ID: 918485026

View in Genome Browser
Species Human (GRCh38)
Location 1:185019671-185019693
Sequence TTGGATGAATAAATGTAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918485023_918485026 10 Left 918485023 1:185019638-185019660 CCTGTCACAAAGTAGGTGCTAAA No data
Right 918485026 1:185019671-185019693 TTGGATGAATAAATGTAGCAGGG No data
918485021_918485026 24 Left 918485021 1:185019624-185019646 CCTAGAAAAAAGTGCCTGTCACA No data
Right 918485026 1:185019671-185019693 TTGGATGAATAAATGTAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918485026 Original CRISPR TTGGATGAATAAATGTAGCA GGG Intergenic
No off target data available for this crispr