ID: 918487560

View in Genome Browser
Species Human (GRCh38)
Location 1:185045611-185045633
Sequence GGCCGCGGCCAGCGGAGCCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 5, 3: 42, 4: 387}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918487554_918487560 7 Left 918487554 1:185045581-185045603 CCGCGGCAGCTGATACCAGAGTC 0: 1
1: 0
2: 0
3: 9
4: 117
Right 918487560 1:185045611-185045633 GGCCGCGGCCAGCGGAGCCCTGG 0: 1
1: 0
2: 5
3: 42
4: 387
918487553_918487560 14 Left 918487553 1:185045574-185045596 CCGGCGTCCGCGGCAGCTGATAC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 918487560 1:185045611-185045633 GGCCGCGGCCAGCGGAGCCCTGG 0: 1
1: 0
2: 5
3: 42
4: 387
918487556_918487560 -8 Left 918487556 1:185045596-185045618 CCAGAGTCTTGCTCCGGCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 63
Right 918487560 1:185045611-185045633 GGCCGCGGCCAGCGGAGCCCTGG 0: 1
1: 0
2: 5
3: 42
4: 387

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918487560 Original CRISPR GGCCGCGGCCAGCGGAGCCC TGG Exonic