ID: 918484531

View in Genome Browser
Species Human (GRCh38)
Location 1:185015301-185015323
Sequence CTGGAAATACAGATGCAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918484531_918484533 -4 Left 918484531 1:185015301-185015323 CCAATCTGCATCTGTATTTCCAG No data
Right 918484533 1:185015320-185015342 CCAGTTTCTTTCCTAAGCTCAGG No data
918484531_918484535 22 Left 918484531 1:185015301-185015323 CCAATCTGCATCTGTATTTCCAG No data
Right 918484535 1:185015346-185015368 TTGTTTTCTATTTACAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918484531 Original CRISPR CTGGAAATACAGATGCAGAT TGG (reversed) Intergenic
No off target data available for this crispr