132 TTGGCTTCCCCGGGTCACATTGG - Intronic
1154518026 18:15196295-15196317 TTGGCTTCTCAGGGCCACATTGG - Intergenic
1155119408 18:22803108-22803130 TTGGCTTCCCTGGTCCACATGGG - Intronic
1155607710 18:27626288-27626310 TGGGATGCCCTGGACCACCTTGG + Intergenic
1155613330 18:27693833-27693855 TTGGCATCCCTGGGCCACATTGG - Intergenic
1155676548 18:28436195-28436217 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1155715646 18:28940281-28940303 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1155825719 18:30440129-30440151 TTGGCTTCCCCAGGCCACAGTGG + Intergenic
1155905076 18:31440850-31440872 TTGGCTTCCCTGGGTCACATTGG - Intergenic
1156355268 18:36335110-36335132 TTGGCTTCCCTGGGCCACACTGG + Intronic
1156485462 18:37462885-37462907 TTGGCTTCCCTGGGCCACATTGG - Intronic
1156638312 18:39058252-39058274 TGGCATTCCCAAGGCCATATAGG + Intergenic
1156682664 18:39609739-39609761 TTGGCATCCCTGGGCCACATTGG - Intergenic
1156703878 18:39856811-39856833 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1156722316 18:40085093-40085115 TTGGATTCCCCGGGCCACACTGG - Intergenic
1156879735 18:42062522-42062544 TTGGCTTCCCTGGGCCACAGTGG - Intronic
1157313605 18:46570663-46570685 TTGGTTTCCCTGGGCCACACTGG + Intronic
1157319822 18:46625410-46625432 TTGGCTTCCCTGGGCCACACTGG + Intronic
1157786262 18:50485796-50485818 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1157958040 18:52120955-52120977 TTGGCTTCCCTGGGCCATATTGG + Intergenic
1158511682 18:58096000-58096022 TTGGCTTCCCTGGGCCACACTGG - Intronic
1159039166 18:63306921-63306943 TTGGCTTCCCTGGGCCACATTGG - Intronic
1159440957 18:68479323-68479345 TTGATTTCCCTGGGCCACATTGG - Intergenic
1159544312 18:69819850-69819872 TTGGCTTCCCTAGGCCACATTGG + Intronic
1159652329 18:70992204-70992226 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1159879860 18:73848470-73848492 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1160160825 18:76468764-76468786 TTGGCTTCCCTCGGCCACATTGG - Intronic
1160175988 18:76594647-76594669 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1160205820 18:76830556-76830578 TCAGCTTCCCTGGGCCACATTGG + Intronic
1160227722 18:77024321-77024343 TTGGCTTCCCTGGGCCACATTGG - Intronic
1160794784 19:940212-940234 TTGGCTTCCCTGGGCTACATTGG + Intronic
1161393720 19:4034043-4034065 AGGCATTCCCCAGGCCACAGGGG + Intronic
1161401425 19:4067465-4067487 TGGGCCTCCCCGGGCCTCAGTGG + Intergenic
1161524665 19:4746372-4746394 TGGGATTTCCCAGGCTAGATCGG + Intergenic
1161549794 19:4905859-4905881 TTGGCTTCCCTGGGCCACATTGG - Intronic
1161965822 19:7547999-7548021 TTGGCTTCCCTGGGCCACATTGG + Intronic
1162680309 19:12335450-12335472 GGGGCTTCCCTGGGCCACATTGG + Intergenic
1163323023 19:16585660-16585682 TGGGTTTCACAGGGCCACAGAGG - Intronic
1163891572 19:20021040-20021062 TTGGCTTCCCTGGGCCACAGTGG + Intronic
1164643531 19:29843137-29843159 TGGGGTGGCCCTGGCCACATAGG + Intergenic
1165256917 19:34582519-34582541 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1165352818 19:35285559-35285581 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1165396452 19:35566800-35566822 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1165446429 19:35859402-35859424 TTGGCTTTCCTGGGCCACATTGG - Intronic
1165664963 19:37620465-37620487 TTGGCATCCCTGGGCCACATTGG + Intronic
1166459479 19:42973555-42973577 TTGGCTTCCCTGGGCCACAATGG - Intronic
1166476801 19:43133600-43133622 TTGGCTTCCCTGGGCCACAATGG - Intronic
1166662284 19:44654819-44654841 TTGGCTTCCCCGGGCCACATTGG - Intronic
1166928660 19:46287469-46287491 TTGTCTTCCCTGGGCCACATTGG - Intergenic
1166953420 19:46445701-46445723 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1167820492 19:51923182-51923204 TTGGCTTCCCTGGGCCACACTGG - Intronic
1167833261 19:52044930-52044952 TTGGCTTCCCTGGGCCACACTGG + Intronic
1167964280 19:53131152-53131174 TTGGCTTCCCTGGGCCACATTGG - Intronic
1167978007 19:53247301-53247323 TTGGCTTCCCTGGGCCACACTGG + Intronic
1168021309 19:53610813-53610835 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1168377202 19:55890367-55890389 TTGGTTTCCCTGGGCCACGTTGG + Intergenic
1168457878 19:56527969-56527991 TTGTCTTCCCTGGGCCACATTGG + Exonic
1168705679 19:58469101-58469123 TTGGCTTCCCTGGGCCACATTGG - Intronic
1202679927 1_KI270712v1_random:1220-1242 TTGGCTTCTCAGGGCCACATTGG - Intergenic
924988931 2:294691-294713 TTGGCTTCCCTGGGCCACACTGG + Intergenic
925402964 2:3588819-3588841 TTGGCTTCCCTGGGCCACATTGG - Intergenic
925418621 2:3692282-3692304 TTAGCTTCCCTGGGCCACATTGG + Intronic
925714079 2:6768752-6768774 TTGGCTTCCCTGGGCCACATTGG + Intergenic
925827740 2:7866494-7866516 TTGGCTTCCCAGGGCCACACTGG - Intergenic
926106624 2:10156154-10156176 TTGGCTTCCCTTGGCCACATTGG + Intronic
926304042 2:11624889-11624911 TTGGATTCCCTGGGCCACATTGG - Intronic
926314465 2:11699163-11699185 TTGGTTTCCCTGGGCTACATTGG - Intronic
926376227 2:12230682-12230704 TTGGCTTCCCTGGGCCACACTGG + Intergenic
926690203 2:15727847-15727869 TTGGTTTCCCTGGGCCACGTTGG + Intronic
926766733 2:16328778-16328800 TTGGCTTCCCTGGGCCACATTGG + Intergenic
927297949 2:21476767-21476789 TTGGCTTCCCTGGGCCATATTGG + Intergenic
927549150 2:23981935-23981957 TTGGCTTCCCTGGGCCACATTGG + Intronic
927639509 2:24837932-24837954 TCGGCTTCCCTGGGCCACATTGG - Intronic
927727550 2:25438218-25438240 TTGGCTTCCCTGGGCCACACTGG + Intronic
927761879 2:25764346-25764368 CTGGCTTCCCTGGGCCACATTGG + Intronic
927804207 2:26131189-26131211 TTGGCTTCCCTGGGCCACAGTGG + Intronic
927873820 2:26641132-26641154 TTGGCTTCCCTGGGCCACATTGG - Intronic
927924073 2:26997433-26997455 TGGGCTTCCCTGGGTCACACGGG - Intronic
927993294 2:27463610-27463632 TTGGCTTCCCTGAGCCACATCGG - Intronic
928034023 2:27805120-27805142 TTGGCTTCCCTGGGCCACACTGG + Intronic
928284939 2:29981912-29981934 TTGGCTTCCCTGGGCCACACTGG - Intergenic
928467191 2:31533142-31533164 TTGGCTTCCCTGGACCACATTGG - Intronic
928536810 2:32249133-32249155 TTGGTTTCCCTGGGCCACATTGG + Intronic
928570334 2:32600911-32600933 TTGGCTTCCCTGGGCCACTTTGG + Intronic
928916026 2:36471639-36471661 TTGGCTTCCCTGGGCCACATTGG + Intronic
929230579 2:39555992-39556014 TTGGCTTCTCTGGGCCACATTGG - Intergenic
929389568 2:41454198-41454220 TTGGCTTCCCTGGGCCACACTGG - Intergenic
929396033 2:41523370-41523392 TTGGCTTTCCCGGGCCATATTGG - Intergenic
929655784 2:43730340-43730362 TTGGCTTCCCTGGGCCACACTGG - Intronic
929763136 2:44822497-44822519 TTGGCTTCCCTGGGTCACATTGG - Intergenic
929858545 2:45655428-45655450 TAGGCTTCCCTGGGCCACATCGG - Intronic
929972853 2:46598616-46598638 TGGGCTTCTCTGGGCCGCATTGG - Intronic
930187251 2:48422260-48422282 TTGGCTTCCCTGGGCCACAGTGG - Intergenic
930356558 2:50328289-50328311 TTGGCTTCCCTGGGCCACATTGG - Intronic
930614047 2:53574815-53574837 TTGGCTTCCCTGGGCCACACTGG + Intronic
930676312 2:54204390-54204412 TTGGCTTCCCTGGGCCACACTGG - Intronic
930702326 2:54471023-54471045 TTGGCTTCCCTGGGCCACACTGG - Intronic
930739618 2:54817573-54817595 TTGGCTTCCCTGGGCCACATTGG + Intronic
930868570 2:56147091-56147113 TTGGCTTCCCTGGGCCACACTGG - Intergenic
930880413 2:56263920-56263942 TTGGCTTCCCTGGGCCACACTGG + Intronic
930906040 2:56569211-56569233 TTGGCTTCCCTGGGCCACATTGG + Intergenic
930949224 2:57117088-57117110 TTGGCTTCCCTGGGCCACATTGG - Intergenic
931035494 2:58238232-58238254 TTGGCTTCCCTGGGTCACATTGG - Intronic
931393582 2:61865818-61865840 TTGGCTTCCCTGGGCCACGTTGG - Intergenic
931667429 2:64619431-64619453 TTGGCTTCCCTGGGCCACATGGG - Intergenic
931690680 2:64832335-64832357 TTGGCTTCCCTGGGCCACATTGG - Intergenic
931739812 2:65231775-65231797 TTGGCTTCCCTGGGCCACATTGG + Intronic
931954616 2:67407167-67407189 TTGGCTTCCCTGGGCCACATTGG + Intronic
932094635 2:68836810-68836832 TTGGCTTCTCTGGGCCACATTGG + Intergenic
932195137 2:69776661-69776683 TCGGCTTCCCTGGGCCACATTGG + Intronic
932222220 2:70008710-70008732 TTGGCTTCCCTGGGCCACATTGG - Intergenic
932285766 2:70530419-70530441 TTGGCTTCTCTGGGCCACATTGG + Intronic
932784693 2:74589884-74589906 TTGGCTTCCCTGGGCCACATTGG + Intronic
932810162 2:74818636-74818658 TTGGCTTCCCTGGGCCACATTGG + Intergenic
932958857 2:76388599-76388621 TTGGCTTCCCTGGGCCACATTGG + Intergenic
933372520 2:81433808-81433830 TTGGCTTCTCCGGGCCACATTGG - Intergenic
933509163 2:83217876-83217898 TTGGCTTCCCTGGGCCACACTGG - Intergenic
933608410 2:84408401-84408423 AAGGCTTCCCTGGGCCACATTGG + Intergenic
933638228 2:84730469-84730491 TTGGCTTCCCTGGGCCACATTGG + Intronic
933849821 2:86356886-86356908 TTGGCTTTCCTGGGCCACATTGG + Intergenic
933994961 2:87661380-87661402 TTGGTTTCACTGGGCCACATTGG + Intergenic
934251316 2:90358560-90358582 TTGGCTTCTCAGGGCCACATTGG - Intergenic
934258243 2:91444840-91444862 TTGGCTTCTCAGGGCCACATTGG + Intergenic
934818734 2:97353592-97353614 TGAGATGCCCTGGACCACATTGG + Intergenic
934978262 2:98821512-98821534 TTGGCTTCCCTGGGCCACACTGG + Intronic
935015352 2:99176763-99176785 TTGGCTTCCCTGGGCCACATTGG - Intronic
935094585 2:99932283-99932305 TTGGCTTCCCTGGGCCACATTGG - Intronic
935229880 2:101086678-101086700 TTGGCTTCCCTAGGCCACATTGG + Intronic
935422189 2:102880786-102880808 TTGGCTTCCCTGGGCCACACTGG - Intergenic
935441381 2:103100950-103100972 TTGGCTTCCCTGAGCCACATTGG + Intergenic
935684782 2:105673653-105673675 TTGGCTTCCCGGGGGCACATTGG + Intergenic
935744934 2:106182174-106182196 TTGGAATCCCTGGGCCACAGTGG + Intronic
935759610 2:106308941-106308963 TTGGTTTCCCTGGGCCATATTGG - Intergenic
936004688 2:108873667-108873689 TTGGCTTCCCTGGGCCACACTGG + Intronic
936258832 2:110939862-110939884 TTGGCTTCCCTGGGCCACACTGG - Intronic
936276037 2:111098228-111098250 TTGGCCTCCCTGGGCCACATTGG + Intronic
936298895 2:111289533-111289555 TTGGTTTCACTGGGCCACATTGG - Intergenic
936397768 2:112142091-112142113 GGGGAGACCCCTGGCCACATAGG - Intronic
937212401 2:120283352-120283374 TCGGCTTCCCTGGGCCACATCGG - Intronic
937454189 2:122027115-122027137 TTGGATTCCCTGGGCCACACTGG + Intergenic
937457936 2:122059069-122059091 TTGGCTTCCCTGGGCCACACTGG - Intergenic
937517907 2:122676613-122676635 TGGGCTTCCCTGGGCCACACTGG - Intergenic
937579372 2:123465111-123465133 TTGGCTTCCCTGGGCCACATTGG - Intergenic
937708242 2:124946675-124946697 TTGGCTTCCCTGGGCCACAATGG + Intergenic
938157639 2:128955142-128955164 TTGGCTTCTCTGGGCCACATTGG + Intergenic
938225680 2:129614351-129614373 TTGGCTTCCCTGGGCCACACTGG - Intergenic
939064520 2:137466571-137466593 TTGGCTTCCCTGAGCCACATTGG - Intronic
939325274 2:140680033-140680055 TTGGGTTCCCTGGGCCACATTGG - Intronic
939387872 2:141524636-141524658 TTGGCTACCCTGGGCCACATTGG - Intronic
939792796 2:146600159-146600181 TTGGTTTCCCTGGGCCACATTGG - Intergenic
939977662 2:148737726-148737748 TTGGCTTCCCTGGGCCACATTGG + Intronic
940221670 2:151359336-151359358 TTGCCTTCCCTGGGCCACATTGG + Intronic
940432245 2:153606561-153606583 TTGGCCTCCCTGGGCCACATTGG - Intergenic
940441023 2:153716432-153716454 TTGGTTTCCCTGGGCCACACTGG - Intergenic
940522131 2:154764618-154764640 TTGGCTTCCCTGGGCTACATTGG + Intronic
940896778 2:159088757-159088779 TTGGCTTCCTTGGGCCACATTGG - Intronic
940940030 2:159549516-159549538 TTGGCTTCCCCGGGCTACACTGG + Intronic
941203025 2:162538300-162538322 TTGGTTTCCCTGGGCCACATTGG - Intronic
941226793 2:162859831-162859853 TTGGCTTCCCTGGGCCACATTGG - Intergenic
941266444 2:163368570-163368592 TTGGCTTCCCTGGGCCACAGTGG - Intergenic
941562717 2:167068913-167068935 TTGGCTTCCCTAGGCCACATTGG - Intronic
942674030 2:178407589-178407611 TTGGCTTCCCTGGGCCACACTGG - Intergenic
942767008 2:179469207-179469229 TGGGCTTCCCTGGGCCACACTGG + Intronic
942897267 2:181072125-181072147 TTGGCATCCCTGGGCCACATTGG + Intronic
942901092 2:181119663-181119685 TTGGCTTCCCTGGGCCACACTGG + Intergenic
943487444 2:188503641-188503663 TTGGCCTCCCTGGGCCACATTGG - Intronic
943561107 2:189463472-189463494 TTGGCTTCCCTGAGCCACATTGG + Intronic
943597074 2:189871233-189871255 TTGGCTTCCCTGGGACACATTGG + Intronic
943939286 2:193970423-193970445 TTGGCTTCCCTGGGCCACAGTGG + Intergenic
944192700 2:197020424-197020446 TTGGCTTCCCTGGGCCACGTTGG + Intronic
944242883 2:197502314-197502336 TTGGCTTCCCTGGGCCACACTGG - Intronic
944271484 2:197788546-197788568 TTGGCTTCCCTGGGCTACATTGG + Intergenic
944443048 2:199761969-199761991 TTGGCTTCCCTAGGCCACATTGG + Intronic
944474161 2:200086993-200087015 GGGGATTCACCGGGCCAGATGGG + Intergenic
944749694 2:202696339-202696361 TTGTCTTCCCTGGGCCACATTGG + Intronic
944773159 2:202933969-202933991 TTGGCTTCCCTGGACCACATTGG + Intronic
944908455 2:204285880-204285902 TTGGCTTCCCTGGGCCACATTGG - Intergenic
945025946 2:205620208-205620230 TTGGCTTCCCTGGGCCACCTTGG + Intergenic
945426861 2:209716608-209716630 TTGGCTTCCCTGGGCCACATTGG - Intronic
945586223 2:211667013-211667035 TTGGCTTCCCTGGGTCACATTGG + Intronic
945722141 2:213430542-213430564 TTGGCTTCCCTGGGCCACATTGG - Intronic
945730656 2:213528705-213528727 TTGGCTTCCCTGGGCCACACTGG + Intronic
946017640 2:216616886-216616908 TTGGCTTCCCTGGGCCACATTGG - Intergenic
946387416 2:219393074-219393096 TTGGCTTCCCTGGGCCACATTGG + Intronic
946424978 2:219589640-219589662 TTGGCTTCCCTGGGCCACATTGG - Intergenic
946471272 2:219963554-219963576 TTGGCTTCCCTGGGCCACATTGG - Intergenic
946494514 2:220182261-220182283 TCAGCTTCCCTGGGCCACATTGG - Intergenic
946644007 2:221814529-221814551 TCGGCTTCCCTGGGCCACACTGG - Intergenic
946783893 2:223222158-223222180 TTGGCTTCCCTGGGCCACATGGG - Intergenic
947186314 2:227458691-227458713 TTGGCTTCCCTGGGCCACACTGG + Intergenic
947298621 2:228663083-228663105 TTGGCTTCCCTGGACCACATTGG - Intergenic
947410037 2:229827906-229827928 TTTGCTTCCCTGGGCCACATTGG - Intronic
947646604 2:231746483-231746505 TTGGCTTCCCTGGGCCACATTGG - Intronic
948085967 2:235248497-235248519 TTGGATTCCCTGGGCCACACTGG + Intergenic
948093067 2:235312040-235312062 TTGGCTTCTCTGGGCCACATAGG - Intergenic
948295927 2:236860565-236860587 TTGACTTCCCCGGGCCACACTGG - Intergenic
948652729 2:239458598-239458620 TGGGATGCCCTGAGCCACGTTGG - Intergenic
948734959 2:239996881-239996903 TTGGCTTCCCTGGGCCACATTGG - Intronic
948835079 2:240622446-240622468 TTGGCTTCCCCGGGCCGCATTGG + Intronic
948937917 2:241180308-241180330 TGGGCTTCCCTGGGCCACACTGG + Intronic
949011699 2:241683497-241683519 TTGGCTTCCCTGGGCCACATTGG - Intronic
949063973 2:241978350-241978372 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1168911087 20:1447514-1447536 TTGGCTTCCCTGGGCCACTTTGG - Intronic
1169169572 20:3453767-3453789 TTGGCTTTCCTGGGCCACATTGG + Intergenic
1169324300 20:4662793-4662815 CTGGCTTCCCTGGGCCACATTGG + Intergenic
1169642845 20:7774306-7774328 TTGGCTTCCCTGGGGCACATTGG + Intergenic
1169792883 20:9429972-9429994 TTGGCTTCCTTGGGCCACATTGG + Intronic
1169794651 20:9448694-9448716 TTGGCTTCCTTGGGCCACATTGG - Intronic
1169845706 20:9989025-9989047 TTGGCTTCCCTGGGCCACATTGG - Intronic
1169892525 20:10468955-10468977 TTGGCTTCCCTGGGCCACACTGG + Intronic
1169970915 20:11268677-11268699 TTGGCTTCCTTGGGCCACATTGG - Intergenic
1170130800 20:13017695-13017717 TTGGCTTTCCAGGGCCACATTGG - Intronic
1170521362 20:17189016-17189038 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1170704819 20:18736014-18736036 TTGGCTTCCCTGAGCCACATTGG - Intronic
1170913990 20:20604764-20604786 TTGGCTTCCCCAGGCCACATTGG - Intronic
1170991868 20:21309607-21309629 TTGGCTTCCCTGGGCCACTTTGG - Intronic
1171004556 20:21451668-21451690 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1172166246 20:32901240-32901262 TTGGCTTCCCTGGGCCACATAGG + Intronic
1172238166 20:33392551-33392573 TTGACTTCCCTGGGCCACATTGG - Intronic
1172312748 20:33931026-33931048 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1172996812 20:39076901-39076923 TTGGCTTTCCTGGGCCACATTGG - Intergenic
1173363533 20:42365574-42365596 TTGGATTCCCCGGGCCACATTGG + Intronic
1173372401 20:42448773-42448795 TTGGCTTCCCTGGGCCACATTGG + Intronic
1173513615 20:43649505-43649527 TTGGCTTCCCTGGGCAACATTGG - Intergenic
1173597265 20:44266868-44266890 TTGGCTTCCTTGGGCCACATTGG + Intronic
1173634099 20:44539783-44539805 TTGGCTTCCCTGGGCCACATTGG - Intronic
1173925799 20:46780383-46780405 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1174066534 20:47869734-47869756 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1174541149 20:51290695-51290717 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1174610759 20:51796528-51796550 TTGGCTTCCCTGGTCCACATTGG - Intronic
1174903160 20:54522133-54522155 TTGTCTTCCCTGGGCCACATTGG + Intronic
1175296944 20:57915055-57915077 TGGGATGCCCTGGGCCACCTCGG - Intergenic
1175354093 20:58348715-58348737 TTGGCTTCCCTGGGCCACATTGG + Intronic
1175406195 20:58731016-58731038 TTGGCTTCCCTGGGCCACAACGG + Intergenic
1175672459 20:60917184-60917206 TTGGCTTCCCCAGGCCACATTGG + Intergenic
1175751109 20:61498677-61498699 TTGTCTTCCCTGGGCCACATTGG + Intronic
1176166923 20:63679254-63679276 TGGGATTCCCCCGACCAGGTCGG - Intronic
1177245301 21:18515399-18515421 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1177394294 21:20512678-20512700 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1177691221 21:24510163-24510185 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1177777952 21:25590300-25590322 TTGGCTTCCCTGGGCCACACTGG + Intronic
1178161932 21:29928026-29928048 TTGGCTTCCCTGGGCCACACTGG + Intronic
1178279680 21:31270799-31270821 TTGGCTTCCCTGGGCCACATTGG - Intronic
1178401613 21:32290982-32291004 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1178511059 21:33205496-33205518 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1178638415 21:34325986-34326008 TGGGCTTCCCTGGGCCACATTGG - Intergenic
1178866117 21:36328802-36328824 TTAGCTTCCCTGGGCCACATTGG + Intronic
1178977076 21:37229214-37229236 TTGGCTTCCCTGGGCCACGTTGG + Intronic
1179087701 21:38234339-38234361 TTGGCTTCCCTAGGCCACATTGG - Intronic
1180092495 21:45540205-45540227 AGGGAGTCCCAGGGCCAAATGGG - Intronic
1180886494 22:19248393-19248415 TTGGATCCCCTGGGCCACACTGG - Intronic
1181395659 22:22619308-22619330 TTGGCTTCTCTGGGCCACATTGG + Intergenic
1181610838 22:24010847-24010869 TTGGTTTCCCTGGGCCACGTTGG - Intergenic
1181663037 22:24367511-24367533 TTGGCTTCCCTGGGCCACAATGG - Intronic
1181689875 22:24553236-24553258 TTGGCTTCCCTGGGCCACACTGG + Intronic
1181720312 22:24769270-24769292 TTGACTTCCCCGGGCCACATTGG + Intronic
1181748219 22:24970645-24970667 TCGGCTTCCCTGGGCCACACTGG + Intronic
1181888572 22:26041218-26041240 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1182175118 22:28277815-28277837 TGGGATCCTCGGGGCCAGATTGG - Intronic
1182435968 22:30330061-30330083 TCGGCTTCCCTGGGCCACACCGG + Intergenic
1182872611 22:33661994-33662016 TTGGCTTCCCTGGGCCACACTGG + Intronic
1183276746 22:36903162-36903184 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1184053295 22:42025413-42025435 TTGGCTTCCCTGGGCCACATTGG - Intronic
1184508725 22:44919444-44919466 TTGGTTTCCCTGGGCCACACTGG - Intronic
1184624684 22:45715603-45715625 TTGGCTTCCCTGGGCCACACTGG - Intronic
1185000449 22:48242270-48242292 TCGGCTTCCCTGGGCCACCTTGG + Intergenic
1185098327 22:48823621-48823643 TGGGCTTCCCTGGGCCACACTGG + Intronic
1185422845 22:50744699-50744721 TGTGATTCCCACGACCACATAGG - Exonic
1203288970 22_KI270735v1_random:16262-16284 TCGGCTTCTCAGGGCCACATTGG - Intergenic
1203324743 22_KI270738v1_random:3445-3467 TTGGCTTCTCAGGGCCACATTGG - Intergenic
949091485 3:34420-34442 TTGGCTTCCCTGGGCCACACTGG - Intergenic
949273086 3:2243581-2243603 TTGGCTTCCCTGGGCCACATGGG - Intronic
949538713 3:5015666-5015688 TTGGCTTCCCTGGGCCACATTGG + Intergenic
949634270 3:5965791-5965813 TCGGCTTCCCTGGGCCACATTGG + Intergenic
949798307 3:7875611-7875633 TGGATTTCCCTGGGCCATATTGG + Intergenic
949812669 3:8023004-8023026 TTGGTTTCCCTGGACCACATTGG + Intergenic
949911219 3:8909760-8909782 TTGGCTTCCCTGGGCCACACTGG + Intronic
949978266 3:9480617-9480639 TTGGCTTCCCGGGGCCACACTGG + Intergenic
950341982 3:12255324-12255346 TTGGCTTCCCTGGTCCACATTGG + Intergenic
950674193 3:14544825-14544847 TGGGATTCCACCAGCCACAGGGG + Intergenic
950806410 3:15607032-15607054 TTGGCTTCCCTGGGCCACACTGG - Intronic
951083353 3:18479174-18479196 TTGGCTTCCCTGGGCCACACTGG - Intergenic
951714528 3:25625677-25625699 TTGGCTTCCCTGGGCCACATTGG - Intronic
951994093 3:28707685-28707707 TTGGCTTCCCTGGGCCACTTTGG - Intergenic
952092470 3:29905673-29905695 TTGGCTTCCCTGGGCCACATTGG + Intronic
952242395 3:31545888-31545910 TCGGCTTCCCTGGGCCACAGTGG - Intronic
952300605 3:32101486-32101508 TTGGCTTCCCTGGGCCACACTGG - Intergenic
952757825 3:36887686-36887708 TTGGCTTCCCTGGGCCACATTGG - Intronic
952759570 3:36902034-36902056 TTGGCTTCCCTGGGCCATATTGG + Intronic
952879399 3:37974118-37974140 TCGGCTTCCCTGGGCCACATTGG - Intronic
953056888 3:39395033-39395055 TTGGCTTCCCTGGGCCACATTGG + Intronic
953138002 3:40200187-40200209 TTGGCTTCCCTGGGCCACAGTGG + Intronic
953249420 3:41230825-41230847 TTGGCTTCCCTGGGCCACATTGG + Intronic
953284292 3:41591417-41591439 TTGGCTTCCCTGGGCCACACTGG + Intronic
953313108 3:41899682-41899704 TTGGCTTCCCTGGGCCACATTGG - Intronic
953380567 3:42468715-42468737 TTGGCTTCCCTGGGCCACGTTGG + Intergenic
953399164 3:42597786-42597808 TTGGTTTACCTGGGCCACATTGG - Intronic
953657208 3:44863169-44863191 TTGGCTTCCCTGGGCCACACTGG - Intronic
954013752 3:47666787-47666809 TTGGCTTCCCTGGGCCACATTGG - Intronic
954019256 3:47724649-47724671 TTGGCTTCCCTGGGCCACATTGG - Intronic
954527047 3:51281189-51281211 TCGGCTTCCCTAGGCCACATTGG + Intronic
954832831 3:53437482-53437504 TTGGCTTCCCTGGGCCACATTGG + Intergenic
955141741 3:56276748-56276770 TTGGCTTCGCTGGGCCACATTGG + Intronic
955217530 3:56996983-56997005 TTGGCTTCCCTGAGCCACATTGG - Intronic
955330809 3:58045543-58045565 TTGGCTTCCCTGGGCCACACTGG - Intronic
955489236 3:59465730-59465752 TTGGCTTCCCTGGGCCACATTGG - Intergenic
955510564 3:59676495-59676517 TTGGCTTCCCCAGGCCACATTGG + Intergenic
955550318 3:60077593-60077615 AGGGATTCCCCTGGCTAAATAGG + Intronic
955635669 3:61026722-61026744 TTGGCTTCCCTGGGCCACATTGG - Intronic
955759142 3:62259321-62259343 TTGGCTTCCCTAGGCCACATTGG + Intronic
955832540 3:63019338-63019360 TTGGCTTCCCTGGGCAACATTGG + Intergenic
955926290 3:64008580-64008602 TTGGCTTCCCTGGGCCACACTGG - Intergenic
955943427 3:64168287-64168309 TTGGCTTCCCTGGGCCACACTGG + Intronic
956188146 3:66582117-66582139 TTGGCTTCCGTGGGCCACATTGG + Intergenic
956217252 3:66861217-66861239 TTGGCTTCCCTGGGCCACACTGG + Intergenic
956278143 3:67526204-67526226 TTGGCTTCCCTGGGCCACAATGG + Intronic
956407015 3:68938427-68938449 TTGGCTTCCCTGGGCCACATTGG + Intergenic
956475421 3:69614454-69614476 TTGGCTTCCCTGGGCCACATTGG - Intergenic
956950021 3:74272101-74272123 TTGGCTTCCCTGGGCCACAGTGG + Intronic
956963557 3:74432304-74432326 TTGGCTTCCCTAGGCCACATTGG + Intronic
957031804 3:75250641-75250663 TTGGCTTCCCTGGGCCACACTGG - Intergenic
957056490 3:75446920-75446942 TGGGATGCCCCTGCCCAAATTGG - Intergenic
957352500 3:79044041-79044063 TTGGCTTCCCTGGGCCACATTGG + Intronic
957566079 3:81885828-81885850 TTGGCTTCCCTGAGCCACATCGG - Intergenic
957893389 3:86388472-86388494 TTGGCTTCCCTGGGCCACATTGG + Intergenic
958102350 3:89029256-89029278 TTGGCTGCCCTGGGCCACATTGG - Intergenic
958599508 3:96277035-96277057 TTGGCTTCCCTGGGCCACACTGG + Intergenic
958609470 3:96406028-96406050 TTGGCTTCCCTGGGCCACATTGG - Intergenic
958841507 3:99210359-99210381 TTGGCTTCCCTGGGCCACATTGG + Intergenic
958900957 3:99886332-99886354 TTGGCTTCCCTGGGCCACACTGG + Intronic
959084985 3:101842669-101842691 TTGGCTTCCCTGGGCCACACTGG - Intronic
959171454 3:102848815-102848837 TTGTCTTCCCTGGGCCACATTGG - Intergenic
959523960 3:107355419-107355441 TTGGCTTCCCTGGGCCACATTGG - Intergenic
959574727 3:107922305-107922327 TTGGCTTCCTCGAGCCACATTGG + Intergenic
960076856 3:113496147-113496169 TTGGCTTCCCTGGGGCACATTGG - Intronic
960353624 3:116623790-116623812 TTGGCTTCCCTGGGCCACATTGG - Intronic
960567662 3:119151749-119151771 TTGGCTTCCCTGGGCCACTTGGG + Intronic
960605002 3:119496349-119496371 TTGGCTTCCCTGGGCCACATTGG - Intergenic
960836261 3:121909883-121909905 TTGGCTTCCCTGGGCCACATTGG - Intronic
960927918 3:122814872-122814894 TTGGATTCCCTGGGCCACACTGG - Intronic
960939662 3:122925287-122925309 TTGGCTTCCCTGGACCACATTGG + Intronic
961118157 3:124349517-124349539 TTGGCTTCCCTGGGCCACATTGG - Intronic
961183467 3:124894839-124894861 TTGGCTTCCCTGGGCCACATTGG + Intronic
961482677 3:127194250-127194272 TTGGCTTCCCTGGGCCACACTGG + Intronic
961584007 3:127907371-127907393 TGGGGTTCCACAGGTCACATTGG + Intergenic
961902148 3:130223564-130223586 TTGGCTTCTCTGGGCCACATTGG - Intergenic
962334562 3:134515731-134515753 TTGGCTTCCCTGGGCCAGATTGG + Intronic
962545527 3:136430543-136430565 TTGGCTTCCCTGGGCCACAATGG + Intronic
962574669 3:136745751-136745773 TTGGCTTCCCTGGGCCACATTGG + Intronic
962712435 3:138099384-138099406 TTGGCTTCCTTGGGCCACATTGG - Intronic
962819262 3:139032244-139032266 TTGGCTTCCCTGGGCCACATTGG - Intronic
963615019 3:147525765-147525787 TTGGCTTCCCTGGGCCATATTGG + Intergenic
963843659 3:150133127-150133149 TTGGCTTTCCTGGGCCACATTGG - Intergenic
963933276 3:151026379-151026401 TTGGCTTCCCTGGGCCACATTGG + Intergenic
963967706 3:151391506-151391528 TTGGCTTCCTTGGGCCACATTGG + Intronic
964020677 3:152006630-152006652 TTGGCTTCCCTGGGCCACATTGG - Intergenic
964348046 3:155774745-155774767 TTGGCTTCCCTGGGCCACATTGG - Intronic
964481200 3:157139955-157139977 CTGGCTTCCCTGGGCCACATTGG + Intergenic
964505312 3:157392534-157392556 TTGGCTTCCCTGGGCCACATCGG + Intronic
964587068 3:158318132-158318154 TTGGCTTCCCTGGGCCACACTGG - Intronic
964785739 3:160394230-160394252 TCGGCTTCCCTAGGCCACATTGG + Intronic
964823007 3:160794698-160794720 TTGGCTTCCCTGGGCCACATTGG + Intronic
964840757 3:160990994-160991016 TTGGCTTCCCTGGGCCACATTGG + Intronic
964842329 3:161007720-161007742 TTGGCTTCCCTGGGCCACACAGG - Intronic
965477544 3:169176028-169176050 TTGGCTTCCCTGGGCCACACTGG + Intronic
965661580 3:171047483-171047505 TTGGCTTCCCTGGGCCACATTGG + Intergenic
965883915 3:173420747-173420769 TTGGCTTCCCTGGGCCACACCGG - Intronic
965990630 3:174813190-174813212 TTGGCTTCCCTGGTCCACATTGG + Intronic
966139304 3:176736551-176736573 CTGGCTTCCCTGGGCCACATTGG - Intergenic
966176254 3:177140968-177140990 TTGGCTTCCCTGGGCCACAATGG - Intronic
966356937 3:179090535-179090557 TTGGTTTCCCTGGGCCACATTGG - Intergenic
966380814 3:179343371-179343393 TTGGCTTCCCTGGGCCACACTGG - Intergenic
966601860 3:181783668-181783690 TTGGCTTCCCTGGGCCACAATGG + Intergenic
966823595 3:183944804-183944826 TTGGCTTCCCAGGGCCACATTGG - Intronic
966948899 3:184798101-184798123 TTGGCTTCTCTGGGCCACATTGG - Intergenic
967634102 3:191780137-191780159 TTGGCTTCCCTGGGCCACATTGG - Intergenic
967794578 3:193585558-193585580 TTGGCTTCCCTGGGCCACATTGG - Intronic
968006300 3:195245471-195245493 TTGGCTTCCCTGGGCCACACTGG - Intronic
968144796 3:196288908-196288930 TTGGCTTCCCTGGGGCACATTGG + Intronic
968179228 3:196578871-196578893 TTGGCTTCCCTGGGCCACACTGG - Intronic
968378028 4:60929-60951 TTGGCTTCCCTGGGCCACATTGG + Intronic
968394399 4:220361-220383 TTGGCTTCCCTGGGCCACATTGG + Intergenic
968400752 4:294747-294769 TTGGCTTCCTTGGGCCACATTGG - Intronic
968406622 4:345420-345442 TTGGCTTCCCTGGGCCACATTGG + Intronic
968822093 4:2861996-2862018 TTGGCTTCCCTGGGCCACACTGG - Intronic
969219327 4:5749255-5749277 TTGGCTTCCCTGGGCCACATTGG + Intronic
969224848 4:5788960-5788982 TTGACTTCCCCGGGCCACACTGG - Intronic
969259932 4:6026945-6026967 TTGACTTCCCTGGGCCACATTGG - Intronic
969375154 4:6758458-6758480 TTGACTTCCCTGGGCCACATTGG + Intergenic
969754704 4:9141431-9141453 TGGGATGCCCCTGCCCAAATCGG + Intergenic
969938563 4:10707150-10707172 TTGGCTTCCCTGGGCCACATTGG + Intergenic
970035981 4:11736613-11736635 TTGGTTTCCATGGGCCACATTGG + Intergenic
970119800 4:12740911-12740933 TTGGCTTCCCCAGGCCACATTGG + Intergenic
970226503 4:13863840-13863862 CTGGCTTCCCTGGGCCACATTGG - Intergenic
970261670 4:14231233-14231255 TTGGTTTCCCAGGGCCACATTGG + Intergenic
970398578 4:15696181-15696203 GTGGCTTCCCTGGGCCACATTGG - Intronic
970413081 4:15829417-15829439 TTGGCTTCCCTGGGCCACATTGG + Intronic
970526246 4:16935046-16935068 TTGGCTTACCTGGGCCACATTGG - Intergenic
970627740 4:17907791-17907813 TTGGCTTCCCCGGGCTACAATGG - Intronic
971277546 4:25212311-25212333 TTGGCTTCCCTGGGCCACATTGG + Intronic
971283194 4:25259619-25259641 TTGGCTTCCCTGGGCCACACTGG + Intronic
971774429 4:30943798-30943820 TTGGCTTCCCTGGGCCACACTGG - Intronic
971879532 4:32352145-32352167 TTGGTTTCCCTTGGCCACATTGG + Intergenic
971957439 4:33440121-33440143 TGGGATTCGCCTGTCCACAGTGG - Intergenic
972055305 4:34794886-34794908 TTGGGTTCCCTGGGTCACATTGG - Intergenic
972113454 4:35595581-35595603 TTGGCTTCCCTGAGCCACATTGG - Intergenic
972323032 4:37990390-37990412 TTGGCTTCCCTGGGCCACACTGG - Intronic
972327212 4:38028028-38028050 TTGGCTTCCCTGGGCCACATTGG + Intronic
972391723 4:38619896-38619918 TTGGCTTCCCTAGGCCACATTGG - Intergenic
972445317 4:39137779-39137801 TGGGCTTCCACTGGCCAAATAGG + Intergenic
972501280 4:39680337-39680359 TTGGCTTTCCTGGGCCACATTGG + Intergenic
972529320 4:39947528-39947550 TTGGCTTCCCTGGGCCACACTGG + Intronic
972976702 4:44644257-44644279 TTGGCTTCCCTGGGCCACACTGG + Intronic
973028113 4:45299704-45299726 ACGGCTTCCCTGGGCCACATTGG + Intergenic
973597850 4:52510995-52511017 TTGGCTTTCCTGGGCCACATTGG - Intergenic
973975950 4:56262590-56262612 TTGGTTTCCCTGGGCCACACTGG - Intronic
974874224 4:67683651-67683673 TTTGCTTCCCTGGGCCACATTGG - Intronic
975116214 4:70683895-70683917 TTGGTTTCCCTGGGCCACACTGG - Intronic
975671822 4:76787649-76787671 TTGGTTTCCCTGGGCCACAGTGG + Intergenic
975858640 4:78652048-78652070 AAGGCTTCCCTGGGCCACATTGG - Intergenic
975893646 4:79059763-79059785 TGAGATTCCCATGACCACATGGG + Intergenic
975997158 4:80329154-80329176 TTGGCTTCCCTGGGCCACATTGG - Intronic
976269230 4:83214091-83214113 TTGGCTTCCCTGGGCCACATTGG - Intergenic
976291153 4:83419237-83419259 TTGGCTTCCCTGGGCCACATTGG - Intronic
976305703 4:83557435-83557457 TTGGCTTCCCTAGGCCACATTGG + Intronic
976426270 4:84906852-84906874 TGGGCTTCCCTGGGCCACACTGG - Intronic
976433879 4:84994671-84994693 TTGGCTTCCCTGGGCCACACTGG + Intergenic
976718783 4:88150579-88150601 TTGGCTTCCCTGGGCCACACTGG + Intronic
976756845 4:88507755-88507777 TTGGCTTCCCTGGGCCACATGGG + Intergenic
976773933 4:88686203-88686225 TTGGCTTCCCCAGGCCACATTGG - Intronic
976877008 4:89865652-89865674 TTGGCTTCCCCAGGCCACACTGG + Intergenic
976986821 4:91310920-91310942 TTGGTTTCCCTAGGCCACATTGG - Intronic
977055522 4:92185574-92185596 TTGGCTTCCCTGGGCCACACTGG + Intergenic
977549394 4:98424317-98424339 TGGATTTCCCTGGGCCATATTGG + Intronic
978083653 4:104623617-104623639 TTGGCTTCCCTAGGCCACATTGG + Intergenic
978150832 4:105432792-105432814 TTGGCTTCCCTGGGCCACATTGG - Intronic
978293468 4:107174635-107174657 TTGGCGTCCCTGGGCCACATTGG - Intronic
978386620 4:108182123-108182145 TTGGCTTCCCTGGGCCACAGTGG - Intergenic
978489016 4:109290692-109290714 TTGGCTTCCCTGGGCCACATTGG + Intronic
978822942 4:112986958-112986980 TTGGCTTCCCTAGGCCACATTGG + Intronic
978941207 4:114437932-114437954 TTGGCTTCCCTTGGCCACATTGG - Intergenic
979229168 4:118326897-118326919 TTGGCTTCCCTGGGCCACATTGG + Intronic
979378030 4:119972033-119972055 TTGGCTTTCCTGGGCCACATTGG + Intergenic
979522601 4:121686102-121686124 TTGGCTTCTCTGGGCCACATTGG - Intronic
979550306 4:121983519-121983541 TTGGCTTCCCTGGGCCACATTGG + Intergenic
979702131 4:123681883-123681905 TTGGCTTCCCTGGGCCACATTGG + Intergenic
979992915 4:127396555-127396577 TGGGCTTCCCAGAGCCACACTGG + Intergenic
980028157 4:127791281-127791303 TTGGCTTCCCTGGGCCCCATTGG + Intronic
980104776 4:128577328-128577350 TTGGCTTCCCTGTGCCACATTGG + Intergenic
980155575 4:129100412-129100434 TTGGCTTCCCTGGACCACATTGG - Intronic
980294017 4:130886460-130886482 TTGGCTTCCCTGGGCCACATTGG + Intergenic
980320666 4:131268873-131268895 TTGGCCTCCCTGGGCCACATTGG + Intergenic
980515914 4:133860295-133860317 TTGGCTTCCCTGGGCCACATTGG - Intergenic
980793083 4:137645038-137645060 TTGGCTTCCCTGGACCACATTGG - Intergenic
980799313 4:137728537-137728559 TCAGCTTCCCCAGGCCACATTGG - Intergenic
980902413 4:138917507-138917529 TTGGCTTTCCTGGGCCACATTGG + Intergenic
981067467 4:140499796-140499818 TTGGCTTCCCTGGGCCACATTGG + Intergenic
981180255 4:141733691-141733713 TTGATTTCCCTGGGCCACATTGG - Exonic
981237359 4:142434810-142434832 TTGGCTTCTCTGGGCCACATTGG + Intronic
981342040 4:143632727-143632749 TTGGCTTCCCTGGGCCACATTGG + Intronic
981361872 4:143855331-143855353 TTGGCTTCCCTGGGCCACATAGG - Intergenic
981381702 4:144079434-144079456 TTGGCTTCCCTGGGCCACATAGG - Intergenic
981420985 4:144550006-144550028 TTGGCTTTCCGGGGCCACATTGG + Intergenic
981467000 4:145084498-145084520 TTGGCTTCCCTGGGCCACACTGG + Intronic
981638813 4:146912023-146912045 TTGGCTTCTCTGGGCCACATTGG + Intronic
981751617 4:148097830-148097852 TTGGCTTCCCTGGGCCACATTGG - Intronic
981881184 4:149614643-149614665 TTGGCTTCCCTGGGCAACATTGG + Intergenic
981919897 4:150076333-150076355 TTGGCTTCCCTGGGGCACATTGG - Intergenic
982064532 4:151641608-151641630 TTGGCTTCCCTGGGCCACACTGG - Intronic
982160670 4:152565854-152565876 TTGACTTCCCTGGGCCACATTGG - Intergenic
982693504 4:158573570-158573592 TGGGCTTCCCTGGACCACATTGG - Intronic
982933554 4:161440327-161440349 TTGGCTTCCCTGGGCCACAATGG + Intronic
982941285 4:161560125-161560147 TTGGCTTCCCTGGGCCACAATGG - Intronic
983146646 4:164224326-164224348 TTGGCTTCCCTTGGCCACATTGG - Intronic
983221392 4:165047439-165047461 TTGGCTTCCCTGGGCCACATTGG - Intergenic
983305285 4:165976987-165977009 TTGGCTTCCCTGGGCCACACTGG - Intronic
983366189 4:166793362-166793384 TTGGCTTCCCTGGGCCACACTGG + Intronic
983519766 4:168695956-168695978 TTGAATTCCCTGGGCCACACTGG + Intronic
983556912 4:169067470-169067492 TTGGCTTTCCTGGGCCACATTGG - Intergenic
983722850 4:170878851-170878873 TTGGCTTCCCTGGGCCACATTGG - Intergenic
983743521 4:171165498-171165520 TTGGCTTCCCTGGGCCACACTGG - Intergenic
983833287 4:172358596-172358618 TTGGCTTCCCTGGGCCACACTGG - Intronic
983849986 4:172568985-172569007 TTGGCTTCCCTGGGCCACACTGG - Intronic
983867814 4:172789490-172789512 TTGGATTCCCTGGGTCACATTGG - Intronic
984133326 4:175905458-175905480 TTGGCTTCCCTGGGCCACAGTGG - Intronic
984253037 4:177357441-177357463 TTGGCTTCCCTGGGCCACAGTGG - Intronic
984509412 4:180660374-180660396 TTGGTTTCCCTGAGCCACATTGG + Intergenic
984674248 4:182528719-182528741 TTGGCTTCCCTGGGCCACATTGG + Intronic
984738597 4:183136803-183136825 TTGGTTTCCCTGGGCCACACTGG - Intronic
984812715 4:183808811-183808833 TTGGCTTCCCTGGGCCACATAGG + Intergenic
985089686 4:186350490-186350512 TTGGCTTCCCTGGGCCACATTGG - Intergenic
985292363 4:188399767-188399789 TTGGCTTCCCTGGGCCACATTGG - Intergenic
985306218 4:188543535-188543557 TTGGCTTCCCTGGGACACATTGG + Intergenic
985559079 5:573094-573116 TTGGCTTCCCTTGGCCACATTGG - Intergenic
985627941 5:999770-999792 TGGGATTCTCCTGGCAACAGGGG - Intergenic
985748148 5:1659480-1659502 TGGTGAGCCCCGGGCCACATGGG - Intergenic
985749559 5:1666546-1666568 TTGGCTTCCCTGGGCCACACTGG + Intergenic
985922863 5:2993110-2993132 TTGGCTTCCCCAGGCCACAATGG + Intergenic
986024199 5:3834927-3834949 TTGGCTTCCCTGGGCCACATTGG - Intergenic
986135211 5:4970751-4970773 TTGGCTTTCCTGGGCCACATTGG - Intergenic
986139105 5:5012916-5012938 TTGGCTTCCCTGGGCCACCTTGG + Intergenic
986173168 5:5330166-5330188 TTGGCTTCCCTGGGCCTCATTGG + Intergenic
986253965 5:6086301-6086323 TTGGCTTCCCTGGGCCACATTGG + Intergenic
987042588 5:14076913-14076935 TTGGCTTCCCTGGGCCACATTGG + Intergenic
987098329 5:14569914-14569936 TTGGCTTCCCTGGGCCACATTGG - Intergenic
987246009 5:16049601-16049623 TTGGCTTCCCAGGGCCACATTGG - Intergenic
987337774 5:16912143-16912165 TTGGCTTCCCTGGGCCACATTGG - Intronic
987376056 5:17236098-17236120 TTGGCTTCCCTGGGCCACACTGG - Intronic
987882251 5:23763215-23763237 TTGGCTTCCCTGGGCCACACTGG - Intergenic
988527332 5:31998649-31998671 TTGGCTTCCCTGGGCCACATTGG + Intronic
988547344 5:32171199-32171221 TTGGCTTCCCTGGGCCACACTGG + Intronic
988659781 5:33252811-33252833 TTGGCTTCCCTGGGCCACACTGG + Intergenic
988720058 5:33868855-33868877 TTGGCTTCTCTGGGCCACATTGG - Intronic
988790314 5:34601775-34601797 TTGGCTTCCCTGGGCCACATCGG + Intergenic
988901210 5:35734371-35734393 TTGGCTTCCCCGGGCCACAAGGG + Intronic
988932860 5:36053952-36053974 TTGGCTTCCCTGGGCCACATTGG + Intronic
989020826 5:37005149-37005171 TTGGCTTCCCTGGGCCACAGTGG - Intronic
989033174 5:37140931-37140953 TTGGCTTCCCTGAGCCACATTGG - Intronic
989070125 5:37501420-37501442 TTGGCTTCCTTGGGCCACATTGG + Intronic
989157876 5:38361541-38361563 TTGGCTTCCCTGGGCCACATTGG + Intronic
989988942 5:50738636-50738658 TTGGCTTCCCTGGGCCACAGTGG + Intronic
990324450 5:54661104-54661126 TTGGGTTCCCCGGGCCACATTGG - Intergenic
990350033 5:54906857-54906879 TTGGCTTCCCTGGGCCACATTGG + Intergenic
990372579 5:55135839-55135861 TTGGCTTCCCTGGGCCACATTGG - Intronic
990781647 5:59371110-59371132 TTGGCTTCCCTGGGCCACATTGG - Intronic
991097914 5:62758913-62758935 TTGGCTTCCCAGGGCCACATTGG - Intergenic
991200778 5:63988964-63988986 TTGGCTTCCCTGGGCCACAGTGG - Intergenic
991273400 5:64814157-64814179 TAGGCTTCCCTGGGCCACACTGG - Intronic
991412829 5:66361927-66361949 TTGGCTTCTCTGGGCCACATTGG - Intergenic
991697247 5:69284742-69284764 TTGGCTTCCCTGGGCCACACTGG + Intronic
992029266 5:72704981-72705003 TTGGCTTCCCTGGGCCACATTGG - Intergenic
992087645 5:73292184-73292206 TTGGCTTCCCTGGGCCACCTTGG + Intergenic
992240448 5:74764571-74764593 TTGGTTTCCCTGGGCCACACTGG - Intronic
992435823 5:76755245-76755267 TTGGCTTCCCTGGGCCACACTGG + Intergenic
992464753 5:76992746-76992768 TTGGTTTCCCTGGGCCACAATGG + Intergenic
992569295 5:78038371-78038393 TTGGCTTCCCTGGGCCACATTGG + Intronic
992712482 5:79473398-79473420 TTGGCTTCCCTGGGCCATATTGG - Intronic
993106138 5:83603162-83603184 TTGGATTCCCTTGGCCACAATGG + Intergenic
993499704 5:88651530-88651552 TTGGCTTCCCTGGACCACATTGG + Intergenic
993548970 5:89249997-89250019 TTGGCTTCCCTAGGCCACATTGG + Intergenic
993816679 5:92557062-92557084 TTGGCTTCCCTGGGTCACATTGG + Intergenic
993996737 5:94732402-94732424 TTGGCTTCCCTGGGCCACACTGG - Intronic
994047518 5:95326584-95326606 TTGGCTTCCCTGGGCCACATTGG + Intergenic
994082520 5:95723097-95723119 AGGGCTTCCCTGGGCCACACTGG + Intronic
994281665 5:97911236-97911258 TTGGCTTCCTTGGGCCACATTGG + Intergenic
994529881 5:100956099-100956121 TTGGATTCCCTGAGCCACATTGG + Intergenic
994684258 5:102929947-102929969 TTGGCTTTCCTGGGCCACATTGG - Intronic
994761344 5:103858125-103858147 TTGGCTTCCCTGGGCTACATTGG - Intergenic
994858980 5:105163333-105163355 TGGGATTCCCTGGACAACATTGG - Intergenic
994996677 5:107072512-107072534 TTGGCTTCCCTGGGCCACACTGG + Intergenic
995191640 5:109324419-109324441 TTGGCTTCCCTGGGCAACATTGG - Intergenic
995227644 5:109720598-109720620 TTGGCTTCCCTGGGCCACATTGG + Intronic
995341161 5:111061406-111061428 TTGGCTTCCCTGGGCCACATTGG + Intergenic
995727802 5:115200901-115200923 TTGGCTTGCCAGGGCCACATTGG - Intergenic
995781613 5:115781930-115781952 CTGGCTTCCCTGGGCCACATTGG - Intergenic
995978753 5:118075780-118075802 TGCCATTCCAGGGGCCACATGGG + Intergenic
996076162 5:119197238-119197260 TTGGCTTCCCTGGGCCACACAGG + Intronic
996357415 5:122612206-122612228 TTGGCTTCCCTGGGCCACACTGG + Intergenic
996377256 5:122824318-122824340 TTGGCTTCCCTGGGCCACAATGG - Intronic
996650211 5:125866645-125866667 TTGGCTTCCTTGGGCCACATTGG - Intergenic
996698239 5:126422582-126422604 TTGGCTTCCCTGGGTCACATTGG - Intronic
996872509 5:128207071-128207093 TTGGTTTCCCTGGGCCACATTGG + Intergenic
997101451 5:130973717-130973739 GGGGTTTTCCTGGGCCACATAGG + Intergenic
997125383 5:131221377-131221399 TTGGCTTCCCTGGGCCACATTGG - Intergenic
997215240 5:132104462-132104484 TTGGTTTCCCTGGGCCACTTTGG + Intergenic
997606883 5:135181492-135181514 TTGGCCTCCCTGGGCCACATTGG - Intronic
997720987 5:136078301-136078323 TTGGCTTCCCTGGGCCACATTGG + Intergenic
997787559 5:136727563-136727585 TTGGCTTCCCTGGGTCACATTGG + Intergenic
997939931 5:138148075-138148097 TTGGCTTCCCTGGGCCACACTGG + Intronic
998003808 5:138644155-138644177 TTGGTTTCCCTGGGCTACATTGG - Intronic
998081217 5:139276351-139276373 TTGGCTTCCCTGGGCCACATTGG + Intronic
998101418 5:139438442-139438464 TTGGCTTCCCTGGACCACATTGG - Intronic
998786565 5:145716130-145716152 TTGGCTTCTCTGGGCCACATTGG - Intronic
998866100 5:146504701-146504723 TTGGCTTCCCTGGGCCACATTGG + Intronic
998949806 5:147381882-147381904 TTGGCTTCCCTGGGCCACGTTGG + Intronic
999053753 5:148551666-148551688 TTGGCTTCCCTGGTCCACATTGG + Intronic
999207554 5:149860723-149860745 TTGGCTTCCCTGGGCCACATTGG - Exonic
999225699 5:150022157-150022179 TTGGCTTCCCTGGGCCACATTGG - Intronic
999976267 5:156915074-156915096 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1000145980 5:158453754-158453776 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1000212965 5:159126038-159126060 TTGACTTCCCTGGGCCACATTGG + Intergenic
1000217306 5:159173317-159173339 TCGGCTTTCCTGGGCCACATTGG - Intronic
1000284309 5:159813656-159813678 TTGGCTTCCCTGGGCCACATCGG - Intergenic
1000320142 5:160128099-160128121 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1000351439 5:160355875-160355897 TTGGCTTCCCTGTGCCACATTGG - Intronic
1000383319 5:160648398-160648420 CTGGCTTCCCTGGGCCACATTGG - Intronic
1000395156 5:160767029-160767051 TTGGCTTCGCCGGGCCACAATGG + Intronic
1000423568 5:161064289-161064311 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1000569326 5:162892555-162892577 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1000594781 5:163202352-163202374 TTGGCTTCCCTGGGACACATTGG - Intergenic
1000599845 5:163259421-163259443 TTTGCTTCCCTGGGCCACATTGG - Intergenic
1002155287 5:177273230-177273252 TTGGCTTCCCTGGGCCACACTGG + Intronic
1002820620 6:721114-721136 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1003622018 6:7708771-7708793 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1004077980 6:12362768-12362790 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1004159212 6:13198537-13198559 TTGGCTTCCCTGGCCCACATTGG + Intronic
1004186496 6:13425789-13425811 TTGGCTTCCCTGGGCCACATTGG + Intronic
1004191189 6:13465152-13465174 TTGGCTTCCCTGGGCCACATTGG + Intronic
1004523340 6:16382743-16382765 TTGGCTTCCCTGGGCCACACTGG + Intronic
1004627397 6:17389887-17389909 TTGGTTTCCCTGGGCCACAGTGG - Intergenic
1004682021 6:17905210-17905232 TTGACTTCCCTGGGCCACATTGG - Intronic
1004731395 6:18362677-18362699 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1004922588 6:20390519-20390541 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1004928246 6:20436367-20436389 TTGGCTTCCCTGGGCCACGTTGG + Intronic
1004954819 6:20717749-20717771 TGAGTTTCCCTGGGCCACATAGG + Intronic
1005116213 6:22340415-22340437 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1005123091 6:22412843-22412865 TTGGCTACCCTGGGCCACATCGG - Intergenic
1005172910 6:23008788-23008810 TTGGCTTCCCTGGGTCACATTGG - Intergenic
1005356301 6:24986834-24986856 TTGGCTTCCCTGGGCCACACTGG + Intronic
1005416844 6:25608915-25608937 TTGGCTTCCCTGGGCCACAGTGG + Intronic
1005654042 6:27913904-27913926 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1005718993 6:28582328-28582350 TTGGCTTCCCTGGGCCATATTGG - Intronic
1005852529 6:29832496-29832518 TTGGCTTCCCTGGGTCACATAGG - Intergenic
1005856911 6:29869716-29869738 TGGGATTCCCGTGGCATCATAGG - Intergenic
1006619024 6:35349387-35349409 TTGGCATCCCTGGGCCACATTGG + Intronic
1006711746 6:36079418-36079440 CTGGCTTCCCTGGGCCACATTGG + Intronic
1006773103 6:36570210-36570232 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1007163862 6:39814267-39814289 TTGGCTTCCCTGGGCCACACTGG - Intronic
1007179889 6:39922479-39922501 TTGGCTTCCCTGGGCCACAGTGG - Intronic
1007479303 6:42139770-42139792 TTGGCTTCCCTGGGTCACATTGG - Intronic
1008023321 6:46604920-46604942 TTGGCTTCCCTGCGCCACATTGG + Intronic
1008060778 6:46994440-46994462 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1008390313 6:50943265-50943287 TTGGCTTACCTGGGCCACATTGG + Intergenic
1008394425 6:50990478-50990500 TTGACTTCCCTGGGCCACATTGG - Intergenic
1008423367 6:51328746-51328768 TTGGCTTCTCTGGGCCACATTGG + Intergenic
1008472878 6:51903496-51903518 TTGGCTTCCCTGGGCCACATTGG - Intronic
1008641453 6:53466747-53466769 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1008667339 6:53729109-53729131 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1008895400 6:56548102-56548124 TTGGCTTCCCTGGGCCACACTGG + Intronic
1009646885 6:66415520-66415542 TTGGCTTCCCTGAGCCACATTGG - Intergenic
1009658005 6:66570298-66570320 TTGGCTTCCCTTGGCCACATTGG + Intergenic
1009915457 6:69989629-69989651 TTGCCTTCCCTGGGCCACATTGG - Intronic
1009930416 6:70171226-70171248 TTGGCTTCCCTGGGCCACATTGG - Intronic
1009966458 6:70583599-70583621 TTGGCTTCCCTGGGTCACATTGG + Intronic
1010439785 6:75880390-75880412 TTGGCTTCCCTGAGCCACATTGG + Intronic
1010486630 6:76422211-76422233 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1010583344 6:77626846-77626868 TTGCCTTCCCTGGGCCACATTGG - Intergenic
1010746008 6:79562715-79562737 TTGGCTTCTCTGGGCCACATTGG + Intergenic
1010826442 6:80482525-80482547 TTGGCTTCCCTCGGCCACATTGG - Intergenic
1011045549 6:83077785-83077807 TTGGCCTCCCTGGGCCACATTGG + Intronic
1011103770 6:83756106-83756128 TTGGTTTCCCTGGGCCACATTGG + Intergenic
1011133333 6:84073965-84073987 TTGGCTTCCCTGGACCACATTGG - Intronic
1011646926 6:89468516-89468538 TTGGCTTCCCTGGGCCACATGGG + Intronic
1011651924 6:89514489-89514511 TTGGCTTCACTGGGCCACATTGG - Intronic
1011959974 6:93075983-93076005 TTGGCTTCCCTGGGCCACAATGG - Intergenic
1012937910 6:105387525-105387547 TTGGCTTCCCTGGGCCACACTGG + Intronic
1013157541 6:107507687-107507709 TGGGCTTCCCTGGGCCACATTGG - Intronic
1013280050 6:108627620-108627642 TTGGCTTCCCTGGGCCACACTGG + Intronic
1013347286 6:109273610-109273632 TTGGCTTCTCTGGGCCACATTGG + Intergenic
1013481426 6:110556136-110556158 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1013745210 6:113337158-113337180 TTGGATTCCCTGGGCCACATTGG + Intergenic
1013789598 6:113822015-113822037 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1014020958 6:116589271-116589293 TTGGCTTCCCTGAGCCACATTGG + Intronic
1014107996 6:117588965-117588987 TTGGCTTCCCTGGGCCACACTGG + Intronic
1014419644 6:121226968-121226990 TTGGCTTCCCTGGGCCACATTGG + Intronic
1014458369 6:121665264-121665286 TTGGCTTCCCTAGGCCACATTGG - Intergenic
1014676201 6:124369618-124369640 TTGGCTTCCCTGGGCCACACTGG - Intronic
1014739944 6:125137474-125137496 TTGGCTTCTCTGGGCCACATCGG + Intronic
1014749123 6:125235327-125235349 TGGGCTTCCCTGGGCCACACTGG + Intronic
1014927047 6:127284950-127284972 TTGGTTTCCCTGGGCCACACTGG - Intronic
1014937765 6:127404108-127404130 TTGGTTTCCCTGGGCCACACTGG - Intergenic
1015036524 6:128661944-128661966 TTGCCTTCCCTGGGCCACATTGG - Intergenic
1015041100 6:128719764-128719786 TTGGCTTCCCTGGGCCAAATTGG - Intergenic
1015502009 6:133944449-133944471 TTGGCTTTCCTGGGCCACATTGG + Intergenic
1015625617 6:135178703-135178725 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1015646077 6:135390095-135390117 TTGGCTTCCCAGGGCCACATTGG - Intronic
1015681638 6:135814981-135815003 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1015991974 6:138954419-138954441 TTGGCTTCCCTGGGCCACACTGG + Intronic
1016065255 6:139675923-139675945 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1016085731 6:139911851-139911873 TTGGCTTTCCTGGGCCACATTGG + Intergenic
1016267861 6:142253319-142253341 TTGGCTTCCCTGGTCCACATTGG + Intergenic
1016356760 6:143227071-143227093 TTGGCTTCTCTGGGCCACATTGG - Intronic
1016358735 6:143245930-143245952 TTGGCTTCCCTGGGCCACATTGG + Intronic
1016359315 6:143250894-143250916 TTGGCTTCCTTGGGCCACATTGG - Intronic
1016398835 6:143656345-143656367 TTGGCTTCCCTGGGCCACATTGG + Intronic
1016595944 6:145801491-145801513 TTGGCTTCCCTGGGCCACATTGG - Intronic
1016674054 6:146742955-146742977 TTGGCTTCCCTGGGCCACAGTGG - Intronic
1017109080 6:150915336-150915358 TTGGCTTCCCTGGGCCACACTGG - Intronic
1017145415 6:151230137-151230159 TGAGATTCCCGGGGCTACAGAGG + Intergenic
1017184589 6:151588218-151588240 TTGGCTTCCCTGGGCCACATTGG + Intronic
1017246358 6:152230857-152230879 TTGGCTTCCCTGGGCCACACTGG + Intronic
1017251102 6:152280509-152280531 TTGGCTTCCCTGGGCCACATTGG - Intronic
1017861049 6:158397630-158397652 TTGGTTTCCCTGGGCCACACTGG - Intronic
1017906395 6:158759961-158759983 TTGGCTTCCCTGGGCCACACTGG - Intronic
1017920972 6:158871564-158871586 TTGGCTTCCCTGGGCCACACTGG - Intronic
1017961645 6:159227733-159227755 TTGGCTTCCCTGGGCCACATTGG + Intronic
1018051012 6:160007986-160008008 TTGGCTTCCCTAGGCCACATTGG + Intronic
1018268206 6:162048637-162048659 TTGGCTTCCCTGGGCCACATAGG + Intronic
1018406267 6:163485851-163485873 TTGGCTTCCCTGGACCACATTGG + Intronic
1018503869 6:164443111-164443133 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1019029268 6:168996063-168996085 TTGGCTTCCCTGGGCCACAATGG + Intergenic
1019359843 7:599063-599085 TGGGCTTCTCCAGGCCTCATGGG - Intronic
1019667677 7:2259898-2259920 TTGGCTTCCCAGGGCCACATTGG + Intronic
1019873416 7:3788583-3788605 TTGGCTTCCCTGGGCCACGTTGG + Intronic
1020205585 7:6112809-6112831 TTGGCTTCCCTGGGCCACACTGG - Intronic
1020354644 7:7263352-7263374 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1020379084 7:7522722-7522744 TTGGCTTCCCTGGGCCACATTGG + Intronic
1020492719 7:8808630-8808652 TTGACTTCCCTGGGCCACATTGG - Intergenic
1020538804 7:9435316-9435338 TTGGCTTCCCTGAGCCACATTGG - Intergenic
1020816121 7:12908153-12908175 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1020832876 7:13113163-13113185 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1020966452 7:14875901-14875923 TTGGCTCCCCTGGGCCACATTGG - Intronic
1021468903 7:20979039-20979061 TTGGCTTCTCTGGGCCACATTGG + Intergenic
1021499238 7:21311394-21311416 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1021732378 7:23608556-23608578 TTGGCTTCCCTGGGCCACACTGG - Intronic
1022118766 7:27286556-27286578 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1022487628 7:30791807-30791829 TTGGCTTCCCTGGGCCACATTGG + Intronic
1023040921 7:36172701-36172723 TTGGCTTCCCTGGGCCACAATGG - Intronic
1023178096 7:37453189-37453211 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1023180549 7:37478348-37478370 TTGGCTTCCCTGAGCCACATTGG + Intergenic
1023204867 7:37737655-37737677 TTGGCTTCCCTGGGCCACACTGG - Intronic
1023377404 7:39571350-39571372 TTGGCTTTCCTGGGCCACATTGG - Intronic
1023388517 7:39684636-39684658 CTGGCTTCCCCGGGCCACATTGG + Intronic
1023919930 7:44620827-44620849 TTGGCTTCCCTGGGCCACATTGG - Intronic
1024682631 7:51708871-51708893 TCGGCTTCCCTGGGCCACCTTGG - Intergenic
1024725694 7:52191442-52191464 TTGGTTTCCCTGGGCCACATTGG - Intergenic
1024726101 7:52197142-52197164 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1024908127 7:54411456-54411478 TTGACTTCCCTGGGCCACATTGG + Intergenic
1025320622 7:58089508-58089530 TTGGCTTCTCAGGGCCACATTGG + Intergenic
1025478927 7:60958492-60958514 TTGGCTTCTCAGGGCCACATTGG + Intergenic
1025553126 7:62274204-62274226 TTGGCTTCTCAGGGCCACATTGG - Intergenic
1025562268 7:62382234-62382256 TTGGCTTCTCAGGGCCACATTGG + Intergenic
1026060931 7:67025290-67025312 TTGGCTTTCCTGGGCCACATTGG + Intronic
1026152390 7:67799278-67799300 TTGGCTTCCCTGTGCCACATTGG - Intergenic
1026511325 7:71029524-71029546 TTGGCTTCCCTGGGCCGCATTGG + Intergenic
1027356141 7:77357547-77357569 TTGGGTTCCCTGGGCCACACTGG + Intronic
1027529341 7:79311258-79311280 TTGGCTTCCCTGGGCCACCTTGG + Intronic
1027611237 7:80363598-80363620 TTGGTTTCCCTGGGCCACATTGG - Intergenic
1027775532 7:82459970-82459992 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1027985142 7:85277958-85277980 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1028254582 7:88578205-88578227 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1028386525 7:90260158-90260180 TTGGATTCCCTGGCCCACACTGG - Intronic
1028935771 7:96462537-96462559 TTGGCTTCCCTGGGCCACACCGG + Intergenic
1029223095 7:99005755-99005777 TTGGCTTCCCTGGGCCACATTGG - Intronic
1029287242 7:99474183-99474205 TTGGCTTCCCTGGGCCACATTGG + Intronic
1029311518 7:99671196-99671218 TTGGCTTCCCTGGGCCACAGTGG - Intronic
1029548747 7:101225210-101225232 TTGGCTTCTCTGGGCCACATTGG - Intergenic
1029614718 7:101649153-101649175 TTGGCTTCCCTGGGCCACATCGG - Intergenic
1029615135 7:101651538-101651560 TTGGCTTCCCCGGGCCACACTGG + Intergenic
1030017189 7:105235079-105235101 TTGGCTTCTCTGGGCCACATTGG - Intronic
1030199383 7:106886919-106886941 TTGGCTTCCCTGGGCCACATTGG + Intronic
1030308005 7:108038740-108038762 TTGGCTTCCCTGGGCCACACTGG - Intronic
1030661532 7:112224212-112224234 TTGGCTTCCCTGGGCCACATTGG + Intronic
1030756030 7:113289073-113289095 TTGGCTTCCCTGGGCCCCATTGG + Intergenic
1030836053 7:114287164-114287186 TTGGCTTCCCTGGGCCACATTGG + Intronic
1030982069 7:116197940-116197962 TTGGCTTCCCTGGGCCACTTAGG - Intergenic
1031110138 7:117597419-117597441 GTGGTTTCCCTGGGCCACATTGG + Intronic
1031281094 7:119800266-119800288 TTGGTTTCCCTGGGCCACATTGG + Intergenic
1031519522 7:122746533-122746555 TTGGCTTCCCTGGGCCATATTGG + Intronic
1031603233 7:123738792-123738814 TTGGTTTCCCTGGGCCACATTGG + Intronic
1031686765 7:124739844-124739866 TTAGCTTCCCTGGGCCACATTGG + Intergenic
1031758136 7:125673508-125673530 TTGGCTTCTCTGGGCCACATTGG - Intergenic
1031840547 7:126733083-126733105 TTGGCTTCCCTGGGCCACATTGG - Intronic
1032301157 7:130688543-130688565 TTGGCTTCCCTGGGCCACGTTGG + Intergenic
1032317279 7:130850321-130850343 CTGGCTTCCCTGGGCCACATTGG + Intergenic
1032343427 7:131097316-131097338 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1032376005 7:131418421-131418443 TTGGCTTCCCTGGGCCACATTGG + Intronic
1032761737 7:134949825-134949847 TTGGCTTCCCTGGGTCACATTGG + Intronic
1032990915 7:137394369-137394391 TTGGCTTCCCTGGGCCACATTGG - Intronic
1033038742 7:137899294-137899316 AGGCCTTCCCTGGGCCACATGGG - Intronic
1033678931 7:143573497-143573519 GGGGATTCCCTGGGCCTCTTGGG - Exonic
1033692907 7:143755957-143755979 GGGGATTCCCTGGGCCTCTTGGG + Exonic
1034089290 7:148349300-148349322 TCGGCTTTCCTGGGCCACATTGG + Intronic
1034125338 7:148666623-148666645 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1034182484 7:149148944-149148966 TTGGCTTCCCTGGGCCACACTGG - Intronic
1035061770 7:156074757-156074779 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1035490705 7:159274613-159274635 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1035965025 8:4181414-4181436 TTGGCTTCCCTGGGCAACATTGG + Intronic
1036377936 8:8216739-8216761 TGGGATGCCCCTGCCCAAATTGG + Intergenic
1036413108 8:8520643-8520665 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1036475920 8:9093165-9093187 TTGACTTCCCTGGGCCACATTGG + Intronic
1036957589 8:13205526-13205548 TTGGTTTCCCTGGGCCACATTGG + Intronic
1036975997 8:13413341-13413363 TTGGCTTCCCCGGGCCACATTGG - Intronic
1037060130 8:14497667-14497689 TTGGCTTCCCTGGGCCACATTGG - Intronic
1037256605 8:16962345-16962367 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1037323722 8:17668292-17668314 TTGGCTTCCCCGGGCCACGTTGG - Intronic
1037329062 8:17725850-17725872 TTGGCTTCCCTGGGCCACATTGG - Intronic
1037395874 8:18442163-18442185 TTGGCTTCCCTGGGCCACAGAGG + Intergenic
1037441741 8:18923112-18923134 TTGGCTTCCCTGGGCCACACTGG + Intronic
1037824780 8:22154758-22154780 GGGGAATCCCTGGGCCACCTGGG + Intronic
1037852600 8:22344665-22344687 TGAGACTGCCTGGGCCACATAGG + Intronic
1038187663 8:25290237-25290259 TTGGCTTCCCTAGGCCACATTGG + Intronic
1038249288 8:25888028-25888050 TTGGCTTCCCAGGCCCACATTGG + Intronic
1038420648 8:27432061-27432083 TTGGCTTCCCTGGGCCACATTGG - Intronic
1038651540 8:29408102-29408124 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1038965124 8:32563200-32563222 TTGGCTTCCCTGGGCCACATTGG - Intronic
1039235197 8:35495368-35495390 TTAGCTTCCCTGGGCCACATTGG + Intronic
1039318333 8:36398352-36398374 TTGACTTCCCTGGGCCACATTGG + Intergenic
1039376852 8:37043368-37043390 TGTGATGCCCCGTGCCACCTTGG + Intergenic
1039819720 8:41125004-41125026 TCGGCTTCCCTGGGCCACATTGG - Intergenic
1039899484 8:41741031-41741053 TGGGACTCCCAGGTCCCCATGGG - Intronic
1040030897 8:42822768-42822790 TTGGCTTCCCTGGGGCACATTGG + Intergenic
1040385203 8:46910545-46910567 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1040419670 8:47227057-47227079 TTGGCTTCCCTGGACCACATTGG + Intergenic
1040622558 8:49106156-49106178 TTGGCTTCCCTGTGCCACATTGG - Intergenic
1040650835 8:49447340-49447362 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1040698652 8:50034635-50034657 TTGGCTTCCCTGGGCCACACTGG + Intronic
1040848931 8:51878325-51878347 TTGGCTTCCCCAGGCCACATTGG - Intronic
1041064130 8:54064757-54064779 TTGGTTTCCCTGGGCTACATTGG + Intronic
1041129774 8:54685738-54685760 TTGGCTTCCCCAGGCCACATTGG - Intergenic
1041184835 8:55288119-55288141 TTGGCTTCCCTGGGCCACATTGG - Intronic
1041188645 8:55329460-55329482 TTGGCTTCCCTGGGCCACATTGG - Intronic
1041586644 8:59528493-59528515 TTGGCTTCCCTGGACCACATTGG + Intergenic
1041644715 8:60239408-60239430 TTGGCTTCCCTGGGCCACACTGG + Intronic
1041896445 8:62929919-62929941 TTGGCTTCCCTGGGACACATTGG - Intronic
1042193686 8:66213510-66213532 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1042211183 8:66382003-66382025 TTGGTTTCCCTGGGCCACATCGG - Intergenic
1042294582 8:67205389-67205411 TTGGCTTCCCTGAGCCACATTGG - Intronic
1042366345 8:67941082-67941104 TTGGCTTCCCTGGGCCACAATGG - Intergenic
1042647772 8:71006403-71006425 TGGGCTTCCCTGGACCACATTGG - Intergenic
1042718665 8:71803560-71803582 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1042828397 8:73001165-73001187 TTTGCTTCCCTGGGCCACATTGG + Intergenic
1042880121 8:73478219-73478241 TTGGCTTCCCTGGGCCACATTGG + Intronic
1042927715 8:73983521-73983543 TTGGCTTCCCTGGGCCACGTTGG - Intergenic
1043447576 8:80334265-80334287 TTGGCTTTCCTGGGCCACATTGG - Intergenic
1043499690 8:80840404-80840426 TTGGCTTCCCTGGGCCACATTGG - Intronic
1043575272 8:81649449-81649471 TTGGCTTCCCTGAGCCACATTGG - Intergenic
1043576167 8:81660036-81660058 TTGGCTTCCCTGGGCCACACTGG + Intronic
1044197520 8:89395622-89395644 TTGGCTTCCCTGGGTCACATTGG - Intergenic
1044346341 8:91108809-91108831 TTGGCTTCCCTGGGCCACATTGG - Intronic
1044367400 8:91365230-91365252 TTGGCTTCCCTGGGCCACACTGG + Intronic
1044461386 8:92448678-92448700 TTGGCTTCCCTGGGCCACGTTGG + Intergenic
1044532143 8:93319440-93319462 TCGGCTTCCCTGGGCCACATTGG + Intergenic
1044720802 8:95144112-95144134 TTGGCTTCCCTGGGTCACATTGG - Intronic
1044879384 8:96707540-96707562 TCGGCTTCCCTGGGCCACACTGG - Intronic
1045247169 8:100453181-100453203 TTGGCTTCCCTGAGCCACATTGG + Intergenic
1045259635 8:100560779-100560801 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1045584563 8:103518283-103518305 TTGGCTTCCCTGGGCCACAATGG + Intronic
1045596485 8:103662011-103662033 TTGGCTTCCCTGGGCTACATTGG + Intronic
1046094968 8:109546704-109546726 TTGGCTTCCCTGGGCCACACTGG - Intronic
1046476392 8:114750050-114750072 TTGGCTTCCCGGGGCCACACTGG + Intergenic
1046764575 8:118055990-118056012 TTGGCTTCCCTGGGCCACACTGG + Intronic
1046924788 8:119774567-119774589 TTGGCTTCCCTGGTCCACATTGG - Intronic
1047279638 8:123434000-123434022 TTGGCTTCCCTGGGCCACACTGG - Intronic
1047305585 8:123650226-123650248 TTGGCTTCCCTGGGCCACATTGG + Intronic
1047377668 8:124317914-124317936 TTGGCTTCCCTGGGCCACATTGG + Intronic
1047408107 8:124602074-124602096 TTGGCTTCCCTGGGCCACAGTGG + Intronic
1047544118 8:125798435-125798457 TTGGTTTCCCTGGGCCACTTTGG - Intergenic
1047628402 8:126679725-126679747 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1047768034 8:128005331-128005353 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1047848839 8:128834250-128834272 TTGGATACCCTGGGCCACATTGG - Intergenic
1048397037 8:134023635-134023657 TGGGATTTTCCCGGGCACATTGG + Intergenic
1048483829 8:134829329-134829351 TTGGCCTCCCCGGGCCACGTTGG - Intergenic
1048843487 8:138584929-138584951 TGGGATACCTGGGCCCACATGGG - Intergenic
1049161334 8:141099794-141099816 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1049985518 9:947337-947359 TTGGCTTCCCTGGGCCACATTGG - Intronic
1050044049 9:1525190-1525212 TTGGCTTCCCTGGGCCACATCGG + Intergenic
1050455406 9:5830261-5830283 TTGGCTGCCCTGGGCCACATTGG - Intronic
1050523531 9:6526396-6526418 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1050713789 9:8496910-8496932 TTGGCTTCTCTGGGCCACATTGG - Intronic
1050749479 9:8920502-8920524 TTGGCTTCCCTGGGCCACACTGG + Intronic
1050780473 9:9327822-9327844 TTGGCTTCCCTGGGCCACGTTGG + Intronic
1050860313 9:10420986-10421008 TTGGCTTCCCTGGGCCACATTGG + Intronic
1050928847 9:11299768-11299790 TTTGCTTCCCTGGGCCACATTGG + Intergenic
1050938011 9:11423633-11423655 TGGGATTTCCTGGGCCACATTGG + Intergenic
1050976071 9:11940208-11940230 TTGACTTCCCTGGGCCACATTGG + Intergenic
1051390622 9:16559351-16559373 TTGGCTTCCCTGGGCCACAATGG - Intronic
1051446255 9:17142327-17142349 TTGGCTTCCCTGGGCCACAGTGG - Intronic
1051663140 9:19444078-19444100 TTGGTTTCCCTGGGCCATATTGG + Intronic
1052035053 9:23670965-23670987 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1052370647 9:27660537-27660559 TTGGCTTCCCTGGGCCACATGGG - Intergenic
1052823084 9:33154905-33154927 TTGGCTTCCCCAGGCCACACTGG - Intronic
1053189425 9:36049433-36049455 TTGGCTTCCCTGGGCCACACTGG + Intronic
1053234270 9:36438492-36438514 TTGGCTTCCCTGGGCCACATTGG - Intronic
1053324660 9:37132763-37132785 TTGGCTTCCATGGGCCACATTGG + Intronic
1053918329 9:42962480-42962502 TTGGCTTCCCTGGACCACATTGG + Intergenic
1054720139 9:68595730-68595752 TTGGCTTCGCTGGGCCACATCGG + Intergenic
1054883595 9:70171750-70171772 TTGGCTTCTCTGGGCCACATTGG + Intronic
1055130723 9:72771115-72771137 TGGGTTTCCCTGGGCCACACAGG - Intronic
1055144985 9:72922523-72922545 TTGGCTTCCCTGGGCTACATGGG + Intronic
1055313348 9:75008094-75008116 TTGGCTTCCCTGGGCCACACTGG + Intronic
1055451918 9:76438719-76438741 TTGGCTTCCCTGGGCCACATTGG + Intronic
1055561659 9:77527562-77527584 TTGGCTTTCCTGGGCCACATTGG - Intronic
1055677890 9:78683905-78683927 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1055761626 9:79614884-79614906 TTGGCTTCCCTGGGCCACACTGG - Intronic
1056125777 9:83535695-83535717 CTGGCTTCCCTGGGCCACATTGG - Intronic
1056136317 9:83632476-83632498 TTGGCTTCCCTGGGCCACACTGG + Intronic
1056177816 9:84052422-84052444 TGGGATGCCCTGTGCCACCTTGG + Intergenic
1056181144 9:84083536-84083558 TGCGATTCCCAGGGCAACCTTGG + Intergenic
1056729602 9:89154280-89154302 TTGGCTTCCCTGGGCCACATTGG - Intronic
1056784127 9:89576597-89576619 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1056830814 9:89915819-89915841 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1057031906 9:91782501-91782523 TTGGCTTCCCTGGGCCACACTGG + Intronic
1057108112 9:92440260-92440282 TTGGCTTCCCTGGGCCACATTGG + Intronic
1057426494 9:94954374-94954396 TTGGCTTCCCTGGGCCACATTGG + Intronic
1057474473 9:95386974-95386996 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1057628345 9:96699121-96699143 TTGGATTCCCTGGGCCACATTGG - Intergenic
1057741204 9:97712890-97712912 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1058033337 9:100223957-100223979 TTGGCTTCCCTGGGCCACACTGG + Intronic
1058050989 9:100406252-100406274 TTGGTTTCCCTGGGCCACATTGG + Intergenic
1058065423 9:100543617-100543639 TTGACTTCCCTGGGCCACATTGG + Intronic
1058072450 9:100615341-100615363 TTGGCTTCCCCAGGCCACATTGG + Intergenic
1058200920 9:102039387-102039409 TTGGCTTCCCTGAGCCACATTGG + Intergenic
1058524555 9:105844005-105844027 TTGGCTTCCCTGGCCCACATTGG + Intergenic
1058726990 9:107813804-107813826 TTGGCTTCTCTGGGCCACATTGG + Intergenic
1058731032 9:107850121-107850143 TTGGCTTCCCTGGACCACATTGG + Intergenic
1058797599 9:108513588-108513610 TTGGCTTCCTTGGGCCACATTGG - Intergenic
1059347707 9:113641430-113641452 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1059521375 9:114945424-114945446 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1059892079 9:118814832-118814854 TTGGCTTCCCTGGTCCACATTGG + Intergenic
1059975028 9:119707024-119707046 TTGGCTTCCCTGGACCACATTGG - Intergenic
1060200602 9:121650093-121650115 TTGGCTTCCCTGGGCCACACTGG - Intronic
1060482231 9:124023227-124023249 TTGGCTTCCCTGGGCCACATTGG + Intronic
1060571654 9:124646576-124646598 TAAGCTTCCCTGGGCCACATTGG + Intronic
1060625946 9:125111638-125111660 TTGGCTTCCCTGGGCCACACTGG - Intronic
1061349993 9:130056507-130056529 TTGGCTTCCCAGGGCCACATTGG + Intronic
1061358050 9:130121249-130121271 TTGGCTTCCCTGGGCCACACTGG + Intronic
1061443621 9:130624715-130624737 TTGGCTTCCCTGGGCCACACTGG - Intronic
1061472821 9:130841041-130841063 TTGGCTTCCCTGGGCCACATTGG + Intronic
1061568207 9:131458381-131458403 TTGGCTTCCCTGGGCCACACTGG + Intronic
1062482482 9:136759061-136759083 TGGCAGTCCCCTGGCCACAACGG + Intergenic
1203571211 Un_KI270744v1:133320-133342 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1185554830 X:1013018-1013040 TGGGGGTCCCCGGGTCACCTTGG - Intergenic
1185804738 X:3046881-3046903 TTGGCTTCCCTGGGCCACACTGG + Intronic
1185955242 X:4482172-4482194 TTGGCTTCCCTGGGCCACGTTGG + Intergenic
1185987767 X:4855148-4855170 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1186186848 X:7029208-7029230 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1186344176 X:8674511-8674533 TTGGCTTTCCCGGGCCACACTGG + Intronic
1186844996 X:13522006-13522028 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1187013476 X:15303261-15303283 TTGGTTTCCCTGGGCCGCATTGG + Intronic
1187027041 X:15446386-15446408 ATGGATTCCCTGGGCCACACTGG + Intronic
1187143185 X:16614019-16614041 TTGGCTTCCCTGGGCCACACTGG + Intronic
1187274836 X:17808158-17808180 TTGGCTTCCCTGGGCCACATTGG - Intronic
1187345751 X:18462159-18462181 TTGGCTTCCCTGGGCCACATTGG - Intronic
1187413557 X:19072243-19072265 TTGGCTTCTCTGGGCCACATTGG - Intronic
1187457240 X:19452916-19452938 TTGGCTTCCCTGGGCCACATTGG - Intronic
1188258937 X:27999600-27999622 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1188478078 X:30608065-30608087 TCGGCTTCCCTGGGCCACATTGG + Intergenic
1188538266 X:31220982-31221004 TTGGCTTCTCCGGGCCACAGTGG - Intronic
1188585479 X:31769521-31769543 TTGGCTTCCCTGGGCCACACTGG + Intronic
1188649370 X:32612520-32612542 TTGGCTTCCCTGGGCGACATTGG - Intronic
1188716885 X:33469561-33469583 TTGGCTTCCCTGAGCCACATTGG - Intergenic
1188745704 X:33839931-33839953 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1189075445 X:37909555-37909577 TTGGATTACCTGGGCCACACTGG - Intronic
1189113074 X:38313978-38314000 TTGGCTTCCCTGGGCCACACTGG + Intronic
1189123994 X:38426088-38426110 TTGGCTTCTCTGGGCCACATTGG + Intronic
1189151045 X:38707037-38707059 TTGGCTTCCCTGGGCAACATTGG + Intergenic
1189156892 X:38767094-38767116 TTGGCTTCCCTTGGCCACATTGG - Intergenic
1189427497 X:40914276-40914298 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1189577019 X:42364885-42364907 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1189720905 X:43916374-43916396 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1190060381 X:47207301-47207323 TTGGCTTCCCTGGGCCACATTGG + Intronic
1190077409 X:47327880-47327902 AGGGTTTCTCTGGGCCACATTGG + Intergenic
1190120563 X:47656026-47656048 TTGGTTTCCGTGGGCCACATTGG - Intronic
1190149588 X:47933023-47933045 TTGGCTTCCCTGGGCCACATTGG + Intronic
1190251665 X:48731594-48731616 CAGGCTTCCCTGGGCCACATTGG - Intergenic
1190393308 X:49954417-49954439 TTGGCTTCCCTGGGCCACACTGG - Intronic
1190477328 X:50841040-50841062 TTGGCTTCCCTGAGCCACATTGG - Intergenic
1190823546 X:53996491-53996513 TTGGCTTCCCTGGGCCACCTTGG - Intronic
1191891651 X:65949710-65949732 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1192245721 X:69370056-69370078 TTGGCTTCCCTGGACCACATTGG - Intergenic
1192314252 X:70039676-70039698 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1192473199 X:71417245-71417267 TGGGATTCTCTGAGCCACCTCGG + Intronic
1192482102 X:71494537-71494559 TTGGCTTCCCTGGGCCACACTGG - Intronic
1192743166 X:73913020-73913042 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1193121194 X:77824351-77824373 CTGGCTTCCCTGGGCCACATTGG + Intergenic
1194386581 X:93263045-93263067 TTGGCTTCCCAGCGCCACATTGG - Intergenic
1194843204 X:98770720-98770742 TTGGCTGCCCTGGGCCACATTGG + Intergenic
1195544812 X:106102342-106102364 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1195777925 X:108428085-108428107 TTGGCTTTCCTGGGCCACATTGG + Intronic
1195939240 X:110153845-110153867 TTGGCTTCCCTGGGCCACATGGG - Intronic
1196105449 X:111890397-111890419 TTGGCTTCCCAGGGCCACACTGG - Intronic
1196137858 X:112229574-112229596 TTGCCTTCCCTGGGCCACATTGG + Intergenic
1196158218 X:112454142-112454164 TTGGCTTCCATGGGCCACATTGG + Intergenic
1196436786 X:115681849-115681871 TTGGATTCCCTGGGCCACATTGG + Intergenic
1196753428 X:119137752-119137774 TTGGCTTCCCTGGGCCACATTGG - Intronic
1196766129 X:119245484-119245506 TTCGCTTCCCTGGGCCACATTGG - Intergenic
1196895045 X:120327701-120327723 TTGGCTTCCCTGGTCCACATTGG - Intergenic
1197128966 X:122981698-122981720 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1197179586 X:123520037-123520059 TTGGCTTCCCTGAGCCACATTGG + Intergenic
1197517138 X:127446992-127447014 TTAGCTTCCCTGGGCCACATTGG - Intergenic
1197655493 X:129112160-129112182 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1197739404 X:129877811-129877833 TTGGCTTCCCTGGGCCACCTTGG - Intergenic
1197780873 X:130158619-130158641 TTGGCTTCCCCGAGCCACATGGG + Intronic
1197869789 X:131053979-131054001 TTGGCTTCCCTGGGCCACTTTGG + Intergenic
1198024300 X:132689962-132689984 TTGGTTTCCCTGGGTCACATTGG - Intronic
1198077378 X:133206671-133206693 TTGGCTTCCCTGGGTCACATTGG - Intergenic
1198082128 X:133250241-133250263 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1198125412 X:133638739-133638761 TTGGCTTCCCTGGGCCACACTGG + Intronic
1198131875 X:133703888-133703910 TTGGCTTCCCTGGGCCACATTGG + Intronic
1198256433 X:134927808-134927830 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1198403059 X:136286273-136286295 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1198646788 X:138816838-138816860 TTGGCTTCCCTGGGCCATATTGG - Intronic
1198688011 X:139248482-139248504 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1199022975 X:142904248-142904270 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1199825031 X:151490275-151490297 TTGGCTTCCCTGGGCCACTTTGG + Intergenic
1201276478 Y:12303468-12303490 TTGGCTTCCCTGGGCCACATTGG - Intergenic
1202582213 Y:26393709-26393731 TTGGCTTCCCTGGGCCACATTGG + Intergenic
1202604578 Y:26627677-26627699 TTGGTTTCCCTGGGCCACAATGG + Intergenic