ID: 918484531 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:185015301-185015323 |
Sequence | CTGGAAATACAGATGCAGAT TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
918484531_918484533 | -4 | Left | 918484531 | 1:185015301-185015323 | CCAATCTGCATCTGTATTTCCAG | No data | ||
Right | 918484533 | 1:185015320-185015342 | CCAGTTTCTTTCCTAAGCTCAGG | No data | ||||
918484531_918484535 | 22 | Left | 918484531 | 1:185015301-185015323 | CCAATCTGCATCTGTATTTCCAG | No data | ||
Right | 918484535 | 1:185015346-185015368 | TTGTTTTCTATTTACAAAAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
918484531 | Original CRISPR | CTGGAAATACAGATGCAGAT TGG (reversed) | Intergenic | ||
No off target data available for this crispr |