ID: 918479174

View in Genome Browser
Species Human (GRCh38)
Location 1:184959138-184959160
Sequence CAGGATCAGTTCAGAAATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 592
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 561}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918479174_918479176 -10 Left 918479174 1:184959138-184959160 CCCTCATTTCTGAACTGATCCTG 0: 1
1: 0
2: 0
3: 30
4: 561
Right 918479176 1:184959151-184959173 ACTGATCCTGCTCAGCTGTCTGG 0: 1
1: 0
2: 2
3: 9
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918479174 Original CRISPR CAGGATCAGTTCAGAAATGA GGG (reversed) Intronic
900758907 1:4457240-4457262 CTGGACCAGCTCAGGAATGAAGG - Intergenic
904992194 1:34602045-34602067 GATGATAAGTCCAGAAATGATGG + Intergenic
905051698 1:35057127-35057149 AAAGATCAGAGCAGAAATGAAGG - Intergenic
905051756 1:35057903-35057925 TAAGATCAGAGCAGAAATGAAGG - Intergenic
906763243 1:48399767-48399789 CAGGATCAGCACAGATAGGAAGG - Intronic
907058939 1:51401233-51401255 CATCACCAGTTCAGAAATAAAGG + Intronic
907060107 1:51413634-51413656 CTGAATCAGTTTAGAAATGTAGG - Intronic
907384075 1:54114466-54114488 AATGATCAGTACAGTAATGATGG - Intergenic
908150479 1:61296089-61296111 CCAGATCAGTTCAGAATAGAGGG - Intronic
908283548 1:62568735-62568757 CAAGATCAGAGCAGAAGTGAAGG + Intronic
909220979 1:72961371-72961393 TAAGATCAGAACAGAAATGAAGG - Intergenic
909453189 1:75821549-75821571 TAAGATCAGAGCAGAAATGAAGG + Intronic
909993670 1:82253051-82253073 CAAGATCAGAGCAGAACTGAAGG + Intergenic
910620300 1:89246294-89246316 TAAGATCAGAGCAGAAATGAAGG + Intergenic
910744073 1:90554246-90554268 TAAGATCAGAGCAGAAATGAAGG + Intergenic
910805438 1:91185664-91185686 TAAGATCAGTGCAGAACTGAAGG - Intergenic
910886769 1:91971828-91971850 CAAGATCCGTTCACAAATGAAGG - Intronic
911632955 1:100203091-100203113 CAAGATCAGAGCAGAACTGAAGG + Intronic
911758566 1:101589415-101589437 CAGGATCCTTTCTGGAATGAGGG - Intergenic
912235638 1:107847416-107847438 TAAGATCAGAGCAGAAATGAAGG + Intronic
912460600 1:109828443-109828465 CAGGATTAGGTAAGAAAAGAGGG + Intergenic
913720089 1:121584156-121584178 CAAGATCAGAGCAGAACTGAAGG - Intergenic
916252562 1:162753298-162753320 CAGGAACTGTTGAGAAATGAAGG + Intronic
916531535 1:165661037-165661059 CAGGACCCCTTCTGAAATGAAGG + Intronic
916593254 1:166214222-166214244 CAAGATCAGAGCAGAACTGAAGG - Intergenic
916603149 1:166313881-166313903 CAAGATCAGAGCAGAACTGAAGG - Intergenic
916612528 1:166406931-166406953 TAGGATCAGAGCAGAACTGAAGG - Intergenic
916836164 1:168547663-168547685 CAAGATCAGGGCAGAACTGAAGG + Intergenic
916848741 1:168681240-168681262 TAAGATCAGAGCAGAAATGAAGG - Intergenic
916916386 1:169411034-169411056 TAAGATCAGAGCAGAAATGAAGG + Intronic
916973753 1:170051988-170052010 TAAGATCAGAGCAGAAATGAAGG + Intronic
917162815 1:172077314-172077336 TAAGATCAGATCAGAACTGAAGG - Intronic
917358022 1:174146396-174146418 TAAGATCAGAGCAGAAATGAAGG + Intergenic
917391537 1:174542591-174542613 TAAGATCAGAGCAGAAATGAAGG - Intronic
917398567 1:174620778-174620800 TAAGATCAGAGCAGAAATGAAGG + Intronic
917414670 1:174796532-174796554 AAGGACCAGGGCAGAAATGATGG + Intronic
917579342 1:176359010-176359032 TAAGATCAGAGCAGAAATGAAGG + Intergenic
917768291 1:178247566-178247588 TAAGATCAGTGCAGAACTGAAGG - Intronic
918117866 1:181511950-181511972 AATGATCAGTTCAGAAAATATGG - Intronic
918479174 1:184959138-184959160 CAGGATCAGTTCAGAAATGAGGG - Intronic
918504154 1:185233298-185233320 TAAGATCAGAGCAGAAATGAAGG - Intronic
918665061 1:187140847-187140869 CAAGATCAGAGCAGAACTGAAGG + Intergenic
918865992 1:189900750-189900772 CAGGATAAGTCCAAAAATGATGG - Intergenic
919060333 1:192623837-192623859 TAAGATCAGAGCAGAAATGAAGG - Intergenic
919063650 1:192665954-192665976 CAAGATCAGAGCAGAACTGAAGG - Intergenic
919146489 1:193642418-193642440 TAAGATCAGAGCAGAAATGAAGG - Intergenic
921942843 1:220861105-220861127 TAAGATCAGAGCAGAAATGAAGG - Intergenic
922226962 1:223653829-223653851 TATGATAAGTTCAGAAATGAAGG + Intronic
923714398 1:236412515-236412537 CGGGATTAGATGAGAAATGACGG - Intronic
1062810715 10:462173-462195 TAAGATCAGAGCAGAAATGAAGG + Intronic
1063018273 10:2100274-2100296 CAACATCATTTCAGGAATGAAGG - Intergenic
1063257209 10:4341227-4341249 CAGGATAAGTTCTGAAAAGTGGG - Intergenic
1063675084 10:8133915-8133937 CATGATCACATCAGAAGTGATGG - Intergenic
1064379246 10:14825668-14825690 CAGTATCATTCCAGTAATGAAGG + Intronic
1064914273 10:20439189-20439211 TAAGATCAGAGCAGAAATGAAGG - Intergenic
1065265613 10:23971998-23972020 TTGGTTCAGTTCAGAAATGTGGG - Intronic
1067193630 10:44094056-44094078 TAAGATCAGAGCAGAAATGAAGG + Intergenic
1067923542 10:50484036-50484058 CAAGATCAGAGCAGAACTGAAGG + Intronic
1067996460 10:51278952-51278974 TAAGATCAGAGCAGAAATGAAGG - Intronic
1068015086 10:51505969-51505991 CAAGATCAGAGCAGAACTGAAGG - Intronic
1068015706 10:51513990-51514012 CAAGATCAGAGCAGAACTGAAGG + Intronic
1068189402 10:53630859-53630881 GAGAATCAGTTCAGAATTGGGGG - Intergenic
1068410048 10:56643170-56643192 TACGATCAGATCAGAACTGAAGG + Intergenic
1068810509 10:61250525-61250547 CAGGCTCGATTCAGAAAGGAAGG + Intergenic
1069122553 10:64585344-64585366 CAAGATCAGTGTAGAACTGAAGG + Intergenic
1069967249 10:72130532-72130554 CAGGAAGAGTTCAGATATGTAGG - Intronic
1070632821 10:78099798-78099820 CAAGATCAGAGCAGAACTGAAGG + Intergenic
1070853840 10:79589599-79589621 TAAGATCAGAGCAGAAATGAAGG + Intergenic
1071028048 10:81139419-81139441 CAAGATCAGAGCAGAACTGAAGG + Intergenic
1074022574 10:109598990-109599012 CAAGATCAGAGCAGAACTGAAGG + Intergenic
1078392595 11:10949264-10949286 TAAGATCAGAGCAGAAATGAAGG - Intergenic
1078501942 11:11888207-11888229 CAAAATCAGCACAGAAATGAAGG + Intronic
1079316831 11:19415089-19415111 TAAGATCAGAGCAGAAATGAAGG + Intronic
1081171634 11:39876734-39876756 TAAGATCAGAGCAGAAATGAAGG + Intergenic
1081340866 11:41925995-41926017 GACTATCAGTTCAGAACTGAAGG + Intergenic
1081390449 11:42523015-42523037 CAGGATCCCTTCTGGAATGATGG - Intergenic
1081405323 11:42691145-42691167 TAAGATCAGAGCAGAAATGAAGG + Intergenic
1082618835 11:55396261-55396283 TAAGATCAGTGCAGAACTGAAGG - Intergenic
1083345524 11:61988129-61988151 CAAGATCAGAGCAGAACTGAAGG + Intergenic
1083726219 11:64630030-64630052 AAGGTTGAGTTCAGAAATGAGGG - Intronic
1084805040 11:71572836-71572858 CAGGAAAGGTTGAGAAATGAGGG + Intergenic
1086044763 11:82519770-82519792 TAAGATCAATGCAGAAATGAAGG - Intergenic
1086046247 11:82535374-82535396 CAGAACCAGTTCAGATCTGATGG - Intergenic
1086349162 11:85927746-85927768 TAAGATCAGAGCAGAAATGAAGG + Intergenic
1086522675 11:87688420-87688442 CAAGATCAGAGCAGAACTGAAGG + Intergenic
1086645268 11:89212086-89212108 TAAGATCAGAGCAGAAATGAAGG + Intronic
1086732533 11:90268065-90268087 TAGGATCAGAGCAGAACTGAAGG - Intergenic
1086906853 11:92428378-92428400 CAAGATCAGAGCAGAACTGAAGG - Intronic
1087050180 11:93878948-93878970 TAGGTTCAGTCCAGAAAAGATGG + Intergenic
1087653753 11:100898840-100898862 TAAGATCAGAGCAGAAATGAAGG - Intronic
1087740092 11:101877538-101877560 CAAGATCAGAGCAGAACTGAAGG - Intergenic
1087878651 11:103389495-103389517 TAAGATCAGAGCAGAAATGAAGG - Intronic
1087888073 11:103503617-103503639 TAAGATCAGATCAGAAATTAAGG + Intergenic
1088380781 11:109190374-109190396 TAAGATCAGATCAGAACTGAAGG - Intergenic
1088703114 11:112432162-112432184 TAAGATCAGGGCAGAAATGAAGG - Intergenic
1089745228 11:120612059-120612081 CAGGAGCGGTACAGAAAAGATGG - Intronic
1089996598 11:122913717-122913739 CAGGAGATGTTCAGGAATGAGGG - Intronic
1092314160 12:7392568-7392590 CAAGATCAGAGCAGAACTGAAGG + Intronic
1092688816 12:11084077-11084099 CAGGATCAGTTTAGATAGCACGG + Intronic
1092983598 12:13822524-13822546 GAGGAACAGTTAAGAAATGAAGG + Intronic
1093156348 12:15690767-15690789 AAGGAACAGTTAAGAATTGAGGG - Intronic
1093163637 12:15779860-15779882 CAGGTTCTGTTCAGAAACTATGG + Intronic
1093413369 12:18893224-18893246 TAAGATCAGAGCAGAAATGAAGG - Intergenic
1093709165 12:22309785-22309807 CTGGATCAGTGAAGAAAGGAGGG + Intronic
1094312088 12:29095307-29095329 CAAGATCAGAGCAGAACTGAAGG + Intergenic
1095671008 12:44860111-44860133 CAGAATTAGTTCATAAATGGTGG + Intronic
1095704567 12:45222775-45222797 CAGGATCCCTTCTGAAATGGGGG - Intronic
1096266817 12:50130074-50130096 GAGGAACAGTACAGAAATGTGGG + Exonic
1096873742 12:54611303-54611325 CCCCATCAGTTCAGGAATGAAGG + Intergenic
1099676563 12:85768081-85768103 AAGGAACAGTTGAGAAAGGAGGG + Intergenic
1099684021 12:85863201-85863223 CAAGATCAGAGCAGAATTGAAGG - Intergenic
1099875742 12:88403712-88403734 CAAGATCAGAGCAGAACTGAAGG + Intergenic
1100248731 12:92792267-92792289 TAAGATCAGAGCAGAAATGAAGG + Intronic
1100413352 12:94345678-94345700 CAGGACCCCTTCAGAAATGCGGG - Intronic
1100869069 12:98892128-98892150 CAGCATCTGGTCAGAAATGAGGG + Intronic
1101166774 12:102044882-102044904 CAGGATGAACTCAGAAAAGAAGG - Intronic
1102163513 12:110787964-110787986 CAGGACCCCTTCTGAAATGAGGG + Intergenic
1103002741 12:117397598-117397620 GAGGATCAATTCAGATATTATGG + Intronic
1103579552 12:121904136-121904158 CAGTATCAGTGCAGAAACGATGG - Intronic
1103713598 12:122930268-122930290 GAGGCTCAGTTCACAAACGATGG + Intronic
1106022688 13:25930182-25930204 CAGGTGCAGTGCAGAAGTGAGGG - Intronic
1106387832 13:29305280-29305302 CAAGATCAGAGCAGAACTGAAGG + Intronic
1106425789 13:29627911-29627933 CAAGATCAGAGCAGAACTGAAGG + Intergenic
1106850343 13:33783140-33783162 GAAGATTAGTTAAGAAATGAGGG - Intergenic
1106914314 13:34496093-34496115 CAAGATCAGAGCAGAACTGAAGG + Intergenic
1107648457 13:42519419-42519441 TAAGATCAGAGCAGAAATGAAGG + Intergenic
1108239842 13:48452105-48452127 CAAGATCAGAGCAGAACTGAAGG - Intronic
1108768466 13:53664438-53664460 CAGGATCAGAACGGAACTGAAGG - Intergenic
1108850027 13:54717047-54717069 TAAGATCAGTGCAGAACTGAAGG - Intergenic
1110498292 13:76195011-76195033 CAAAATCAGTGCTGAAATGAAGG - Intergenic
1110652794 13:77961773-77961795 CAAGATCAGTGCAGAACTGAAGG + Intergenic
1111844655 13:93493520-93493542 CAAGATCAGAGCAGAACTGAAGG - Intronic
1113164272 13:107420593-107420615 CAGGGTCACTTCTGAAATGAAGG - Intronic
1113204997 13:107907032-107907054 GTGCAGCAGTTCAGAAATGAAGG + Intergenic
1114237784 14:20837258-20837280 CTGGTTCAGTTCAGAAAGGCAGG + Intergenic
1115162048 14:30407468-30407490 TAGGATCAGAGCAGAAATGAAGG - Intergenic
1115184219 14:30666544-30666566 TAAGATCAGAGCAGAAATGAAGG + Intronic
1115998601 14:39219068-39219090 CAGGCCTAGTTCAGAAATAATGG + Intergenic
1116033346 14:39599421-39599443 CAAGATCAGAGCAGAACTGAAGG + Intergenic
1116112917 14:40609660-40609682 CAAGATCAGAGCAGAAATGAAGG - Intergenic
1116171560 14:41408566-41408588 CAGGTTCAGTTCAGAAAAGTGGG + Intergenic
1116339954 14:43709703-43709725 CAGAATGCGGTCAGAAATGATGG - Intergenic
1116765452 14:49064931-49064953 CAAGATCAGAGCAGAAATGAGGG + Intergenic
1117616747 14:57541774-57541796 TAGGATCAGAACAGAACTGAAGG - Intergenic
1117889811 14:60407438-60407460 CAAGATCAGAGCAGAACTGAAGG - Intronic
1118558535 14:67053099-67053121 CAAGATCAGAGCAGAACTGAAGG + Intronic
1119406922 14:74404832-74404854 CAGGATCCCTTCAGGAAGGATGG + Intergenic
1120163271 14:81168244-81168266 CAAGATCACTTCTGAAATGAGGG - Intergenic
1120298721 14:82678684-82678706 CAGGAACAATGGAGAAATGATGG - Intergenic
1120770397 14:88373013-88373035 TAAGATCAGAGCAGAAATGAAGG + Intergenic
1120773651 14:88409587-88409609 TAAGATCAGAGCAGAAATGAAGG - Intronic
1120799469 14:88672541-88672563 CAAGATCAGAGCAGAACTGAAGG + Intronic
1121143195 14:91559728-91559750 CAAGATCAGAGCAGAACTGAAGG + Intergenic
1121899263 14:97677733-97677755 TAAGATCAGAGCAGAAATGAAGG + Intergenic
1123397459 15:19951339-19951361 TAAGATCAGATCAGAACTGAAGG + Intergenic
1124894259 15:33761247-33761269 TAAGATCAGAGCAGAAATGAAGG + Intronic
1124896387 15:33781098-33781120 CAGGATCATTTTACAAAAGAGGG - Intronic
1125313651 15:38408070-38408092 CAGGCTTGGTTCAGAAACGATGG + Intergenic
1126219351 15:46194661-46194683 CAAGATCAGGGCAGAACTGAAGG - Intergenic
1127168124 15:56269319-56269341 CAAGATCAGAGCAGAACTGAAGG - Intronic
1127329286 15:57922974-57922996 CAGGATCAGCTCAGGGAGGAGGG + Intergenic
1127630056 15:60819899-60819921 CAGGATCGGTTCAGAACACAGGG - Intronic
1127747305 15:61992289-61992311 CAGGATTTGTTGAGAAAAGAGGG - Intronic
1129563517 15:76595951-76595973 TAGGATCAGAGCAGAACTGAAGG + Intronic
1130191821 15:81744448-81744470 CAGGGTCAGTTAAGGACTGATGG + Intergenic
1130633285 15:85591635-85591657 CAGAAAAAGTTCAGAAAAGAGGG + Intronic
1131350618 15:91696530-91696552 CAGGAAAAGTTCTGAAATGGGGG + Intergenic
1131729573 15:95265495-95265517 CAAGCTCTGTTCAGAAATCAAGG - Intergenic
1132144492 15:99420400-99420422 TAAGATCAGATCAGAACTGAAGG - Intergenic
1132193710 15:99893129-99893151 CAAGATCTGATCAGAAATGTTGG + Intergenic
1132299451 15:100767129-100767151 CAGGATCAGGAGGGAAATGAGGG + Intergenic
1133345294 16:5065789-5065811 CAGGATCAGGTCTGCAATGGTGG + Exonic
1134674449 16:16079526-16079548 GAGGAAAAGCTCAGAAATGATGG + Intronic
1134858618 16:17541038-17541060 CTGGAACATTCCAGAAATGAAGG - Intergenic
1135083079 16:19452784-19452806 CAGGACCCCTTCTGAAATGAGGG + Intronic
1136030214 16:27497181-27497203 CAGCACAAGTTTAGAAATGAGGG + Intronic
1136036847 16:27547045-27547067 CAGGATCATTTAAGAACGGAGGG - Intronic
1137335431 16:47544085-47544107 TAAGATCAGAGCAGAAATGAAGG - Intronic
1137969696 16:52972561-52972583 TAAGATCAGATCAGAACTGAAGG - Intergenic
1139617836 16:68110652-68110674 CAAGATCAGAGCAGAACTGAAGG - Intronic
1146462986 17:33062159-33062181 CAAGATCAGAGCAGAACTGAAGG - Intronic
1147049692 17:37783672-37783694 CAAGATCAGAGCAGAACTGAAGG - Intergenic
1150850788 17:68701948-68701970 CTGGATCTGATCAGAAATGTAGG - Intergenic
1152902710 17:82953180-82953202 CAAGATCAGAGCAGAACTGAAGG + Intronic
1153365361 18:4249541-4249563 CAGTAACCGTTCAGTAATGATGG + Intronic
1154254672 18:12772094-12772116 CAGAAGGAGTTCAGTAATGAAGG - Intergenic
1155432471 18:25774897-25774919 CAAGATCAGAGCAGAACTGAAGG + Intergenic
1156124651 18:33889012-33889034 TAAGATCAGAGCAGAAATGAAGG + Intronic
1157073196 18:44433829-44433851 TAAGATCAGATCAGAACTGAAGG - Intergenic
1158059190 18:53317978-53318000 TAAGATCAGAGCAGAAATGAAGG - Intronic
1158105362 18:53879845-53879867 TAAGATCAGTGCAGAACTGAAGG - Intergenic
1158310617 18:56154083-56154105 CAAGATCAGAGCAGAACTGAAGG + Intergenic
1158367046 18:56747839-56747861 CATGAACATTTCTGAAATGAGGG + Intronic
1158466156 18:57691665-57691687 CACGTTCATTTCAGAATTGAGGG - Intronic
1159685979 18:71421222-71421244 CAAAGTCAGGTCAGAAATGAAGG + Intergenic
1159979090 18:74754346-74754368 TAAGATCAGTGCAGAACTGAAGG - Intronic
1162328622 19:10013339-10013361 CAGGGTCAGTCCAGAATTGAGGG + Exonic
1163963577 19:20721632-20721654 TAAGATCAGAGCAGAAATGAAGG - Intronic
1163976197 19:20855199-20855221 TAGGATCAGAGCAGAACTGAAGG + Intronic
1164043968 19:21518208-21518230 CAAAATCAGATCAGAACTGAAGG - Intronic
1166260391 19:41635682-41635704 TAAGATCAGAGCAGAAATGAAGG - Intronic
925427128 2:3759119-3759141 CAGGGGCAATTCAGAGATGAGGG + Intronic
925633296 2:5916787-5916809 CAGTCTCAGTTCAGACCTGATGG + Intergenic
926289025 2:11514032-11514054 CTGGATCAGTGCAGAGAGGATGG + Intergenic
928354569 2:30598650-30598672 CAAGATCAGAGCAGAAGTGAAGG - Intronic
928522439 2:32103464-32103486 TAAGATCAGAGCAGAAATGAAGG - Intronic
928664149 2:33533717-33533739 CAGGAACCGGTCAGAAATCAGGG - Intronic
928850311 2:35737403-35737425 CAAGATCAGAGCAGAACTGAAGG + Intergenic
929255838 2:39810688-39810710 TAGGATCAGAGCAGAACTGAAGG - Intergenic
929419676 2:41777910-41777932 CATGGGCAGTTCAGAAGTGAGGG - Intergenic
929530391 2:42747353-42747375 CAGGATCCTTTCTGAAATGAGGG + Intronic
930216707 2:48704887-48704909 TAGGATCAGAGCAGAACTGAAGG - Intronic
930323616 2:49885326-49885348 TAAGATCAGATCAGAACTGAAGG + Intergenic
930517206 2:52422842-52422864 TAAGATCAGTGCAGAACTGAAGG + Intergenic
930623054 2:53664670-53664692 CAAGATCAGAGCAAAAATGAAGG + Intronic
930911404 2:56634238-56634260 TAAGATCAGAGCAGAAATGAAGG - Intergenic
930913265 2:56657240-56657262 TAAGATCAGTGCAGAACTGAAGG - Intergenic
930933217 2:56915107-56915129 TAAGATCAGAGCAGAAATGAAGG + Intergenic
931048521 2:58384537-58384559 TAAGATCAGAGCAGAAATGAAGG - Intergenic
931475540 2:62583822-62583844 CAAGATCAGAGCAGAACTGAAGG - Intergenic
932377277 2:71248430-71248452 TAAGATCAGATCAGAACTGAAGG - Intergenic
932431085 2:71673974-71673996 CAGGCTCAGTTCACATAAGATGG - Intronic
933302515 2:80558403-80558425 CAGGATCAGTTCTGTAATTATGG + Intronic
933355972 2:81209438-81209460 TAGGATCAGAGCAGAACTGAAGG + Intergenic
933997708 2:87682068-87682090 CAGGACCTGCTCTGAAATGAAGG - Intergenic
935229758 2:101085325-101085347 CAGGAACAGAACAGAAATGTGGG + Intronic
935707425 2:105869137-105869159 CAGGAGCAGCTCAGATGTGAGGG - Intronic
935952365 2:108342351-108342373 CAAGATCAGAGCAGAACTGAAGG - Intergenic
936296146 2:111268802-111268824 CAGGACCTGCTCTGAAATGAAGG + Intergenic
936704572 2:115056936-115056958 CAGTATGTGTTCACAAATGAAGG + Intronic
936750070 2:115631407-115631429 CAAGATCAGAGCAGAACTGAAGG - Intronic
936781330 2:116036660-116036682 CAAGATCAGAGCAGAACTGAAGG + Intergenic
937978373 2:127595466-127595488 CAAGATCAGAGCAGAACTGAAGG - Intronic
939193116 2:138939928-138939950 TAAGATCAGAGCAGAAATGAAGG - Intergenic
939394860 2:141615452-141615474 CAATATGAGTTAAGAAATGAAGG + Intronic
939860358 2:147412903-147412925 TAAGATCAGAGCAGAAATGAAGG - Intergenic
939942360 2:148365482-148365504 CAAGATCAGAGCAGAACTGAAGG + Intronic
940400980 2:153247708-153247730 TAAGATCAGAGCAGAAATGAAGG + Intergenic
940494246 2:154405233-154405255 CTAAATCATTTCAGAAATGAAGG + Intronic
940828133 2:158436620-158436642 CAGGATCAGAGCAGAACGGAAGG + Intronic
940913136 2:159226287-159226309 AAGGATTAGCTCAGAAATAATGG - Intronic
941135917 2:161718292-161718314 CAAGATCAGAGCAGAACTGAAGG - Intronic
941550570 2:166910610-166910632 TAGGATCAGAGCAGAACTGAAGG - Intronic
941895539 2:170625551-170625573 TAAGATCAGAGCAGAAATGAGGG - Intronic
942864975 2:180662569-180662591 CAGGATCAGAGGAGATATGATGG + Intergenic
943548642 2:189311792-189311814 CAGGATCATTTCAGACATCCAGG - Intergenic
944254521 2:197611609-197611631 TAAGATCAGAGCAGAAATGAAGG - Intronic
944307984 2:198199373-198199395 TAAGATCAGAGCAGAAATGAAGG + Intronic
944378264 2:199074740-199074762 TAAGATCAGAGCAGAAATGAAGG + Intergenic
944915219 2:204353202-204353224 CAAGATCATTTGAGAAATGCTGG + Intergenic
945290390 2:208120984-208121006 CAGGAGAATTTCAGAAATGTTGG - Intergenic
945409482 2:209491440-209491462 TAAGATCAGAGCAGAAATGAAGG + Intronic
947093662 2:226542249-226542271 AAAGATCATTTCAGAAATAAAGG + Intergenic
948605758 2:239133773-239133795 AAGTGTCACTTCAGAAATGAGGG - Intronic
1169658665 20:7954533-7954555 TAAGATCAGTGCAGAACTGAAGG - Intergenic
1169790178 20:9401951-9401973 CAGGACTAGTTCTCAAATGAGGG - Intronic
1170294529 20:14809578-14809600 CAAGATCAGAGCAGAAATGAAGG + Intronic
1171140560 20:22737778-22737800 TAAGATCAGAGCAGAAATGAAGG + Intergenic
1173023861 20:39289758-39289780 CAGGCTCAGATCAGAGATGAGGG - Intergenic
1175446408 20:59023217-59023239 CAGGATCATTTCCAATATGAAGG + Intronic
1176667096 21:9697835-9697857 CAGGATCAGGGCAGACATGTAGG - Intergenic
1176743959 21:10634209-10634231 TAAGATCAGATCAGAACTGAAGG + Intergenic
1176987327 21:15452850-15452872 CAAGATCAGAGCAGAACTGAAGG - Intergenic
1177028460 21:15952181-15952203 CAGGATCAGAGCAGAACTGAAGG - Intergenic
1177573463 21:22920842-22920864 TAAGATCAGAGCAGAAATGAAGG + Intergenic
1179117559 21:38507813-38507835 CACGTTCTGTTCAGAACTGAGGG - Intronic
1179724039 21:43331813-43331835 CAAGCTCATTTCAGAAAAGAAGG + Intergenic
1180250084 21:46579450-46579472 CAAGATCAGAGCAGAACTGAAGG - Intergenic
1183398436 22:37586829-37586851 CAGGACCCCTTCTGAAATGAGGG - Intergenic
1183618625 22:38959946-38959968 CAGGAACAATTCAGCAATGTGGG + Intronic
1184073177 22:42159478-42159500 CAGGACCTGCACAGAAATGATGG - Intergenic
1184665053 22:45983978-45984000 CAGGATCTGTTTTGGAATGAGGG - Intergenic
1184820941 22:46908914-46908936 CAGGTACAGTTCAGAGATGCGGG + Intronic
949195451 3:1300438-1300460 TAGGGTCAGTTCAGGAAGGAAGG + Intronic
949828574 3:8188728-8188750 AAGGAGAAGTTCAGAAATGATGG + Intergenic
950619406 3:14191779-14191801 CAAGATCAGACCAGAACTGAAGG - Intronic
951526952 3:23662583-23662605 CAGGCACAGATCTGAAATGATGG + Intergenic
951623748 3:24636417-24636439 CATGATCAGAGCAGAACTGAAGG + Intergenic
951628818 3:24696429-24696451 CAAGATCAGAGCAGAACTGAAGG - Intergenic
951834025 3:26961388-26961410 CAGGATCCCCTCAGAATTGAGGG + Intergenic
952572604 3:34734971-34734993 CAAGATCAGAGCAGAACTGAAGG + Intergenic
952642242 3:35611560-35611582 TAGGATCAGAGCAGAACTGAAGG + Intergenic
952679217 3:36072018-36072040 AAAGATCAGAGCAGAAATGAAGG - Intergenic
952837438 3:37615962-37615984 CAAGATCAGAGCAGAACTGAAGG - Intronic
954505699 3:51070702-51070724 CAGTATCAGCTGAGAAAAGATGG - Intronic
954877381 3:53811096-53811118 CAGGACCTGTACAGAAAAGAGGG - Exonic
955435662 3:58896381-58896403 CAAGATCAGAGCTGAAATGAAGG - Intronic
956038697 3:65123010-65123032 TAAGATCAGAGCAGAAATGAAGG + Intergenic
956157615 3:66315120-66315142 CAAGATCAGAGCAGAACTGAAGG - Intronic
956243705 3:67157431-67157453 TAAGATCAGAGCAGAAATGAAGG + Intergenic
956272438 3:67462293-67462315 CAGGACCCCTTCGGAAATGAGGG - Intronic
956325437 3:68047483-68047505 CTGGTTCATTTCAGAGATGAGGG - Intronic
957433848 3:80149321-80149343 TAAGATCAGAGCAGAAATGAAGG - Intergenic
957603867 3:82373308-82373330 AAGGATCAGAGCAGAACTGAAGG - Intergenic
958191489 3:90190646-90190668 CAAGATCAGAGCAGAACTGAAGG - Intergenic
958483992 3:94679861-94679883 CAAGATTAGAGCAGAAATGAAGG + Intergenic
958553822 3:95648192-95648214 CAAGATTAGATCAGAACTGAAGG + Intergenic
958815461 3:98909614-98909636 CAAGATCAGAACTGAAATGAAGG + Intergenic
958947512 3:100379904-100379926 CAGGGTCAGGTCAGACATGGTGG - Intronic
959101189 3:102011337-102011359 CAAGATCAGAGCAGAACTGAAGG + Intergenic
959103757 3:102043054-102043076 CAAGATCAGAGCAGAACTGAAGG + Intergenic
959290430 3:104466836-104466858 TAGGATCAGAGCAGAACTGAAGG - Intergenic
959354561 3:105309400-105309422 TAAGATCAGAGCAGAAATGAAGG + Intergenic
959402439 3:105919960-105919982 CAAGATGTTTTCAGAAATGAGGG - Intergenic
959618579 3:108375587-108375609 TAAGATCAGAGCAGAAATGAAGG + Intronic
959670220 3:108968812-108968834 CAGGATCAATACTGAAATGTTGG - Intronic
960276469 3:115735144-115735166 CAAGATCAGAACAGAACTGAAGG - Intergenic
960764326 3:121109232-121109254 CAAGATCAGAGCAGAACTGAAGG - Intronic
961184467 3:124902577-124902599 CAGGACCAGTTGGGACATGAAGG + Intergenic
961414851 3:126749775-126749797 CAGGGTATGTCCAGAAATGATGG - Intronic
962125142 3:132609284-132609306 CAAGATCAGAGCAGAACTGAAGG + Intronic
962252991 3:133849678-133849700 CATGACAGGTTCAGAAATGAAGG - Intronic
962617373 3:137140497-137140519 TAAGATCAGAGCAGAAATGAAGG + Intergenic
962696650 3:137954725-137954747 CAAGATCAGAGCAGAACTGAAGG - Intergenic
962954157 3:140248690-140248712 CAGGATCACTGCATGAATGAAGG + Intronic
963282012 3:143393594-143393616 TAAGATCAGAGCAGAAATGAAGG + Intronic
963512458 3:146265264-146265286 TTCTATCAGTTCAGAAATGATGG - Intergenic
963689543 3:148481262-148481284 CATGATCAGAGCAGAATTGAAGG + Intergenic
963691364 3:148506858-148506880 TAAGATCAGAGCAGAAATGAAGG - Intergenic
963882925 3:150548152-150548174 CAGAAGCAGTTCAGTATTGATGG - Intronic
964294873 3:155222658-155222680 CAAGATCAGAGCAGAACTGAAGG - Intergenic
964519881 3:157553622-157553644 CAGGACCCCTTCTGAAATGAGGG - Intronic
964905122 3:161710198-161710220 TAAGATCAGATCAGAAGTGAAGG + Intergenic
965497558 3:169416519-169416541 TAGGATCAGGGCAGAACTGAAGG + Intronic
966925962 3:184644764-184644786 CAGGATTATTGCAGAAATCAAGG + Intronic
967326613 3:188246892-188246914 CAGCCTCAGACCAGAAATGATGG + Intronic
967458077 3:189712793-189712815 AAGGACTATTTCAGAAATGAAGG + Intronic
967473560 3:189890227-189890249 CAGGGTCTGTTCTGTAATGATGG + Intronic
969164527 4:5295767-5295789 TAAGATCAGAGCAGAAATGAAGG - Intronic
969549717 4:7856683-7856705 CAGGAACATTTAAGAAAAGAGGG - Intronic
969876455 4:10139218-10139240 CCTGTTCAGTGCAGAAATGAGGG - Intergenic
971078341 4:23176970-23176992 CAAGATCAGAGCAGAACTGAAGG - Intergenic
971671613 4:29564876-29564898 TAGGATCAGAGCAGAACTGAAGG + Intergenic
972908770 4:43786554-43786576 CAGGATCAGAGGAGATATGATGG + Intergenic
973018462 4:45170547-45170569 CAAGATCAGGGCAGAACTGAAGG - Intergenic
974654598 4:64802597-64802619 CAAGATCAGAGCAGAACTGAAGG + Intergenic
974690404 4:65291234-65291256 CAAGATCAGAGCAGAACTGAAGG - Intergenic
974774329 4:66460322-66460344 TAGGATCAGAGCAGAACTGAAGG - Intergenic
974780637 4:66548239-66548261 TAGGATCAGAGCAGAACTGAAGG + Intergenic
974837727 4:67271178-67271200 TAAGATCAGAGCAGAAATGAAGG - Intergenic
974899141 4:67975234-67975256 CAGGATCAGGAATGAAATGATGG - Intergenic
974912956 4:68145901-68145923 CAAGATCAGAGCAGAACTGAAGG - Intergenic
974939594 4:68449915-68449937 GAGGATAATTTCAGAAAGGAGGG + Intronic
975165954 4:71178349-71178371 TAAGATCAGAGCAGAAATGAAGG + Intergenic
975647932 4:76564116-76564138 CAGGATGAGTGAAGTAATGAAGG - Intronic
975842560 4:78490797-78490819 TAGGATCAGAACAGAACTGAAGG + Intronic
976777720 4:88724077-88724099 CTGGAGAAGTGCAGAAATGAGGG - Intergenic
976778306 4:88730741-88730763 CAAGCTCATTTCAAAAATGAAGG - Intronic
976833245 4:89339569-89339591 GAGAATGAGATCAGAAATGAAGG - Intergenic
977084167 4:92573310-92573332 CAAGATCAGAGCAGAACTGAAGG - Intronic
977245685 4:94628608-94628630 CAGCCTAATTTCAGAAATGAAGG - Intronic
977500540 4:97831516-97831538 TAAGATCAGAGCAGAAATGAAGG + Intronic
977627909 4:99208301-99208323 CGGGTTCATTTCAAAAATGAAGG - Intronic
977632642 4:99260472-99260494 TAAGATCAGAGCAGAAATGAAGG - Intergenic
978047658 4:104151752-104151774 TGTGATCAGTTCAGAGATGAAGG - Intergenic
978361439 4:107934459-107934481 AAGTATCAGCTTAGAAATGATGG - Intronic
978601121 4:110429188-110429210 CAAGATCAGAGCAGAACTGAAGG - Intronic
978658700 4:111097637-111097659 TAAGATCAGAGCAGAAATGAAGG - Intergenic
978859046 4:113427513-113427535 TAAGATCAGTGGAGAAATGAAGG - Intergenic
978904453 4:113989175-113989197 TAAGATCAGAGCAGAAATGAAGG + Intergenic
979400502 4:120243845-120243867 CAAGATCAGCTCAGAAATATGGG + Intergenic
979768524 4:124492647-124492669 AAGGAACAGTGCAGACATGAAGG - Intergenic
979957335 4:126970144-126970166 CATGGTCAGCTCAGAAATGTTGG + Intergenic
982294955 4:153818380-153818402 CAAGATCAGAGCAGAACTGAAGG + Intergenic
983010690 4:162542422-162542444 CAGGATCAGGAGAGAATTGAAGG - Intergenic
983729160 4:170971948-170971970 CAGGATCAGTGCAGAGAGAACGG - Intergenic
984384089 4:179033059-179033081 TAAGATCAGAGCAGAAATGAAGG + Intergenic
984633667 4:182088258-182088280 CTGGATCAGTACAGAAATTTGGG + Intergenic
985407913 4:189654502-189654524 CAGGATCAGGGCAGACATGTAGG + Intergenic
986406904 5:7435048-7435070 GAGGATCAGATCAGAACAGAGGG + Intronic
986530719 5:8733987-8734009 TAAGATCAGAGCAGAAATGAAGG + Intergenic
986753830 5:10815104-10815126 CAAGATCAGAGCAGAACTGAAGG + Intergenic
986880805 5:12168607-12168629 CAAGATCAGAGCAGAACTGAAGG - Intergenic
987115617 5:14724496-14724518 AAGGATCAGTGCAGTGATGAAGG + Intronic
987173797 5:15286327-15286349 AAGGTTCAGTCCATAAATGATGG + Intergenic
987684346 5:21177921-21177943 CATAACCAGTTGAGAAATGATGG - Intergenic
987866712 5:23550088-23550110 CAGGACCCTTTCTGAAATGAGGG - Intergenic
988110761 5:26815832-26815854 CAAGATCAGAGCAGAACTGAAGG + Intergenic
988257372 5:28838259-28838281 AAGGCTAAGTTCAGAAATAAAGG - Intergenic
989029338 5:37102086-37102108 CAAGATCAGAGCAGAACTGAAGG - Intergenic
989276508 5:39596154-39596176 CAAGATCAGAGCAGAACTGAGGG - Intergenic
989407335 5:41076275-41076297 CAAGATCAGAGCAGAACTGAAGG - Intergenic
989657142 5:43757029-43757051 CAAGATCAGAGCAGAATTGAAGG - Intergenic
989662124 5:43811172-43811194 TAAGATCAGAGCAGAAATGAAGG - Intergenic
989681919 5:44040089-44040111 CAAGATCAGAGCAGAACTGAAGG - Intergenic
990317568 5:54597882-54597904 CAAGATCAGAGCAGAACTGAAGG + Intergenic
991606651 5:68408914-68408936 AAGGATCATATAAGAAATGAAGG + Intergenic
991627903 5:68623458-68623480 CAAGATCAGAGCAGAACTGAAGG - Intergenic
992251103 5:74876629-74876651 CAGAATCAGTTCACGGATGAAGG + Intergenic
992571959 5:78067906-78067928 CAAGATCAGAGCAGAATTGAAGG + Intronic
993068570 5:83130967-83130989 TAGGATCAGAGCAGAATTGAAGG - Intronic
993688756 5:90972845-90972867 TAAGATCAGAGCAGAAATGAAGG + Intronic
993837400 5:92832479-92832501 CAAGATCAGAGCAGAACTGAAGG - Intergenic
993957258 5:94249409-94249431 CATGATCAGTCCAGAAAAGAAGG - Intronic
994263033 5:97682265-97682287 TAAGATCAGAGCAGAAATGAAGG - Intergenic
994266298 5:97720787-97720809 TAAGATCAGAGCAGAAATGAAGG - Intergenic
994350961 5:98745469-98745491 CAAGATCAGAGCAGAACTGAAGG + Intergenic
994834293 5:104829607-104829629 TAGGATCAGAGCAGAACTGAAGG - Intergenic
995467266 5:112463735-112463757 TAAGATCAGAGCAGAAATGAAGG - Intergenic
996119829 5:119658648-119658670 CTGAATAAGTTCAGAAATCAAGG - Intergenic
997097225 5:130926692-130926714 CAAGATCAGAGCAGAACTGAAGG + Intergenic
997129731 5:131264414-131264436 CACGCTCAGTTCAGAATTCACGG + Intronic
997765938 5:136503399-136503421 CAAGGTAAGTTCAGAAATGGAGG - Intergenic
997873501 5:137526808-137526830 TAAGATCAGAGCAGAAATGAAGG + Intronic
998873066 5:146572016-146572038 CAGGATCAGAGCAGAACTGAAGG - Intergenic
999694693 5:154178737-154178759 AAGGACCAGCCCAGAAATGAGGG + Intronic
999984227 5:156987558-156987580 TAGGATCAGAACAGAACTGAGGG + Intergenic
1000053182 5:157579625-157579647 CAGGATCATCTCTGCAATGAGGG + Intergenic
1001252328 5:170156059-170156081 CAGGCTGAGTCCAGAAATGCTGG - Intergenic
1002579537 5:180199358-180199380 CAGGATCCGGTCAGTGATGAAGG - Intronic
1002755850 6:158867-158889 CAAGATCAGAGCAGAACTGAAGG + Intergenic
1003214918 6:4100342-4100364 CAGGATCATTTCTGATTTGAAGG + Intronic
1003225476 6:4201513-4201535 TAAGATCAGAGCAGAAATGAAGG - Intergenic
1004453176 6:15766490-15766512 CAGGATCTGTCCTGAAAAGAGGG - Intergenic
1004819245 6:19348862-19348884 CAGCATAACTTCAGACATGAAGG + Intergenic
1005791934 6:29312105-29312127 TAAGATCAGAGCAGAAATGAAGG - Intergenic
1005846391 6:29782895-29782917 CAAGATCAGGGCAGAACTGAAGG + Intergenic
1005921392 6:30405160-30405182 CTTGATCAGTTCATTAATGAAGG - Intergenic
1006742040 6:36315902-36315924 CAGAATAAGTTATGAAATGAAGG - Exonic
1007889930 6:45279533-45279555 CAGGAGCAATTCAGAAAGGGGGG - Intronic
1008323050 6:50141765-50141787 CAGCATAAGATCAGAAGTGAAGG + Intergenic
1008719430 6:54330599-54330621 TAAGATCAGAGCAGAAATGAAGG + Intronic
1009487405 6:64241691-64241713 CAAGATCAGAGCAGAACTGAAGG - Intronic
1009793546 6:68435814-68435836 CTGGATCAGGTAAGAAAGGAAGG - Intergenic
1009962647 6:70542411-70542433 CAGAATTAGTTCTGAAAAGATGG - Intronic
1010545472 6:77150171-77150193 CATACTGAGTTCAGAAATGACGG - Intergenic
1011015937 6:82755590-82755612 TAAGATCAGAGCAGAAATGAAGG - Intergenic
1011298657 6:85850884-85850906 CAAGATCAGAGCAGAACTGAAGG - Intergenic
1012674656 6:102100378-102100400 TAGGATCAGAGCAGAACTGAAGG - Intergenic
1012785450 6:103619611-103619633 CAAGATCAGAGCAGAACTGAAGG + Intergenic
1013672886 6:112424500-112424522 CAAGATCAGAGCAGAACTGAAGG + Intergenic
1014765290 6:125399226-125399248 CAAGATCAGAGCAGAACTGAAGG + Intergenic
1014818748 6:125961921-125961943 CAGAATCCCTTCAGAAATGAGGG + Intronic
1014883454 6:126750566-126750588 CAAGATCAGAGCAGAAGTGAAGG + Intergenic
1014922706 6:127231374-127231396 TAAGATCAGAGCAGAAATGAAGG + Intergenic
1015064414 6:129006622-129006644 CAGAGGCAGTTCAGAAATCAAGG - Intronic
1015133304 6:129838576-129838598 CAAGATCAGAGCAGAACTGAAGG + Intronic
1015651610 6:135468362-135468384 CAAGATCAGAGCAGAAATAAAGG + Intronic
1015699059 6:136014834-136014856 CAGATTCAGTTCTGAATTGATGG - Intronic
1015902170 6:138079086-138079108 CAAGATCAGAGCTGAAATGAAGG + Intergenic
1016335144 6:142996892-142996914 CAAGATCAGAGCAGAACTGAAGG + Intergenic
1016523612 6:144974721-144974743 TAAGATCAGAGCAGAAATGAAGG - Intergenic
1017182649 6:151568197-151568219 CAAGATCATTTCAGAAATTGAGG - Intronic
1017614477 6:156229919-156229941 CAGGCTCAGCTCAGGAATCAGGG + Intergenic
1017762466 6:157580919-157580941 CAGAATCAGTGCTGAACTGAAGG - Intronic
1017882788 6:158573283-158573305 CAGGCCCACTTCAGAAGTGAGGG + Intronic
1020480772 7:8657546-8657568 CAGCATCAAATCAGAGATGAGGG + Intronic
1020823508 7:12999707-12999729 TAAGATCAGAGCAGAAATGAAGG - Intergenic
1021158875 7:17246983-17247005 CAGGACCTCTTCTGAAATGAGGG - Intergenic
1021322611 7:19230011-19230033 TAGGATCAGAGCAGAACTGAGGG + Intergenic
1021373598 7:19880644-19880666 TAAGATCAGAGCAGAAATGAAGG - Intergenic
1022634947 7:32122858-32122880 CACGATCAGAGCAGAATTGAAGG + Intronic
1023065780 7:36376087-36376109 AAGGATCAGAGCAGAACTGAAGG - Intronic
1023642645 7:42275880-42275902 AAGTACCATTTCAGAAATGATGG - Intergenic
1024334858 7:48196733-48196755 CAGGAACACATCAGAAATGGTGG - Intronic
1024405851 7:48979008-48979030 CAAGATCAGAGCAGAACTGAAGG + Intergenic
1024907644 7:54406235-54406257 CAAGATCAGAGCTGAAATGAAGG - Intergenic
1024990270 7:55229096-55229118 CAAGATCAGAGCAGAACTGAAGG - Intronic
1027393560 7:77729318-77729340 CAAGGTCAGAACAGAAATGAAGG + Intronic
1027577054 7:79944087-79944109 TAAGATCAGAGCAGAAATGAAGG - Intergenic
1027891544 7:83983108-83983130 CAGGACAAATTAAGAAATGATGG + Intronic
1027949208 7:84791940-84791962 CAGAATTATTTGAGAAATGAAGG + Intergenic
1028395248 7:90362130-90362152 TAAGATCAGAGCAGAAATGAAGG - Intronic
1028801110 7:94967313-94967335 TAAGATCAGAGCAGAAATGAAGG - Intronic
1029033024 7:97488590-97488612 CAGGGTCAGTTCAATAATTAAGG - Intergenic
1029042183 7:97587995-97588017 GAGGAAGAATTCAGAAATGATGG - Intergenic
1029542318 7:101191093-101191115 CAGGACCCTTTCTGAAATGAGGG + Intergenic
1030202755 7:106921942-106921964 TAGGATCAGAGCAGAACTGAAGG + Intergenic
1030534326 7:110746896-110746918 TAAGATCAGTGCAGAACTGAAGG + Intronic
1030890458 7:114993349-114993371 TAAGATCAGATCAGAACTGAAGG - Intronic
1031641892 7:124174693-124174715 AAAGATCAGAGCAGAAATGAAGG - Intergenic
1031705607 7:124977429-124977451 TAGGATCAGAGCAGAACTGAAGG - Intergenic
1032431805 7:131868185-131868207 CAGGACCCCTTCTGAAATGAAGG + Intergenic
1032603770 7:133327435-133327457 TAAGATCAGAGCAGAAATGAAGG - Intronic
1033263332 7:139862387-139862409 AAGGATCAGTAAAGAAATAATGG + Intronic
1033387682 7:140894199-140894221 AAAGACCACTTCAGAAATGAAGG + Intronic
1033626421 7:143114439-143114461 CAAGATCAGAGCAGAACTGAAGG + Intergenic
1033902526 7:146160336-146160358 CAAGATCAGAGCAGAAATGAAGG + Intronic
1034220746 7:149444089-149444111 CAGGATCAGTTCGGAGGAGATGG - Intronic
1034372183 7:150608728-150608750 TAAGATCAGGGCAGAAATGAAGG + Intergenic
1034583074 7:152063460-152063482 CAAGATCAGAGCAGAACTGAAGG - Intronic
1034922889 7:155098505-155098527 CAGGATCTGGTAACAAATGATGG + Intergenic
1035187942 7:157140180-157140202 AAAGAACATTTCAGAAATGATGG - Intronic
1036538366 8:9675447-9675469 CTTGATAAGTTCAGAAATTAAGG + Intronic
1036928115 8:12927293-12927315 CGGGAACATTTCAGAAAGGACGG - Intergenic
1037257982 8:16976842-16976864 TAGGATCAGAGCAGAACTGAAGG - Intergenic
1038266957 8:26045296-26045318 CAGGATCAGTTGTAAAAAGAAGG + Exonic
1039622515 8:39011451-39011473 CATGATCAGTTATGAAAGGAAGG + Intronic
1039636785 8:39176183-39176205 CAAGATCAGAGCAGAACTGAAGG - Intronic
1040086406 8:43347434-43347456 TAAGATCAGAGCAGAAATGAAGG - Intergenic
1040364580 8:46702261-46702283 TAAGATCAGAGCAGAAATGAGGG - Intergenic
1040658666 8:49543800-49543822 CAGGATCTCCTCTGAAATGAGGG - Intronic
1040736135 8:50510913-50510935 TAAGATCAGAGCAGAAATGAAGG - Intronic
1040769343 8:50954187-50954209 TAAGATCAGAGCAGAAATGAAGG - Intergenic
1040968526 8:53109480-53109502 TAAGATCAGAGCAGAAATGAAGG - Intergenic
1041294005 8:56335759-56335781 AAAGATCAGAGCAGAAATGAAGG - Intergenic
1041771537 8:61477796-61477818 TAAGATCAGAGCAGAAATGAAGG - Intronic
1041944660 8:63427574-63427596 CTAGATCAGTTCATAAAGGAAGG - Intergenic
1042070521 8:64928446-64928468 TAAGATCAGAGCAGAAATGAAGG - Intergenic
1042489802 8:69384243-69384265 CAAGATCAGAGCAGAATTGAAGG + Intergenic
1044420584 8:91991561-91991583 CAAGTTAAGTTCAGAAATAATGG + Intronic
1045732745 8:105261207-105261229 CAAGATCAGAGCAGAACTGAAGG - Intronic
1045887010 8:107110671-107110693 CAAGATCAGAGCAGAACTGAAGG + Intergenic
1046410258 8:113832611-113832633 TAGGATCAGAACAGAACTGAAGG + Intergenic
1046539724 8:115564072-115564094 CAGGCTCAGTTCATAACTGGAGG - Intronic
1047044541 8:121037403-121037425 CAGGATGAAATCAGAAATCAAGG - Intergenic
1047488334 8:125353229-125353251 CAGCATCAGTTCAGAATAAATGG + Intronic
1048160210 8:132012980-132013002 CAAGACCAGTTCAGAAATCCAGG - Exonic
1048434917 8:134407232-134407254 CAGGATGAGTCAAGAAAAGAAGG - Intergenic
1048532429 8:135262109-135262131 CAAGATCAGAGCAGAACTGAAGG + Intergenic
1048898597 8:139016669-139016691 CAGGAACACTGCAGAAGTGAAGG - Intergenic
1050166859 9:2773910-2773932 CAGGATCAGAGCAGAACTGAAGG + Intronic
1050440910 9:5662833-5662855 CAAGATCAGAGCAGAACTGAAGG - Intronic
1051022448 9:12560258-12560280 CAGAAATAGTTCAGAAATGCAGG - Intergenic
1051229357 9:14939161-14939183 CAGGAGAAATTCAGGAATGATGG - Intergenic
1051458162 9:17284754-17284776 CAAGATCAGAGCAGAATTGAAGG - Intronic
1052440933 9:28495656-28495678 TAAGATCAGAGCAGAAATGAAGG - Intronic
1052444792 9:28546517-28546539 CAGGACCCATTCTGAAATGAGGG + Intronic
1052724630 9:32214828-32214850 CAAGATCAGACCAGAACTGAAGG - Intergenic
1053225926 9:36357129-36357151 CAGCCTCCTTTCAGAAATGAGGG - Intronic
1055057934 9:72040549-72040571 CAGGATCATCTCTGAAATGGGGG - Intergenic
1055537635 9:77265791-77265813 TAAGATCAGAGCAGAAATGAAGG - Intronic
1056924097 9:90818197-90818219 CAGGGTCATTTCAGAGAGGAGGG + Intronic
1057113227 9:92494432-92494454 CATAATCAGTTTAGGAATGAAGG - Intronic
1057642455 9:96837423-96837445 CTAGATCAGTTCAGAAAAAAAGG - Intronic
1058530067 9:105897427-105897449 CAAGATCAGAGCAGAACTGAAGG - Intergenic
1058657352 9:107235618-107235640 CAGTATAAGTTCGGAAATTAAGG + Intergenic
1059320488 9:113464587-113464609 CAGGACCAGTGAGGAAATGAAGG - Intronic
1060158321 9:121336133-121336155 CATAATCAGTTCAGAGTTGAGGG + Intergenic
1061304122 9:129722837-129722859 CGGGAACAGTACAGATATGAGGG - Intergenic
1061384972 9:130284427-130284449 CAGGATCAGACCAGAAAACAAGG - Intergenic
1061502677 9:131012911-131012933 AAGGCTCAGCTCAGAGATGACGG - Intronic
1062154150 9:135037066-135037088 TAGGATCAATCCAGACATGATGG - Intergenic
1203659000 Un_KI270753v1:23927-23949 CAGGATCAGGGCAGACATGTAGG + Intergenic
1185936497 X:4262633-4262655 CAGGACCCCTTCTGAAATGAGGG + Intergenic
1186523472 X:10226538-10226560 CAAGATCAGAGCAGAACTGAAGG + Intronic
1186740718 X:12515199-12515221 CAAGATCAGAGCAGAACTGAAGG - Intronic
1188201992 X:27302666-27302688 TAAGATCAGTGCAGAACTGAAGG + Intergenic
1188451864 X:30316001-30316023 AAACATCAGTTCAGAAATAAAGG - Intergenic
1189715920 X:43866096-43866118 CAGGATAAAGTCTGAAATGATGG - Intronic
1189999868 X:46675717-46675739 CAGGATCCCTTCTGAAATGAGGG - Intronic
1190422448 X:50299130-50299152 CAAGATCAGAGCAGAAATGAAGG - Intronic
1191071753 X:56408043-56408065 TAAGATCAGAGCAGAAATGAAGG - Intergenic
1191115677 X:56849893-56849915 TAAGATCAGAGCAGAAATGAAGG + Intergenic
1191122218 X:56918130-56918152 TAAGATCAGAGCAGAAATGAAGG - Intergenic
1191168267 X:57415222-57415244 TAAGATCAGTGCAGAACTGAAGG - Intronic
1191203328 X:57808030-57808052 TAAGATCAGAGCAGAAATGAAGG - Intergenic
1191203812 X:57813268-57813290 CAAGATCAGAGCAGAACTGAAGG - Intergenic
1191579581 X:62745325-62745347 CAAGATCAGAGCAGAACTGAAGG + Intergenic
1191725486 X:64276183-64276205 TAAGATCAGATCAGAACTGAAGG - Intronic
1191726408 X:64285969-64285991 TAAGATCAGAGCAGAAATGAAGG + Intronic
1191864547 X:65693308-65693330 TAAGATCAGTGCAGAACTGAAGG - Intronic
1191948858 X:66566220-66566242 TAGGATCAGAGCAGAACTGAAGG + Intergenic
1191950659 X:66588279-66588301 TAAGATCAGAGCAGAAATGAAGG - Intergenic
1192010727 X:67269552-67269574 CAAGATCAGAGCAGAACTGAAGG + Intergenic
1192352237 X:70366247-70366269 TAAGATCAGAGCAGAAATGAAGG - Intronic
1192703444 X:73501455-73501477 TAGGATCAGAGCAGAACTGAAGG + Intergenic
1192918765 X:75683515-75683537 TAGGATCATAGCAGAAATGAAGG - Intergenic
1193034749 X:76937368-76937390 TAAGATCAGAGCAGAAATGAAGG + Intergenic
1193036126 X:76953298-76953320 TAAGATCAGAGCAGAAATGAAGG + Intergenic
1193123149 X:77844444-77844466 TAAGATCAGATCAGAACTGAAGG - Intronic
1193592768 X:83410204-83410226 CAAGATCAGAGCAGAACTGAAGG + Intergenic
1194097452 X:89659762-89659784 CAGGATTAGTTCATTTATGATGG + Intergenic
1194170203 X:90571619-90571641 CAAGATCAGAGCAGAACTGAAGG + Intergenic
1194391044 X:93318830-93318852 TAAGATCAGATCAGAACTGAAGG - Intergenic
1194608272 X:96008205-96008227 CAAGATGAGAGCAGAAATGAAGG + Intergenic
1194721612 X:97346812-97346834 GAGGAGCAGCTCTGAAATGAGGG + Intronic
1194930685 X:99883658-99883680 CAAGATCAGACCAGAACTGAAGG + Intergenic
1195332413 X:103814581-103814603 TAAGATCAGATCAGAACTGAAGG + Intergenic
1195531480 X:105962734-105962756 TAAGATCAGTGCATAAATGAAGG + Intergenic
1195622329 X:106969469-106969491 TAAGATCAGAGCAGAAATGAAGG + Intronic
1195715750 X:107817240-107817262 TAGGATGAGTTCAGAGACGAAGG + Intergenic
1196172508 X:112605472-112605494 TAGGATCAGAGCAGAACTGAAGG + Intergenic
1196280890 X:113822497-113822519 CAAGATCAGAGCAGAACTGAAGG - Intergenic
1196312661 X:114186615-114186637 TAAGATCAGAGCAGAAATGAAGG + Intergenic
1196600390 X:117595357-117595379 TAAGATCAGTGCAGAACTGAAGG - Intergenic
1197319399 X:125009026-125009048 TAAGATCAGTGCAGAACTGAAGG + Intergenic
1197455928 X:126675243-126675265 CAAGATCAGAGCAGAACTGAAGG + Intergenic
1197601820 X:128540285-128540307 CAAGATCAGAGCAGAACTGAAGG - Intergenic
1198085929 X:133282096-133282118 TAAGATCAGAGCAGAAATGAAGG + Intergenic
1198680461 X:139176407-139176429 TAGGATCAGAGCAGAACTGAAGG - Intronic
1198878405 X:141252118-141252140 TAAGATCAGATCAGAACTGAAGG - Intergenic
1199450200 X:147970566-147970588 CAGGATCAGAGCAGAACTGAAGG + Intergenic
1199469541 X:148179111-148179133 TAAGATCAGATCAGAACTGAAGG - Intergenic
1200450469 Y:3321134-3321156 CAGGATTAGTTCATTTATGATGG + Intergenic
1200516448 Y:4149386-4149408 CAAGATCAGAGCAGAACTGAAGG + Intergenic
1200778523 Y:7192986-7193008 AAAGATCAGAGCAGAAATGAAGG - Intergenic
1201392865 Y:13517414-13517436 TAAGATCAGAGCAGAAATGAAGG - Intergenic
1201521985 Y:14885535-14885557 TAAGATCAGAGCAGAAATGAAGG - Intergenic
1201628504 Y:16042102-16042124 CAAGATCAGAGCAGAACTGAAGG - Intergenic
1201720783 Y:17094534-17094556 CAGGACCCCTTCTGAAATGAGGG + Intergenic
1202040870 Y:20682141-20682163 CAGCATCAGATAAGAAAGGAAGG - Intergenic