ID: 918487560

View in Genome Browser
Species Human (GRCh38)
Location 1:185045611-185045633
Sequence GGCCGCGGCCAGCGGAGCCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 5, 3: 42, 4: 387}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918487556_918487560 -8 Left 918487556 1:185045596-185045618 CCAGAGTCTTGCTCCGGCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 63
Right 918487560 1:185045611-185045633 GGCCGCGGCCAGCGGAGCCCTGG 0: 1
1: 0
2: 5
3: 42
4: 387
918487554_918487560 7 Left 918487554 1:185045581-185045603 CCGCGGCAGCTGATACCAGAGTC 0: 1
1: 0
2: 0
3: 9
4: 117
Right 918487560 1:185045611-185045633 GGCCGCGGCCAGCGGAGCCCTGG 0: 1
1: 0
2: 5
3: 42
4: 387
918487553_918487560 14 Left 918487553 1:185045574-185045596 CCGGCGTCCGCGGCAGCTGATAC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 918487560 1:185045611-185045633 GGCCGCGGCCAGCGGAGCCCTGG 0: 1
1: 0
2: 5
3: 42
4: 387

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918487560 Original CRISPR GGCCGCGGCCAGCGGAGCCC TGG Exonic
900151311 1:1180405-1180427 GCGGGCGGCCAGCGGAGGCCGGG - Intronic
900171920 1:1273526-1273548 GCCCGCCGCCCGCGGGGCCCCGG - Intronic
900191775 1:1355162-1355184 GGGCGCGGTCAGCGGCGCGCGGG + Intronic
900200868 1:1405688-1405710 GGCTGAGGCCAGAGGATCCCTGG - Intronic
900201290 1:1407780-1407802 GGCCGCGGCGAGCCGAGGTCGGG - Intergenic
900287516 1:1908759-1908781 GGACGCGGACGGAGGAGCCCCGG + Intergenic
900350252 1:2231015-2231037 GGCGGCTGCCACCTGAGCCCTGG - Intronic
900633766 1:3652064-3652086 GGCGGCGGCCAGGAGAGACCCGG + Intronic
900786772 1:4654664-4654686 GGGCGCGGGCGGCGGGGCCCCGG + Intergenic
901019698 1:6249522-6249544 AGCAGCGCCCAGCGGAGCCCAGG - Exonic
901049995 1:6421097-6421119 AGCCTGGGCCAGGGGAGCCCAGG + Intronic
901319212 1:8329590-8329612 GGCACCGGCCAGCCCAGCCCTGG - Intronic
902385591 1:16073684-16073706 GGGCGCGGCGGGCGGGGCCCGGG + Intergenic
902876504 1:19343806-19343828 GGCCACTGGCAGCAGAGCCCTGG + Intronic
903142165 1:21345306-21345328 GGTCGCGGGCAGCGGTGCCGCGG - Intronic
903652586 1:24930618-24930640 GGCCGCGGCCAGCGGGGAGGAGG - Intronic
904626201 1:31805217-31805239 GGCCGGGGCCAGTGGATCACAGG - Intronic
904822667 1:33255997-33256019 GGCCACGGCCGCCGGGGCCCCGG + Intergenic
905546476 1:38804221-38804243 GGCCGCGAGCAGCGGGGCGCGGG - Intergenic
905584299 1:39105215-39105237 GGCTGCGGCCGGCTGGGCCCGGG - Intronic
905803762 1:40861873-40861895 GCCCGCGGCCGGCGGAGGCACGG + Exonic
905912211 1:41662575-41662597 GGCAGCCGCCAGCCGCGCCCGGG - Intronic
906197088 1:43936152-43936174 GGCTGCGGGGCGCGGAGCCCAGG - Exonic
906345510 1:45012100-45012122 GGCAGCAGCCAGGGCAGCCCTGG + Intergenic
907278079 1:53327920-53327942 GGGCGCGGCGGCCGGAGCCCCGG - Exonic
907281633 1:53350814-53350836 GGCCTCAGCCACCGCAGCCCAGG + Intergenic
907767072 1:57422944-57422966 GGACGCAGCCAGCGGAGGCAGGG + Intronic
908977758 1:69919693-69919715 GGCCAAGGCCAGGGGAGACCTGG + Intronic
910678976 1:89843486-89843508 CGCCACGGCCAGGGGAGCGCTGG + Intronic
911731225 1:101294172-101294194 GGCCGAGGCAAGTGGATCCCTGG + Intergenic
912353482 1:109036599-109036621 GGCCGAGGCAAGCGGATCACGGG + Intronic
912486679 1:110034735-110034757 CGCGGCGGCCCGCGGTGCCCCGG - Exonic
913109111 1:115642050-115642072 GACCGCGGGCCGCGGAGCTCGGG + Exonic
914754244 1:150553913-150553935 GGCCGAGGCCAGCAGGGCCAAGG + Exonic
914962702 1:152220373-152220395 GGCCGCGGCCAACACAGCTCTGG - Exonic
915462159 1:156076746-156076768 GGGGGCGGCCTGCGGAGCCCCGG - Exonic
916053026 1:161049229-161049251 GCCTGGGGCCAGCGGAGTCCAGG + Exonic
916233300 1:162561488-162561510 GGCCGCGGCCCGGGGCGCCGGGG - Intronic
918064340 1:181089349-181089371 GGCGGCGGCCAGAGAAGCCGAGG + Exonic
918487560 1:185045611-185045633 GGCCGCGGCCAGCGGAGCCCTGG + Exonic
919809397 1:201399330-201399352 GGCGGCGGCCGGCGGGGCGCGGG - Exonic
919822862 1:201483888-201483910 GGCTGCGGCCAGCAGAGCCCAGG - Exonic
921629155 1:217413006-217413028 GGCCGAGGCAGGCGGAGCCCAGG - Intergenic
923200194 1:231703942-231703964 GGCAGCAGCCAGCCAAGCCCTGG + Intronic
923372728 1:233328664-233328686 GGCCGCTGCCAACGCCGCCCCGG + Exonic
924325439 1:242890453-242890475 GGCGGCGGCCAGTGGGGCTCCGG + Intergenic
1062848398 10:725502-725524 GGCCGACGCCAGCCCAGCCCCGG - Intergenic
1062854593 10:773658-773680 GGCAGCGGCCAGCCTTGCCCTGG + Intergenic
1066537853 10:36410958-36410980 GGCTGCAGCCAGAGAAGCCCAGG - Intergenic
1066644802 10:37595605-37595627 GGCTGCAGCCAGAGGAGGCCAGG - Intergenic
1067375844 10:45727254-45727276 GGCCGAGGACCGCAGAGCCCCGG - Exonic
1070570710 10:77637922-77637944 GCTCGGGGCCAGCGCAGCCCGGG - Intronic
1070793496 10:79203509-79203531 GGCCCCTGCCAGCTGAGCCAAGG - Intronic
1071532434 10:86400481-86400503 GGCGGCGGCGAGCCGAGACCAGG - Intergenic
1071568673 10:86684693-86684715 GGCCCCGGCCAGCCTGGCCCTGG - Intronic
1071579370 10:86756187-86756209 CGCTGCGGCCATCGGCGCCCTGG - Intergenic
1071695456 10:87864168-87864190 GCCGGCGGCCTCCGGAGCCCGGG - Exonic
1073058113 10:100715048-100715070 GGCCCTGGCCAAAGGAGCCCTGG - Intergenic
1074055972 10:109923253-109923275 GGCCGCGCTCGCCGGAGCCCCGG - Intronic
1074151432 10:110763044-110763066 GGCTGAGGCCAACGGAGCCTGGG + Intronic
1075144604 10:119872594-119872616 GGCCGGGGCCGGCGAAGACCGGG + Exonic
1075616005 10:123891462-123891484 CGCCGCTGCCTGCGGGGCCCGGG - Exonic
1075866017 10:125719833-125719855 GGCCCCGGCCGGCGGACCCTCGG - Exonic
1076049351 10:127320415-127320437 GGCCGCGCTCAAGGGAGCCCTGG - Intronic
1076554177 10:131311423-131311445 GGCCGCGGGCGGCGGGGCCGAGG + Exonic
1076726855 10:132417997-132418019 GGCCCCGCCCAGCAGTGCCCAGG - Intergenic
1077016377 11:400747-400769 GGCCGGGGTCAGCGGGGCCGGGG - Intronic
1077016825 11:401827-401849 GGCCGGGGTCAGTGGAGCCGGGG - Intronic
1077016857 11:401897-401919 GGCCGGGGTCAGTGGAGCCGGGG - Intronic
1077016901 11:401990-402012 GGCCGGGGTCAGTGGAGCCGGGG - Intronic
1077016933 11:402060-402082 GGCCGGGGTCAGTGGAGCCGGGG - Intronic
1077016965 11:402130-402152 GGCCGGGGTCAGTGGAGCCGGGG - Intronic
1077016995 11:402199-402221 GGCCGGGGTCAGTGGAGCCGGGG - Intronic
1077017027 11:402269-402291 GGCCGGGGTCAGTGGAGCCGGGG - Intronic
1077017071 11:402362-402384 GGCCGGGGTCAGTGGAGCCGGGG - Intronic
1077017103 11:402432-402454 GGCCGGGGTCAGTGGAGCCGGGG - Intronic
1077017135 11:402502-402524 GGCCGGGGTCAGTGGAGCCGGGG - Intronic
1077053150 11:576697-576719 GCCCGCGGCCAGCGCGGCGCAGG - Intronic
1077142462 11:1030581-1030603 GTCCGCCGCTGGCGGAGCCCCGG - Exonic
1077173895 11:1180177-1180199 GGCCACAGGCGGCGGAGCCCAGG - Intronic
1077211664 11:1373937-1373959 TGCCGAGGCCACAGGAGCCCAGG - Intergenic
1077214625 11:1390249-1390271 GGCGCCGGCCAGGGGCGCCCGGG - Intronic
1077419828 11:2444964-2444986 GGCCGCTGCCGGCCCAGCCCGGG - Intronic
1079131163 11:17747663-17747685 GGCCCCAGCCAGCTGAGCTCAGG + Intronic
1080037261 11:27722527-27722549 AGCCGCGGAGAGCGGAGCCGCGG + Intergenic
1081705704 11:45180986-45181008 GGGTGTGGCCAGCGGGGCCCCGG + Intronic
1081793539 11:45804990-45805012 AGCAGCGGGCAGCGGAGCGCAGG + Exonic
1082076760 11:47980955-47980977 GGCAGCGCCCAGCGCAGCCCGGG - Exonic
1083389486 11:62337552-62337574 GTCCGCGTCCTGCGGTGCCCTGG + Exonic
1083665011 11:64269496-64269518 GCCCGGGGCCAGCGCCGCCCGGG - Intergenic
1083811371 11:65108616-65108638 GGCAGCGGCCAGCAGGGCCCCGG - Exonic
1083970356 11:66070535-66070557 GGCAGCGGCCAGCGGGGATCCGG + Exonic
1084146187 11:67266543-67266565 AGCGGCGGCGAGCGGAGCCGCGG + Exonic
1084351944 11:68608423-68608445 GGCTGCAGCCTGCGGGGCCCTGG + Intronic
1084871738 11:72103156-72103178 GGCCGCGGCAGGCGGGGCTCGGG - Intronic
1084888477 11:72224987-72225009 GGCCTCGGCCTGCGGGGCGCCGG + Exonic
1085312675 11:75525636-75525658 GGCCGGGACGCGCGGAGCCCCGG - Exonic
1086322372 11:85664490-85664512 GGCCCCGGCGAGCTAAGCCCGGG + Exonic
1089066833 11:115668613-115668635 GGCCGAGGCCGGCGGATCACGGG - Intergenic
1089224932 11:116911032-116911054 GGCTGAGGCCAGAGGATCCCTGG + Intronic
1089442721 11:118530607-118530629 GGCGGGGGTCAGCGGAGGCCAGG - Intronic
1090238403 11:125165539-125165561 GGCCGCGGCCTGGGGAGGCAGGG + Intronic
1091550226 12:1530811-1530833 GGGGGCGGCCGGCGGGGCCCGGG - Intronic
1095926260 12:47582675-47582697 GGCCGAGGCCACTTGAGCCCAGG - Intergenic
1096102471 12:48978234-48978256 GTCCGCGGCCAGTGCAGGCCCGG + Intergenic
1096133985 12:49184332-49184354 GGCCGAGGCAAGCGGATCACTGG + Intergenic
1096191574 12:49623453-49623475 GGCGGGAGCCACCGGAGCCCCGG + Exonic
1096529331 12:52233371-52233393 CGCCGGGGCGAGCGGAGCTCAGG - Exonic
1096622688 12:52874336-52874358 GGGCGCGGCCGGCGCCGCCCTGG - Intergenic
1096636534 12:52963746-52963768 GGCCGAGGCAAGCGGATCACTGG + Intergenic
1097121577 12:56737011-56737033 GGCCGAGGCAAGAGGAGCCTAGG - Intronic
1097180347 12:57168266-57168288 GGCTGGGGCCAGCTGAGCTCTGG - Intronic
1097227672 12:57488138-57488160 GGCCGCCGCCGGGAGAGCCCGGG + Exonic
1097830728 12:64222046-64222068 GGCCGCGGCCAGGTGCGCCAAGG + Exonic
1097981443 12:65741452-65741474 TGCCGCGGCGGCCGGAGCCCGGG + Intergenic
1098161031 12:67648632-67648654 GGCCGCGGCCGGGGGAGCCGGGG + Intronic
1102197273 12:111034367-111034389 GGCAGCGGGCGGCCGAGCCCCGG - Intronic
1102256606 12:111418826-111418848 GGTCGGGGCCATCGGGGCCCGGG - Exonic
1102518474 12:113465296-113465318 GGCCGCGGCCCGCGGCGAGCCGG + Intronic
1103377636 12:120469328-120469350 GGCCGGGGGGAGGGGAGCCCTGG + Intronic
1103817108 12:123667205-123667227 GGCCGAGGCAAGAGGAACCCAGG - Intergenic
1104900289 12:132186371-132186393 GGCTGCGGTCAGCTGAGCCCTGG + Intergenic
1105327295 13:19382287-19382309 CGCAGAGGCCAGCAGAGCCCGGG - Intergenic
1106517150 13:30465343-30465365 GGCGGCGGCCAATGCAGCCCGGG + Intronic
1107467571 13:40664895-40664917 GGCCACCGCCTGCGGAGCGCCGG - Intronic
1108688986 13:52846036-52846058 GGCGGCGGGCGGCGGAGCCTCGG - Exonic
1112692882 13:101916634-101916656 GGCCGCGGCCATGGTGGCCCCGG + Intronic
1113643629 13:111976371-111976393 GGCGGCGGCCCGCGGTGCCAGGG + Intergenic
1113757055 13:112819848-112819870 GGACGCGCCCAGCGGCCCCCGGG - Intronic
1113788104 13:113013455-113013477 GGCCGCAGCCAGCACGGCCCAGG + Intronic
1115119857 14:29927136-29927158 GCTGGCGGCCAGCCGAGCCCCGG + Intronic
1116657929 14:47674751-47674773 GGCGGCGGCGAGCGGAGCGCAGG + Exonic
1117478214 14:56118440-56118462 GGCCGCGGCGCGCGGAGCTCCGG + Exonic
1117545906 14:56794736-56794758 GGCGGCGGCCGTCGGAGGCCTGG + Intergenic
1117680680 14:58200076-58200098 GGCCGCGGCGCGCCGGGCCCGGG - Intronic
1118796702 14:69151756-69151778 CGCCGCGGCCCGCGGGGCCCGGG + Intronic
1119438505 14:74612724-74612746 GGGCGCGGCGCGCGGAGCGCAGG + Intergenic
1119808616 14:77498678-77498700 GGCCGTGGTCCGCGGAGCCGCGG + Exonic
1121535204 14:94686328-94686350 GGCCTCTGCCTGAGGAGCCCTGG + Intergenic
1121535721 14:94689608-94689630 GGCCCCGGCCAGCCGCGCCCAGG - Intergenic
1122079120 14:99254631-99254653 GGCCGGGGCCAGCGAGGCCCTGG + Intronic
1122124207 14:99570477-99570499 GGCAGGGGCCAGAGGGGCCCAGG + Intronic
1122130845 14:99604017-99604039 GGACCGGCCCAGCGGAGCCCCGG - Exonic
1122178513 14:99938073-99938095 GGCCACGGCCAGGCAAGCCCAGG - Intronic
1122418192 14:101560395-101560417 TGCCTCGCCCAGCGCAGCCCCGG - Intergenic
1122789766 14:104179258-104179280 GGCTGCGGCTGGCGGAGCGCAGG + Exonic
1122917432 14:104865524-104865546 GGCCGCGGCCAGCGCTGGGCCGG - Intronic
1122959627 14:105088451-105088473 GGCCCCAGCCAGCGGGGCCGAGG + Intergenic
1123752908 15:23372581-23372603 GGCCGAGGCCCGCGGATCACCGG + Intergenic
1124109590 15:26773341-26773363 GGACGCTGCGAGCGGAGCCGCGG + Intronic
1124789955 15:32718084-32718106 GGCCGCGGCCAGAGCCGCCGGGG - Exonic
1125329032 15:38564616-38564638 GGCCGCGGCCATGGGCACCCTGG - Exonic
1125606376 15:40941964-40941986 GGCCGCGGGAAGCGGAGCCGCGG + Intergenic
1125742126 15:41972564-41972586 GGCGGCGGCCAGCGCGGCCGGGG - Exonic
1128054984 15:64692666-64692688 GGCTGAGGCCAGCGGATCACTGG - Intronic
1128156713 15:65396057-65396079 AGCCGCGGCCAGCGCTGCGCTGG - Exonic
1128211966 15:65909281-65909303 GGCCAGGGCCAGCGGGGCCAGGG + Intronic
1128980015 15:72179238-72179260 GGCCACAGCCAGCGGAACCATGG + Intronic
1129304058 15:74645777-74645799 GGCTGAGGTCAGGGGAGCCCAGG + Intronic
1129540249 15:76342555-76342577 GCCCGCAGCACGCGGAGCCCCGG - Intergenic
1130076572 15:80695226-80695248 GGGCGCGGCGCTCGGAGCCCGGG - Intronic
1130332878 15:82935064-82935086 GGCGGGGGGCAGAGGAGCCCAGG - Intronic
1130671158 15:85914084-85914106 GGCCGAGGCAAGCGGATCACTGG - Intergenic
1130967093 15:88705539-88705561 GGCCGCTGGCAGCGGGACCCAGG + Intergenic
1131992397 15:98104518-98104540 GTGCGAGGCCAGCCGAGCCCAGG + Intergenic
1132314519 15:100880095-100880117 GGCGGCGCCCGGCGGACCCCCGG - Intronic
1132466184 16:78312-78334 GCCCGCGCGCAGCGGGGCCCAGG + Exonic
1132503866 16:297253-297275 AGCCTCGGCCACCGGAGGCCAGG - Intronic
1132558242 16:582133-582155 GGCCACGGCCAGCAGCACCCGGG + Intronic
1132573858 16:655963-655985 GGCGGCTGACAGCAGAGCCCCGG - Intronic
1132837057 16:1959451-1959473 GGCCGCGCCCGGCGGAGCCGGGG + Intergenic
1132897712 16:2236827-2236849 GAGTGCGGCCAGCAGAGCCCGGG - Exonic
1133053759 16:3134594-3134616 GGCCGCGGGCCGTGGAGCTCGGG - Intronic
1133060304 16:3170603-3170625 GGCTGCGGCCACCGGGTCCCCGG + Intergenic
1133325142 16:4937412-4937434 GGCCTCGGCCAGAGGCGCGCCGG - Intronic
1133767655 16:8849057-8849079 GTCTGGGGCCAGGGGAGCCCAGG + Exonic
1133801702 16:9090711-9090733 GGCGGCCGCCCGCGGAGCCAAGG - Intergenic
1135607327 16:23836014-23836036 GGCCGCGGCGCGCGGAGCCGGGG - Exonic
1135745801 16:25015274-25015296 GGCGGCGGCCCGCGGGGCTCGGG + Exonic
1136008241 16:27345733-27345755 GGCCGAGCCCAGCGGATCACCGG + Intronic
1136110965 16:28063504-28063526 GGCCGCTGCCCGCCGCGCCCCGG + Exonic
1138178738 16:54928881-54928903 GGCTGCGGCGGGCGGAGCCGGGG + Intergenic
1138442355 16:57042632-57042654 GGCCAAAGCCAGAGGAGCCCAGG + Intronic
1138619066 16:58197703-58197725 GGCCGCGGGCAGCAGGGCCCGGG - Exonic
1139474836 16:67197955-67197977 GGCTGCTGCTAGGGGAGCCCTGG + Intronic
1139705315 16:68737255-68737277 GGCTGCAGCCAGGTGAGCCCCGG - Exonic
1139719844 16:68843632-68843654 GGCCGTGGGCAGCGGGGCTCAGG + Exonic
1140528998 16:75648082-75648104 GGCCTCGGCCAGCGCCTCCCCGG - Exonic
1141002265 16:80319146-80319168 GGGCTCGGCCAGGGGGGCCCAGG - Intergenic
1141039938 16:80664407-80664429 GGCCCAGGACACCGGAGCCCTGG - Intronic
1141673261 16:85503985-85504007 GGCGGTGGTCACCGGAGCCCGGG + Intergenic
1141689041 16:85586329-85586351 TGCCTCGGACGGCGGAGCCCTGG + Intergenic
1141898496 16:86974244-86974266 GGCGGAGGCCAGCTGAGGCCAGG + Intergenic
1142120330 16:88383627-88383649 GGCTGCGGGGAGCGGGGCCCGGG + Intergenic
1142418198 16:89954450-89954472 TGCCGCGTCCTGCGCAGCCCTGG + Intronic
1142637755 17:1268504-1268526 GGCCGCGCCCCGCAGCGCCCGGG + Intergenic
1142708453 17:1710442-1710464 GGCCGCCGCCCCCGGAGCCTTGG + Intergenic
1142746077 17:1959056-1959078 GGGGGAGCCCAGCGGAGCCCAGG - Intronic
1143012986 17:3876456-3876478 GGTCCTGGCCAGCGGTGCCCAGG - Intronic
1143096610 17:4481600-4481622 GGCAGAGGGCAGCAGAGCCCAGG + Intronic
1143103165 17:4515021-4515043 GGTCGGGGCCAGCACAGCCCAGG + Intronic
1143116634 17:4584993-4585015 GGCCGCGGCCAGGTGAGCCCGGG + Exonic
1143899501 17:10163359-10163381 GGCCGAGGCAAGCGGATCACTGG - Intronic
1144340256 17:14304078-14304100 TGCAGCGGACAGCGCAGCCCGGG + Intronic
1144953165 17:19004673-19004695 GGCCGCGCCCCCCGGATCCCGGG - Intronic
1147123713 17:38351965-38351987 GGCCGCGGCGGGCGGGGCTCCGG + Intergenic
1147623298 17:41882732-41882754 AGCCCCGCCCAGCTGAGCCCAGG + Intronic
1147648881 17:42050709-42050731 GGGCGCGGCCAGGTGAGCCCCGG - Intronic
1147788976 17:43001106-43001128 GGCCGAGGCGAGCGGATCACAGG + Intronic
1147819675 17:43234271-43234293 AGTCGCCCCCAGCGGAGCCCCGG - Intergenic
1147820984 17:43241668-43241690 AGTCGCCCCCAGCGGAGCCCCGG - Intergenic
1147821791 17:43246158-43246180 AGTCGCCCCCAGCGGAGCCCCGG - Intergenic
1147822883 17:43252313-43252335 AGTCGCCCCCAGCGGAGCCCCGG - Intergenic
1147825401 17:43267117-43267139 AGTCGCCCCCAGCGGAGCCCCGG - Intergenic
1147826524 17:43273584-43273606 AGTCGCCCCCAGCGGAGCCCCGG - Intergenic
1147827413 17:43278462-43278484 AGTCGCCCCCAGCGGAGCCCCGG - Intergenic
1147828521 17:43284623-43284645 AGTCGCCCCCAGCGGAGCCCCGG - Intergenic
1147829630 17:43290775-43290797 AGTCGCCCCCAGCGGAGCCCCGG - Intergenic
1147831407 17:43300525-43300547 AGTCGCCCCCAGCGGAGCCCCGG - Intergenic
1148749113 17:49934667-49934689 GGCTGTGGCCAGCAGAGCTCAGG + Intergenic
1148880149 17:50719482-50719504 GGGCGGGGCCCGCGGAGGCCGGG - Intergenic
1148945758 17:51260493-51260515 GGCCGCCGCCGCCGAAGCCCCGG - Intergenic
1149678499 17:58487738-58487760 CGCCGCCGCCCGCGGGGCCCCGG - Exonic
1150819904 17:68426768-68426790 GGCTGAGGCCAGCGGATCACTGG - Intronic
1151854306 17:76710546-76710568 GGCAGCGGCAGCCGGAGCCCCGG + Intronic
1151854401 17:76710784-76710806 GGCCGAGGCCACCGGGGCCCCGG - Exonic
1152782053 17:82231018-82231040 CACCGGGGTCAGCGGAGCCCGGG - Intronic
1153040896 18:812286-812308 GGCCGAGGCGTGGGGAGCCCGGG - Intronic
1153855090 18:9137213-9137235 GGCGGCGGCGGGCGGGGCCCCGG - Intronic
1154172183 18:12060412-12060434 GGCCGTGGGCAGTGTAGCCCCGG - Intergenic
1156350572 18:36298089-36298111 GGCCGCGCCCAGCCCAGCCCAGG - Intronic
1157496718 18:48161845-48161867 GGCCGCGGGGAGGGGCGCCCGGG - Intronic
1158236589 18:55322565-55322587 GGCCGGGGCCCGCGGAGCCCGGG - Intronic
1160387678 18:78506247-78506269 GGCCGCGGCACACGGAGCTCGGG - Intergenic
1160500641 18:79399884-79399906 GTGCGCGCCCTGCGGAGCCCCGG - Intronic
1160763759 19:798106-798128 GGCCGCGGCCCGGGGCGCACGGG - Intronic
1160818516 19:1047276-1047298 GGCTGCGGCCTGCGGCGGCCTGG + Exonic
1160862161 19:1242022-1242044 GGCCGCCGCCCCCGGAGTCCAGG + Intronic
1161201796 19:3019326-3019348 AGCCGCCGCCAGCTGAGCCTGGG + Exonic
1161596809 19:5154716-5154738 GGCCGCGTCCCCCCGAGCCCTGG - Intergenic
1162742818 19:12783071-12783093 AGCTGCGGCCAGGGGACCCCCGG - Intronic
1162778702 19:12995784-12995806 GGCCGCGGCGAGGGGAGGCCCGG - Exonic
1162781366 19:13008617-13008639 GGGCAGGGCCAGCGGAGACCTGG - Intronic
1162982699 19:14249281-14249303 GGCCGCAGACAGCGGGCCCCAGG - Intergenic
1163026842 19:14517778-14517800 GGCCGAGCCCAGGTGAGCCCGGG + Intronic
1163094172 19:15043702-15043724 GGCCGAGGCCAGCGGATCATTGG - Intergenic
1163364875 19:16870261-16870283 TGCCACGGCCAGGGGAGCCTGGG - Intronic
1163453743 19:17394059-17394081 GGCAGCAGCCGGCGGGGCCCTGG - Intergenic
1163530658 19:17847131-17847153 GGCTGAGGCCAGCGGATCACTGG - Intronic
1163577175 19:18117823-18117845 GGCCGCGGGCGGCTGAGGCCGGG - Intronic
1163774817 19:19211945-19211967 CGCTGGGGCCAGCGGAGCGCAGG + Intergenic
1164813380 19:31175757-31175779 GGAGGCGGCCAGTGGGGCCCTGG + Intergenic
1165848433 19:38834430-38834452 GGCCGAGGCCAGTGGATCTCAGG + Intronic
1165961639 19:39539845-39539867 GGCGGCAGCCAGGGGAGCCCCGG - Exonic
1165961649 19:39539869-39539891 GGCGGCGGCCAGGGCAGCCCCGG - Exonic
1165961666 19:39539917-39539939 GGCGGCGGCCAGGGGAGGCCCGG - Exonic
1166602050 19:44104948-44104970 CACCGCGCCCAGCCGAGCCCTGG + Intronic
1166750598 19:45162454-45162476 GGCAGCGGGCGGCGAAGCCCAGG + Intronic
1167096145 19:47375965-47375987 GGCCGCTGCCAGCTCAGCCCAGG + Exonic
1167303368 19:48692891-48692913 GGCTGAGGCAAGAGGAGCCCAGG - Intergenic
1167344441 19:48936459-48936481 GGCCGAGGCGGGCGGAGCACGGG + Intronic
1168100394 19:54138248-54138270 GGCGGCGGCGGGCGGGGCCCGGG - Intronic
1168529863 19:57119128-57119150 TGCCTGGGCCAGCGAAGCCCAGG - Intronic
926251552 2:11157863-11157885 GGCAGAGCCCAGCAGAGCCCTGG - Intronic
926580952 2:14632755-14632777 CGCCCCGGCCAGCGCAGACCTGG + Exonic
927714285 2:25342108-25342130 GGCCGGGGCCAGCGCGGCCGCGG - Intronic
927720273 2:25377878-25377900 GCCCCCGGCCAGCAGAGCGCAGG + Intronic
927935114 2:27071899-27071921 GGACGCGGCTAGCGAAGCCGTGG + Intergenic
928668172 2:33572423-33572445 GGCCAAGGCAGGCGGAGCCCAGG - Intergenic
929033809 2:37672180-37672202 CTCCGCGCCCACCGGAGCCCGGG - Exonic
930198380 2:48530373-48530395 GGCCGCCCCCAGGGGCGCCCTGG + Intronic
931907890 2:66862438-66862460 GGCCGAGGCCGGCGGATCACGGG - Intergenic
932073592 2:68643888-68643910 GGCCGCAGCCAGTGCAGCGCGGG - Intronic
933278235 2:80304664-80304686 GGGAGCGGCGAGCGGCGCCCGGG + Exonic
934713869 2:96532037-96532059 GGGCCCTGCCAGCTGAGCCCTGG - Intergenic
936341568 2:111638316-111638338 GGCCCAAGCCAGCAGAGCCCTGG + Intergenic
936671447 2:114662024-114662046 GGGCGCGGCCTGGAGAGCCCGGG - Intronic
937995985 2:127695536-127695558 GCCCGCGGCCGGCGGGGTCCCGG + Intergenic
941104909 2:161341164-161341186 GGCCGAGGCCACCGGGGCCCCGG - Intronic
941666231 2:168246785-168246807 GGACGCGGCCCCCGGGGCCCTGG + Intronic
942450793 2:176107006-176107028 GACAGCGGCCAGCGGCGCGCAGG + Intronic
942748578 2:179264187-179264209 GGCCGCGGCCCGCAGAGACCGGG - Intronic
945699424 2:213151751-213151773 GGCGGCGGGCAGCGGAGCCCCGG + Intronic
947992154 2:234496674-234496696 GGCGGCGGCGGGCGGGGCCCAGG - Exonic
948116018 2:235494605-235494627 GCCCGCGGGCCGCCGAGCCCGGG - Exonic
948598064 2:239093076-239093098 GGCCTCGCCCAGCGGAGTCCTGG - Intronic
948645314 2:239400676-239400698 CGCCGCGGTAAGCGCAGCCCCGG - Exonic
949014494 2:241701890-241701912 GGCGGCGGGCTGCGGGGCCCGGG - Intergenic
949018209 2:241725422-241725444 GGGCGGGGCACGCGGAGCCCGGG - Exonic
1168992029 20:2103133-2103155 GGCCGGGCGCAGCGGGGCCCGGG + Exonic
1169213073 20:3778368-3778390 GCTCGCGGCCAGCAGAGGCCGGG - Intronic
1170150477 20:13221635-13221657 GGGCCCGGGAAGCGGAGCCCTGG + Intergenic
1171351312 20:24505267-24505289 GTGCGCAGCCAGGGGAGCCCTGG + Intronic
1172181890 20:33008556-33008578 GGCAGCGGCCAGGGCAGCCATGG + Exonic
1172516954 20:35541868-35541890 CGCCCCGGACAGCGGAGGCCGGG + Intergenic
1172528583 20:35616110-35616132 GGCTCCGGTCAGCGGAGCCCGGG + Exonic
1173704167 20:45097992-45098014 GCCCGCGGCCACCGCAGCCACGG + Exonic
1175777073 20:61660118-61660140 GGCTGCGGCCGGCTGAGCCTTGG + Intronic
1175911486 20:62407246-62407268 GGCCGCGGCCGGTGGAGCCCCGG - Exonic
1175913812 20:62416515-62416537 GGCCGCGCCCAGTGGGGGCCGGG + Intronic
1175984818 20:62759368-62759390 GGCCGGGACCAGCCAAGCCCTGG + Intronic
1176062586 20:63178845-63178867 GGCTGCGGCCAGCCGGCCCCCGG + Intergenic
1176143285 20:63554303-63554325 GGCCCGGGCCAGGGGAGCCAAGG + Exonic
1176214338 20:63941190-63941212 TGCCGAGGCCAGCGCAGCCCTGG + Exonic
1176857066 21:13981612-13981634 GGCCGCGGGCAATGTAGCCCCGG + Intergenic
1176867535 21:14062615-14062637 GGCCGCGGGCAATGTAGCCCGGG - Intergenic
1176867553 21:14062688-14062710 TGCTGCGGGCAGCGCAGCCCGGG - Intergenic
1177836742 21:26193140-26193162 GGCTGAGGCCAGAGGAGCCCTGG + Intergenic
1178707639 21:34888810-34888832 GGCGGCGGCGAGCCGCGCCCTGG - Intronic
1179209482 21:39313348-39313370 GGACGGGGCCAGGGGAGCCGGGG + Intronic
1179880710 21:44292352-44292374 AGCCCCGGGCAGAGGAGCCCCGG + Exonic
1181002802 22:19995771-19995793 GGGGGGGGCCAGCGCAGCCCTGG - Intronic
1182365210 22:29774209-29774231 GGCCGAGGCAGGAGGAGCCCAGG - Intergenic
1182668213 22:31974137-31974159 GGCCGAGGCCAGCGGATCACCGG + Intergenic
1182696652 22:32203188-32203210 TGCCACGGGCAGCGCAGCCCGGG + Exonic
1182715451 22:32353748-32353770 TGCCGCGGGCAGTGCAGCCCGGG + Intergenic
1183050688 22:35258006-35258028 GGCCGCGGCCACGGGAGGGCTGG + Intronic
1183552489 22:38498787-38498809 GGCTGAGGCCAGTGGAGGCCAGG + Intronic
1183649406 22:39145535-39145557 CGCCGCGGTCCGCGCAGCCCAGG - Intronic
1183665569 22:39244121-39244143 GGCCGGGGGCGGCGGCGCCCGGG - Exonic
1183702294 22:39457424-39457446 AGCCGCTGCCGCCGGAGCCCGGG + Exonic
1183743146 22:39679355-39679377 GCCCTCGGCCAGGGGCGCCCGGG - Exonic
1184164789 22:42720817-42720839 GGCGGCGGACAGCGGGGCCCCGG + Intronic
1184281485 22:43440061-43440083 AGCGCCAGCCAGCGGAGCCCTGG + Intronic
1184557432 22:45240916-45240938 GGGCGGGGCGAGCGGAGCCGGGG - Intergenic
1184668247 22:45999762-45999784 GGACGCGCCCACCGGAGCCTGGG - Intergenic
950686509 3:14622145-14622167 GGCCTGGGCCTGCGGCGCCCTGG - Intergenic
953412975 3:42700739-42700761 GGCCCCGGCCAGCATAGGCCAGG + Exonic
956179132 3:66501095-66501117 GGCCGCGGAGCGCGGAGCCTAGG - Intronic
958814517 3:98901373-98901395 TGCCGCGGCCAGAGGCGCGCGGG - Exonic
961779814 3:129314971-129314993 GGCCTCGGCCATCGGCGCCTAGG + Exonic
965648346 3:170908348-170908370 GGCCGGGCCGAGCTGAGCCCTGG - Intronic
966898967 3:184466706-184466728 GGCCGGCCCCAGGGGAGCCCTGG - Intronic
968382420 4:107837-107859 GTCCGCGGCGTGCGGGGCCCTGG + Intergenic
968441530 4:626862-626884 GGCAGCGGCCAGCAGAGACCTGG + Intronic
968568688 4:1328212-1328234 AGCTGAGGCCAGCGGCGCCCTGG + Intronic
968679428 4:1906473-1906495 GGCCGAGGCAAGCGGATCACTGG - Intronic
968756458 4:2418627-2418649 GGCCGTGACCAGCGGAGCGCTGG - Exonic
968803204 4:2756338-2756360 GGCGGCAGCCGGCGGGGCCCGGG - Exonic
968900982 4:3431677-3431699 GGCCACGGCCCTCGGACCCCTGG - Intronic
969100488 4:4764697-4764719 TGCCGTGGCCGGCGGTGCCCTGG + Intergenic
969343291 4:6555900-6555922 GGCAGTGGCCAGCTCAGCCCTGG + Intronic
972029022 4:34428746-34428768 GGCCTCTGCCAGCAGAGCCTTGG - Intergenic
972739876 4:41879159-41879181 GGCCAGGGCCAGCGGGGCGCGGG - Intergenic
982042291 4:151408672-151408694 GACGGCGGCCACCGGCGCCCCGG - Intergenic
985517623 5:354975-354997 GGCTGCGGCCAGCCGGGACCCGG - Intronic
985805249 5:2038780-2038802 GGCAGCGGACGGCGGCGCCCAGG + Intergenic
985895487 5:2748315-2748337 GCCCGCGGCCGGCGGCGCCCGGG - Intronic
986860203 5:11918641-11918663 GGGCGCGGCCAGTGCAGCTCTGG - Intergenic
987015085 5:13810093-13810115 TGCCGCCGCCAGCGGGGCCCGGG - Exonic
987132341 5:14871555-14871577 GGCCGCGGGCGGCGGGGCCTCGG + Exonic
992118429 5:73565269-73565291 ATCCGCGGCGAGCGGATCCCGGG + Exonic
993149075 5:84136760-84136782 GGCCTCAGCAAGAGGAGCCCAGG - Intronic
997965483 5:138352888-138352910 GGCAGCGGCGAGCGGAGATCCGG + Exonic
998137840 5:139683772-139683794 GGCCGTGGGCAGGGGGGCCCAGG - Exonic
1001726326 5:173904868-173904890 GGCCGAGGCCAGAGGATCACTGG + Intronic
1002046284 5:176543344-176543366 GGCCGCGGCAGGCGGCGCGCGGG - Intronic
1002164093 5:177333906-177333928 GGCAGTGGCCAGCAGAGCCAGGG - Intronic
1002580927 5:180209099-180209121 GGCGGCGGCGGGCGGCGCCCCGG - Intronic
1002590981 5:180291727-180291749 GGCCGGGGGCTGCGGGGCCCTGG - Intronic
1003872368 6:10412977-10412999 AGCCGGTGCCAGCGGCGCCCGGG - Intronic
1003988989 6:11467088-11467110 GGCCGAGGCCGGCGGATCACTGG - Intergenic
1004861008 6:19804788-19804810 GGCCGGCGCCAGCGGAGCGGGGG + Intergenic
1006422889 6:33946452-33946474 GGCAGCAGCCTGAGGAGCCCTGG - Intergenic
1006582229 6:35083736-35083758 GTGTGCGGCCAGTGGAGCCCAGG - Intronic
1007557789 6:42781910-42781932 GGGCGCGGGGAGCGGCGCCCCGG + Intronic
1008030314 6:46687819-46687841 GGGCGGGGCCAGCCGAGGCCTGG - Intergenic
1011075081 6:83430731-83430753 GGCCGCGGCCTGGGGGGCCTTGG - Intronic
1011195312 6:84774293-84774315 GGCCGCGTCCCGGGGAGCCTGGG + Intergenic
1014057252 6:117030559-117030581 GGCCCAGGCCAGCCCAGCCCTGG + Intergenic
1016743623 6:147554419-147554441 GGTCGTGGCCAGTGGAGGCCAGG + Intronic
1019179673 6:170178383-170178405 GGCCACGGGCAGGGCAGCCCAGG + Intergenic
1019279652 7:193364-193386 GGCCGCGCCCGGCTGGGCCCAGG + Exonic
1019491586 7:1316291-1316313 GGCAGCGGCCGGAGAAGCCCAGG + Intergenic
1019705273 7:2494479-2494501 AGCCGTGGCCAGCAGAGACCCGG - Intergenic
1021106559 7:16645461-16645483 GGCCGCGGCCAGCCTGGCCGGGG - Intronic
1021452775 7:20798055-20798077 GCCCGCGGCCGCCGCAGCCCGGG - Intergenic
1022108417 7:27213303-27213325 GCCCGCGGCCCTCGGAGGCCGGG + Intergenic
1026920325 7:74150737-74150759 GGCCGAGGCCAGTGGATCACGGG + Intergenic
1028160099 7:87475693-87475715 GGCCGCGGCGAGCAAAGTCCAGG - Exonic
1029125710 7:98293945-98293967 GGCCTCGGCCTGTGGAGCCATGG - Intronic
1029640777 7:101817479-101817501 GGGCGCGGGCCGGGGAGCCCCGG - Intronic
1032344382 7:131106026-131106048 GCGCGCGGCCGGCGGTGCCCGGG - Intergenic
1032683576 7:134209491-134209513 GCCCCAGGCCAGGGGAGCCCCGG + Intronic
1033654364 7:143362808-143362830 GGCCGCGGCGAGCCGAGCCGGGG - Intergenic
1034519013 7:151604399-151604421 GGCCGAGGCAGGAGGAGCCCTGG + Intronic
1034522608 7:151632265-151632287 GGACGCGGGCAGCGGGGGCCGGG + Intronic
1035266821 7:157693701-157693723 GGCAGAGGCCAGAGGGGCCCTGG + Intronic
1035455426 7:159005936-159005958 GGCCGCAGGCACCGGAGCGCGGG - Intergenic
1035603537 8:913898-913920 GGGCACGGCCCCCGGAGCCCCGG + Intergenic
1037865784 8:22441237-22441259 GGGCGCGGCCACCGCAGCGCCGG - Exonic
1038540342 8:28385856-28385878 GGCCGCGGCGGGCGGGGCGCGGG - Intronic
1039619310 8:38982081-38982103 GGCCGAGGCAAGCGGATCACTGG - Intronic
1042059090 8:64798410-64798432 GCGCGCGGCCCGCGGGGCCCAGG + Intronic
1042216351 8:66432519-66432541 GGCCGCTGCCGCCCGAGCCCGGG + Exonic
1043052854 8:75404576-75404598 GGACGCGGCCACCGGGGCTCAGG - Intergenic
1044306453 8:90645892-90645914 GGCCGAGGCATGCGGAGCCCGGG - Exonic
1045305105 8:100951566-100951588 GATCGCGGCCGGCGGCGCCCCGG + Intronic
1046641463 8:116736424-116736446 GGCTGAGGCCAGCGGATCACGGG + Intronic
1048073351 8:131042414-131042436 GGCTGCAGCCAGTGGAGCCCGGG + Exonic
1049585220 8:143429881-143429903 CGCCGCCGCCCGCGAAGCCCGGG + Exonic
1049741995 8:144245331-144245353 GGCGGCGGCCAGAGGAAGCCAGG - Intronic
1049759561 8:144325969-144325991 GGAGGGGGCCAGAGGAGCCCAGG - Intronic
1053372726 9:37576242-37576264 GGCCGCGGCCGCCGGTGCCCTGG + Exonic
1054332818 9:63776636-63776658 GGGCGCTGCCAGGGGAGCCAAGG - Intergenic
1056642946 9:88386830-88386852 GGCCGAGGCCAGCGGATTGCTGG + Intergenic
1056991949 9:91421327-91421349 GGGCGCGGCCCGTGGAGCCCGGG - Intronic
1057168653 9:92947615-92947637 AGCCGCTTCCAGAGGAGCCCCGG - Exonic
1057279950 9:93702036-93702058 GGCCCCATCCAGCGGGGCCCTGG - Intergenic
1057379925 9:94558526-94558548 GGCCGAGGCCAGCGGATCACGGG - Intergenic
1059438132 9:114288624-114288646 GGTCGCGGCCAACAGGGCCCAGG + Intronic
1060182873 9:121546089-121546111 GTCCTCGGCCAGCTCAGCCCAGG + Intergenic
1060296541 9:122347185-122347207 CGCCGGGGTCAGCGGAGCACGGG - Intergenic
1060727699 9:126016964-126016986 GGCCCTGCCCAGGGGAGCCCTGG + Intergenic
1060983880 9:127808826-127808848 GGCAGCTGCCACAGGAGCCCTGG - Exonic
1061020507 9:128011299-128011321 GGCTGCAGCCACAGGAGCCCTGG - Intergenic
1061108851 9:128552734-128552756 GGCCCCGGGCAGCCGACCCCCGG + Intronic
1061198298 9:129120818-129120840 GGCTGCTGCCAGGGTAGCCCGGG + Intronic
1061248425 9:129413388-129413410 GGCCGCGGCGGGCGGGGGCCGGG - Intergenic
1061348236 9:130043311-130043333 GGACCCGGCCGGGGGAGCCCGGG - Intergenic
1061502953 9:131014073-131014095 GGCCAAGGCCAGCTGGGCCCAGG - Intronic
1061933802 9:133846555-133846577 GGCCGGGGCCAGGGCAGCCAGGG - Intronic
1062160185 9:135075623-135075645 CGCCGGAGCCAGCGGAGCCGGGG + Intronic
1062378765 9:136276773-136276795 GGCAGCGGCGAGGGGAGGCCGGG - Intergenic
1062381503 9:136288996-136289018 GGCAGCGGCAGGTGGAGCCCGGG + Intronic
1062451150 9:136616345-136616367 GCCAGCGGCCAGAGGACCCCGGG + Intergenic
1062525312 9:136975875-136975897 GCCCGCTGCCAGCTGAGTCCTGG - Intergenic
1062547551 9:137070449-137070471 GGCCCCGGCCATGGGCGCCCGGG + Exonic
1202799817 9_KI270719v1_random:164947-164969 GGGCGCTGCCAGGGGAGCCAAGG - Intergenic
1187900612 X:24024817-24024839 GCCGCCGGCCTGCGGAGCCCGGG - Intronic
1190618441 X:52262209-52262231 GGCCGCGGCCTGGTCAGCCCCGG - Intergenic
1191873956 X:65775219-65775241 GGCCGAGGCGAGCGGATCACGGG + Intergenic
1195716843 X:107826308-107826330 GGCGGCGGCGACCGGGGCCCGGG + Exonic
1200133739 X:153864767-153864789 GGCCCCGGCCAGCCGGGTCCAGG - Intronic
1201222952 Y:11789446-11789468 GGCGGCGGCCAGTGGGGCTCCGG + Intergenic