ID: 918483937

View in Genome Browser
Species Human (GRCh38)
Location 1:185009637-185009659
Sequence TGAAACCAGTGTAAAATAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918483937_918483939 19 Left 918483937 1:185009637-185009659 CCCACTATTTTACACTGGTTTCA No data
Right 918483939 1:185009679-185009701 ATATTTATAATCTATAATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918483937 Original CRISPR TGAAACCAGTGTAAAATAGT GGG (reversed) Intergenic
No off target data available for this crispr