ID: 918490207

View in Genome Browser
Species Human (GRCh38)
Location 1:185073666-185073688
Sequence CTGTTACTTACAAGGAATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 125}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918490207 Original CRISPR CTGTTACTTACAAGGAATGC AGG Intronic
902523754 1:17040187-17040209 ATGTTACATACAAGGAAACCAGG - Intronic
905754311 1:40495623-40495645 CTTTTACTTGCAATGAATGTGGG + Exonic
910013355 1:82492313-82492335 GTGTTAGTTACAAGGAAGTCAGG + Intergenic
910045811 1:82913953-82913975 TTGATTCTTACATGGAATGCAGG - Intergenic
915459744 1:156062743-156062765 CTGCCACTTACAAGTATTGCGGG + Intronic
917383572 1:174442157-174442179 CTTTTCTTTACAAGGAATGTGGG + Intronic
918490207 1:185073666-185073688 CTGTTACTTACAAGGAATGCAGG + Intronic
924034234 1:239919814-239919836 CAGTTATTTACAAAGAATCCTGG - Intergenic
924444344 1:244115288-244115310 CTCTTTCTTACAAGCAGTGCTGG - Intergenic
1065314945 10:24454679-24454701 CAGTCACTTACAAGGAAGGAGGG + Intronic
1067558532 10:47288658-47288680 CTATTTATAACAAGGAATGCTGG - Intergenic
1068281480 10:54876448-54876470 GTGATTCTTACAAGGAATCCGGG + Intronic
1068968343 10:62936234-62936256 CTTTCACTTACAAGGAAATCTGG + Intergenic
1069884500 10:71615365-71615387 CAGTTACTTGAAATGAATGCTGG - Intronic
1071458504 10:85869534-85869556 CTGATTCTGACAAGGAAAGCTGG + Intronic
1072237616 10:93466676-93466698 CTGTTCCCTACAAGGGAGGCTGG + Intronic
1075021266 10:118954173-118954195 CTGTCACTTTCCAGGAAGGCTGG - Intergenic
1076805270 10:132853442-132853464 ATTTTGCTCACAAGGAATGCTGG + Intronic
1076934480 10:133558365-133558387 TTGGTGCTTACAAGGAATGTGGG - Intronic
1078607673 11:12791338-12791360 CTGCTGACTACAAGGAATGCAGG - Intronic
1080679959 11:34465404-34465426 CAGTTACATAAAAGGTATGCAGG - Intronic
1081296833 11:41400971-41400993 CTGTCACTCATAAGCAATGCAGG + Intronic
1091115097 11:133005313-133005335 ATGTTACTTCCAAGCAATGTGGG - Intronic
1092202226 12:6592957-6592979 CTGTCACATACAAGGAAGGAAGG + Intronic
1098795593 12:74884789-74884811 CTGTGACTTTCAAGGGATCCAGG - Intergenic
1099374704 12:81885010-81885032 ATGTTACTTATAAGGGAAGCTGG + Intergenic
1099620789 12:85000637-85000659 CTCTTATTAAGAAGGAATGCAGG - Intergenic
1100918838 12:99459073-99459095 GGGTTTCATACAAGGAATGCAGG + Intronic
1102277704 12:111596565-111596587 AACTTATTTACAAGGAATGCAGG + Intronic
1103086509 12:118065284-118065306 CTGTTGCTTTCAAAGAAGGCAGG - Exonic
1110611886 13:77497901-77497923 CTGTTATCTACAAGGAATAGAGG + Intergenic
1113451242 13:110411461-110411483 CTGTTACTTTTTAGCAATGCTGG - Intronic
1116696041 14:48179616-48179638 CTGATAATAACAAGGTATGCTGG - Intergenic
1118599028 14:67458450-67458472 CTGTTACCCACTAGGGATGCTGG - Intronic
1122551720 14:102553829-102553851 ATATTATTTAAAAGGAATGCTGG + Intergenic
1122641812 14:103164472-103164494 CTTTTACGTAAAAGGAATGTTGG + Intergenic
1123876875 15:24632241-24632263 CTGTTTCTTACAAGGAGTTCTGG + Intergenic
1125361774 15:38872181-38872203 CTGTCACTTACATGGTATTCAGG - Intergenic
1125465510 15:39947715-39947737 CTGTTCTTTACAAGGCATTCAGG + Intronic
1126176753 15:45743136-45743158 CAGTGATTTACAAGGAGTGCGGG + Intergenic
1127606725 15:60593256-60593278 CTGATACCTGCAAGGAAAGCCGG + Intronic
1131727034 15:95238002-95238024 CTGGTACTTTCAGGAAATGCTGG - Intergenic
1132387965 15:101415163-101415185 CTGTTTCTGAGAAGGAATGCTGG - Intronic
1134254401 16:12599816-12599838 CTGTTACTCACAAGGACAGGTGG + Intergenic
1138727834 16:59160248-59160270 CTGTTAGATGCTAGGAATGCAGG + Intergenic
1143056454 17:4165818-4165840 CTGTTCTTTAAAAGGAATGTGGG - Exonic
1143724941 17:8838299-8838321 CTGTTTCTGACAAGTGATGCGGG + Intronic
1144219840 17:13089812-13089834 CTTTTACTGAGAAGGAATCCTGG + Intergenic
1146073616 17:29707275-29707297 GTGTTATTTAAAATGAATGCAGG + Intronic
1147611955 17:41807103-41807125 CTGCCACTGACAAGGAAGGCAGG + Intronic
1153011374 18:542649-542671 CTGGTACTTACAAGCATTTCAGG + Intergenic
1153653185 18:7259712-7259734 CTGTTATTTGCAAGGAAAGCAGG + Intergenic
1155199129 18:23502513-23502535 CTGTTACTAGCAAGGAGTGAAGG + Intergenic
1158253758 18:55521081-55521103 TTGCTACTTACTAGGAATTCTGG + Intronic
1158479501 18:57807941-57807963 TTGTAACTTAGAAGGAATGTTGG - Intergenic
1158739035 18:60117893-60117915 CTGGTACTTCCAAGAAATGCAGG - Intergenic
1161933502 19:7356775-7356797 CTGTGACTAACAAGTCATGCAGG - Intronic
1165180509 19:33963524-33963546 CAGCTACTTAGAAGGATTGCTGG - Intergenic
926287412 2:11500700-11500722 CTGTTACTTACTAGGGAAGATGG + Intergenic
926819629 2:16838362-16838384 CTGAAATTTACAAGGAATTCTGG - Intergenic
930250244 2:49026935-49026957 TTGTTACAGACAAGGGATGCTGG - Intronic
930357743 2:50343659-50343681 GTGTCACTTACAAGGTTTGCAGG - Intronic
930974970 2:57446469-57446491 CTGTTACTAACATGTAATGGAGG - Intergenic
935245446 2:101215288-101215310 CTGTTAATCACAAGAAATGTAGG - Intronic
938695587 2:133832580-133832602 CTCCTACTTTCAAGGAAGGCTGG - Intergenic
940420816 2:153477951-153477973 CTGCTACTTACTTGGAATGCGGG - Exonic
940514130 2:154658559-154658581 CTGATAATTACAGGGAAGGCAGG - Intergenic
941975781 2:171403644-171403666 CTGTTACTAACAAGGGAGACGGG + Intronic
942128249 2:172848794-172848816 CAGCTTCTTATAAGGAATGCAGG + Intronic
942906325 2:181185146-181185168 CTTCTACTTACAAGGAATAGTGG - Intergenic
945281105 2:208036370-208036392 CTGATAGTTACAAGGATTGGGGG + Intergenic
948664380 2:239525980-239526002 CTGTTGATTACCAGAAATGCCGG + Intergenic
1169748726 20:8969577-8969599 TGGTTACTTACCAGGAGTGCTGG - Intergenic
1170207258 20:13811715-13811737 CTATTACTTGAAAGGGATGCTGG + Intronic
1171149452 20:22814336-22814358 CTGTTCCTTGCAAGAAATGCAGG - Intergenic
1173011644 20:39188572-39188594 CTGTTATTTGCAAGGGAGGCTGG + Intergenic
1174096988 20:48097440-48097462 CTGTAGCTTCCAAGGAATGACGG + Intergenic
1174831258 20:53814370-53814392 CTTTTACTTAAAAGGCATGCAGG + Intergenic
1178020077 21:28397630-28397652 CTGTCATTTACAATGGATGCAGG + Intergenic
951356282 3:21670891-21670913 CTCTTACCCACAAGGAATGCTGG - Intronic
952058554 3:29478896-29478918 ATGTTATTTCCAAGGAATGTTGG + Intronic
954850670 3:53597352-53597374 ATGTTACTGACTAGGATTGCAGG + Intronic
961485466 3:127212828-127212850 CAGTTCCTTAAAAGGAATGTTGG - Intergenic
961518326 3:127452424-127452446 CTGATATGTGCAAGGAATGCAGG - Intergenic
964973339 3:162588016-162588038 CTGTCACTGACAAGGACTACTGG + Intergenic
966740835 3:183231883-183231905 CTGCTTCTGTCAAGGAATGCAGG + Intronic
969947220 4:10796468-10796490 GGGTTTCATACAAGGAATGCAGG + Intergenic
970239971 4:13999008-13999030 TATTTACTTATAAGGAATGCCGG + Intergenic
973988911 4:56384122-56384144 CTGTGACTTTCAAGGAATTCGGG - Exonic
974815877 4:67002976-67002998 GGGTTTCATACAAGGAATGCAGG - Intergenic
975473064 4:74793065-74793087 CAGCTACTTGCAAGCAATGCTGG + Intronic
975757772 4:77587978-77588000 CTGCTTCTTTCAAGGGATGCAGG + Intronic
979421264 4:120508348-120508370 CTGGTAGCTGCAAGGAATGCTGG + Intergenic
987124999 5:14803813-14803835 GTGTTACTGGCAAGGAATGTGGG + Intronic
989108023 5:37881458-37881480 CTGTAACTTACATGGAATCATGG + Intergenic
990551731 5:56887741-56887763 CTGTTACTAATAAAGAATTCTGG + Intronic
991154741 5:63419137-63419159 ATGTTATTTACAAGAAATGAAGG - Intergenic
992792470 5:80225935-80225957 CTATTACTTATAATGAGTGCTGG - Intronic
993321141 5:86468551-86468573 CTGCTACCTGCAAGGAATTCTGG - Intergenic
994931063 5:106186713-106186735 CTGTTTCTCACAAGACATGCTGG - Intergenic
995450835 5:112298514-112298536 GTGTTTCATACCAGGAATGCAGG - Intronic
997373573 5:133381068-133381090 CTGTTGTTTCCAAGGAAAGCTGG + Intronic
999421540 5:151448519-151448541 GTGTGACTTACATAGAATGCAGG - Intronic
1014566850 6:122959735-122959757 GGGTTTCTTACCAGGAATGCAGG + Intergenic
1014859427 6:126446500-126446522 CTGTTATTTAAAAGGATTTCTGG - Intergenic
1017366925 6:153654298-153654320 CTTTTCCTTACAAAGAAAGCTGG - Intergenic
1019140959 6:169942121-169942143 CTGTTACTTAAAATGAAAGCTGG + Intergenic
1020854895 7:13407154-13407176 CTTACTCTTACAAGGAATGCGGG - Intergenic
1021652851 7:22848256-22848278 CTATTACTTACCAGGTATGGTGG - Intergenic
1024979996 7:55150036-55150058 CTGTTACAAAAAAGAAATGCAGG - Intronic
1026545034 7:71314877-71314899 CTGTTGCTCTCAATGAATGCTGG - Intronic
1030122998 7:106128993-106129015 ATGTTTCCCACAAGGAATGCTGG - Intergenic
1030701520 7:112646671-112646693 CTGTTAATTCTAAGGAATCCAGG - Intergenic
1030956458 7:115858182-115858204 TTTTTAATTACAAGAAATGCAGG + Intergenic
1033476726 7:141699980-141700002 CTGTGACTGACAAGGAATGGGGG + Intronic
1034370090 7:150587387-150587409 CTGTCATTTACTAGGAATGTTGG + Intergenic
1035782130 8:2235974-2235996 CTGTTGCCTACAAGGAAGGGAGG + Intergenic
1035809991 8:2483445-2483467 CTGTTGCCTACAAGGAAGGGAGG - Intergenic
1036586599 8:10130018-10130040 CAGTTACTTCCAAGGGATGTAGG - Intronic
1038065627 8:23960873-23960895 CTGACACTTACATGGAATGAAGG - Intergenic
1038126655 8:24681194-24681216 CTTTCATTTAAAAGGAATGCTGG + Intergenic
1038910861 8:31962717-31962739 CTGTTTCTTCCCAGGACTGCTGG + Intronic
1044800427 8:95948323-95948345 CTGTTGCTTACCAGGCATTCAGG + Intergenic
1044820528 8:96153100-96153122 CTGTTTCTGACAAGCAGTGCTGG + Intronic
1051263831 9:15291803-15291825 CTGTTCCTAGCAAGGCATGCGGG + Intronic
1052939858 9:34124521-34124543 CTGTTTCCTATAAGGAAGGCAGG - Intronic
1055181864 9:73398073-73398095 GTGTTTCATACCAGGAATGCAGG - Intergenic
1056235150 9:84586891-84586913 GTTTGATTTACAAGGAATGCTGG + Intergenic
1056905257 9:90641957-90641979 CTGTTACATCCATTGAATGCTGG - Intronic
1060683137 9:125583698-125583720 CTGTTACTTACTAGTAACCCTGG + Intronic
1062615415 9:137393901-137393923 CTGCTGTTTACAAGGACTGCAGG + Intronic
1185961483 X:4549847-4549869 CTGTTACCTACTAGGAAGACTGG + Intergenic
1186830467 X:13384839-13384861 CTGTTACTAACAAGTAGAGCTGG - Intergenic
1193093800 X:77525282-77525304 CTGTTACTGACCAGGCAGGCAGG + Intronic
1193775679 X:85638562-85638584 CAGTTTCATACAAGGGATGCAGG - Intergenic
1196646801 X:118126876-118126898 CTGTCAATAACAAGGAATGTGGG - Intergenic
1198082597 X:133253249-133253271 CTGTGGCCTACATGGAATGCAGG + Intergenic