ID: 918492794

View in Genome Browser
Species Human (GRCh38)
Location 1:185099910-185099932
Sequence AATGGTATACTGCTTCTCAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918492794_918492796 -3 Left 918492794 1:185099910-185099932 CCAGTGAGAAGCAGTATACCATT 0: 1
1: 1
2: 0
3: 6
4: 135
Right 918492796 1:185099930-185099952 ATTTATATAGCAACAGCCAGTGG 0: 1
1: 1
2: 0
3: 12
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918492794 Original CRISPR AATGGTATACTGCTTCTCAC TGG (reversed) Exonic
901573800 1:10183893-10183915 AATGCTATGCTGCTTCTCCTTGG - Intergenic
901905124 1:12401955-12401977 AATAGTATACTGCTTCCCAAAGG - Intronic
902100102 1:13980976-13980998 AATGTTATACAGCTTCCCCCAGG - Intergenic
909814628 1:79976313-79976335 AGTGGGAGACTGCTTCTCAAAGG + Intergenic
912197346 1:107413632-107413654 CGTGGTATCCTGTTTCTCACAGG + Intronic
916777814 1:167986632-167986654 TATGGTGAACTGTTTCTCACAGG - Intronic
918233172 1:182554182-182554204 ACTGCTTTTCTGCTTCTCACAGG + Intronic
918351390 1:183659162-183659184 AAAGGAATACAGCTCCTCACCGG + Intronic
918492794 1:185099910-185099932 AATGGTATACTGCTTCTCACTGG - Exonic
921004054 1:211075546-211075568 GAAGGTATAATGCTTCTAACTGG + Intronic
921358097 1:214305409-214305431 AACGGTTTACTGCCTATCACTGG - Intronic
921713410 1:218395225-218395247 ATTAGTAAAGTGCTTCTCACTGG + Intronic
921859172 1:220023068-220023090 AAGAGTATCCTGCTTCTCATTGG - Intronic
1063754386 10:8990319-8990341 AATAATATACTGCTTCTTCCAGG + Intergenic
1064793153 10:18981920-18981942 AAAGATATACTGCTTCTTAAAGG + Intergenic
1068709526 10:60118475-60118497 AATGGTTTATTGCTTTTGACGGG - Intronic
1071614284 10:87060715-87060737 TTTGGTCAACTGCTTCTCACTGG + Exonic
1071966135 10:90854663-90854685 AATGCCATACTGTTTTTCACAGG - Intronic
1080186698 11:29496402-29496424 AATGCTATACTGCTTATTAATGG + Intergenic
1080228474 11:29987949-29987971 AATAATATAATCCTTCTCACAGG - Intergenic
1084071691 11:66740678-66740700 AAGGGTTAACTGCTTCTCTCGGG - Intergenic
1093089640 12:14906673-14906695 AATGGCATACTGAGTTTCACAGG + Intergenic
1093231235 12:16545378-16545400 ACTGGTATGCTGCTACACACAGG + Intronic
1094332555 12:29311125-29311147 GATGGTATACTGCAGTTCACAGG + Exonic
1095153486 12:38823574-38823596 CATTGTATCCTGCTTCTCCCTGG + Intronic
1095322808 12:40849833-40849855 AATAGTATTCTGTGTCTCACAGG - Intronic
1095606751 12:44076969-44076991 AATGGCATATTTCTTCTCCCTGG - Intronic
1097730727 12:63125314-63125336 CATGCTATACTGCTTCCCAAAGG - Intergenic
1100972150 12:100081463-100081485 ACTGGTAAACTGCGTGTCACTGG + Intronic
1101264561 12:103070094-103070116 AATTCTATACTGCTTCTCATGGG + Intergenic
1104263082 12:127203300-127203322 AATGAAATACGGGTTCTCACAGG - Intergenic
1108368833 13:49746748-49746770 GATGGTAAAGTGCTTCACACAGG + Intronic
1112261029 13:97878642-97878664 AATGGTATACCCCTTCTCCATGG - Intergenic
1113405321 13:110033496-110033518 AATGGTCTAGTGCTTATCATTGG + Intergenic
1114782384 14:25552575-25552597 ATTGGTTTGCTGCTTCTGACAGG - Intergenic
1114828937 14:26114842-26114864 AATGGTATACTGTTTGTGAAGGG + Intergenic
1116370544 14:44125225-44125247 GCTGGTAAATTGCTTCTCACAGG + Intergenic
1120518103 14:85493890-85493912 ATTGATAAATTGCTTCTCACAGG - Intergenic
1120777538 14:88454051-88454073 AATGGTATATTCTTTCTCTCGGG - Intronic
1123894078 15:24810717-24810739 ATTGGTAAACTGCATGTCACAGG - Intergenic
1124336325 15:28860027-28860049 AATGGCAGACTGCTCCCCACAGG + Intergenic
1128524220 15:68401507-68401529 AATGGAATACTGCTCATCAATGG + Intronic
1131979103 15:97978508-97978530 AGTGGAATACTGCTTATCAGGGG + Intergenic
1141099633 16:81187796-81187818 AATGGTATCCTCCTTTTTACAGG - Intergenic
1146005861 17:29160246-29160268 AATTCTATTCTGCTTCTCAGAGG + Intronic
1147322109 17:39652846-39652868 CATGGCAATCTGCTTCTCACGGG - Intronic
1152248480 17:79198945-79198967 AATATTCTACTGCTTCCCACTGG + Intronic
1153848579 18:9071829-9071851 AATGTCAGAGTGCTTCTCACAGG - Intergenic
1155271720 18:24148323-24148345 AATGGCACACTGGTTCTCAAGGG - Intronic
1157060679 18:44285417-44285439 AATGGCATACTTGTTCTCACTGG - Intergenic
926658093 2:15431789-15431811 AATGGTATACATCTACTAACTGG + Intronic
927161950 2:20272217-20272239 GATGTTGTACTGCTTCTCAAAGG - Intronic
930311087 2:49740474-49740496 CTTGGTATACTGCATCTCTCAGG - Intergenic
930337322 2:50065650-50065672 AACAAAATACTGCTTCTCACTGG - Intronic
930656240 2:54009779-54009801 AATGGAATACTGATACTAACTGG + Intronic
934787732 2:97026478-97026500 ATTTGTAAACTGCTTTTCACTGG - Intergenic
935805376 2:106741651-106741673 AATGGTATAGTACTTATGACTGG - Intergenic
936840723 2:116764860-116764882 ATTGGGAAACTGCTTCTCCCTGG + Intergenic
937537487 2:122908504-122908526 AATCTTAAACTGCTTCACACTGG - Intergenic
937748551 2:125445780-125445802 AATTGTATACTTTTTCTTACTGG - Intergenic
945576270 2:211533588-211533610 AATGGTGTGCTACTTGTCACTGG + Intronic
947078523 2:226369956-226369978 AATGGTATACTGTTAAACACAGG - Intergenic
948186840 2:236027784-236027806 CATGGTGAACTGCTACTCACAGG + Intronic
1170258168 20:14370504-14370526 TATGCTATACTTCCTCTCACTGG - Intronic
949153727 3:802763-802785 AATGTCATACTGCCTGTCACTGG + Intergenic
950821796 3:15767946-15767968 AATTGTTTCCTGCTTCCCACAGG + Intronic
951463102 3:22971936-22971958 ATTTGTATACTGCTTCTATCAGG - Intergenic
951546028 3:23826258-23826280 AATGCTATACTTCCTTTCACTGG - Intronic
951966247 3:28388943-28388965 ACTGGGATACTGCTTCACAATGG - Intronic
953475836 3:43205303-43205325 TATGCTAAACTGCTTCTCAGGGG + Intergenic
953684453 3:45065463-45065485 ACTGTGATACTGCTTCTCCCAGG + Intergenic
959266615 3:104148663-104148685 AATGGTGAATTGTTTCTCACAGG + Intergenic
962386586 3:134937184-134937206 AATGGAATACTTTTTCTCAATGG + Intronic
962435066 3:135358686-135358708 AATGGTTTACTTCTTCTAATGGG - Intergenic
964394960 3:156235691-156235713 AATGGTAATCTGCACCTCACAGG - Intronic
965166361 3:165197382-165197404 AATGGTATCCAGCATCTCTCAGG - Intergenic
966091019 3:176136456-176136478 TATGGTAAACTGCATGTCACTGG + Intergenic
967267547 3:187703759-187703781 AAGGGTATACTATTTCTCAGAGG - Intronic
967471647 3:189868848-189868870 AATGCTATACCTATTCTCACTGG - Intronic
967582264 3:191173015-191173037 AAAGGTAAATTGCTTTTCACGGG + Intergenic
970840123 4:20458677-20458699 ACTGCTATCCTGCTTCTTACAGG - Intronic
972294185 4:37720819-37720841 ACAGGTAAACTGCATCTCACAGG - Intergenic
975074234 4:70185051-70185073 CATAATATACTGCTTCCCACTGG + Intergenic
977250615 4:94684470-94684492 AATTGTAAACTCCTTCTCAGTGG + Intergenic
978549461 4:109909868-109909890 AATGGTACTCTACTTCTCATAGG + Intergenic
979208467 4:118071308-118071330 TATGGTATAGTGCATGTCACAGG + Intronic
981495259 4:145384127-145384149 ATTTGTCTAGTGCTTCTCACTGG + Intergenic
981931243 4:150191320-150191342 ATCGGTATACTGTCTCTCACAGG - Intronic
983981986 4:174009041-174009063 AATGAGATACTGCCTCACACTGG - Intergenic
990110861 5:52322276-52322298 AATGCTATACTGTTTATCAATGG - Intergenic
991516068 5:67437108-67437130 AATAATACACTGCTTCTCTCAGG - Intergenic
994731198 5:103493016-103493038 AATGGTATAATAATTCTCAGAGG + Intergenic
996050294 5:118924737-118924759 AGTGGTATACTGTTTCTAAATGG - Intronic
997821001 5:137065771-137065793 AATGGTAATCTTGTTCTCACTGG + Intronic
999884944 5:155911853-155911875 CATTGTACACTGCATCTCACAGG + Intronic
1000482001 5:161788624-161788646 TATGGTATACTACTTATCCCAGG - Intergenic
1000594449 5:163197746-163197768 TGTGGTATACTCCTTCTCTCAGG + Intergenic
1001227455 5:169957467-169957489 AATGGTATACTTCTCCTTACAGG - Intronic
1007428033 6:41759786-41759808 AGTGGCACACTGCTGCTCACAGG - Intergenic
1008156180 6:48017726-48017748 AATGTTATACTGCTACTAAGTGG + Intronic
1008589381 6:52977799-52977821 AACCGAATCCTGCTTCTCACAGG - Intergenic
1009062379 6:58413249-58413271 CATGGTGAGCTGCTTCTCACAGG + Intergenic
1009250065 6:61287813-61287835 CATGGTGAGCTGCTTCTCACAGG + Intergenic
1010111252 6:72236362-72236384 AATGGTAAATTGCTTCCCAAAGG + Intronic
1011053613 6:83181832-83181854 AATGGAACACTACTTCTCACAGG - Exonic
1011279653 6:85663984-85664006 AATGGTACACTGGTTATCTCTGG - Intergenic
1011730190 6:90254461-90254483 AATGGTATAATGCCCCTCAAAGG + Intronic
1011855818 6:91689491-91689513 AGTTGTATATTGTTTCTCACAGG - Intergenic
1011998823 6:93627684-93627706 AATGGTATGTTGCTTATCACAGG - Intergenic
1018777886 6:167035125-167035147 TTTGTTAGACTGCTTCTCACTGG + Intronic
1021966205 7:25921817-25921839 AATACTATATTGCTTCTCTCTGG - Intergenic
1023354299 7:39351733-39351755 AATGGTAAAGTGCTACTCAATGG + Intronic
1023397538 7:39765234-39765256 AATGGTTTACTGCTGCTTCCTGG + Intergenic
1023785253 7:43701152-43701174 ATGGGTATACTGCATGTCACTGG + Intronic
1025135137 7:56405232-56405254 AATGGTTTACTGCTGCTTTCTGG - Intergenic
1027543255 7:79494769-79494791 AATGGTATGCTGCTTACCAAAGG - Intergenic
1035894786 8:3387353-3387375 GATGGTATACAACTTCTCAGAGG + Intronic
1036940478 8:13047630-13047652 TATGGTAGACAGATTCTCACTGG - Intergenic
1037490950 8:19396746-19396768 AAGGTTCTAGTGCTTCTCACTGG + Intergenic
1039979378 8:42394109-42394131 AACTGTATACCCCTTCTCACAGG + Intronic
1041151796 8:54943334-54943356 AAAGGTATGCTTCTTCCCACTGG - Intergenic
1042164530 8:65933001-65933023 AATGCTTTTCTGCTTCTAACTGG + Intergenic
1043642026 8:82465981-82466003 AAAAGTAGACTGCTTCTGACTGG + Intergenic
1044273668 8:90275495-90275517 GATGGTGTCCTTCTTCTCACAGG - Intergenic
1047949309 8:129916721-129916743 AATAGTACACTGCTACTCATTGG + Intronic
1048262643 8:132958115-132958137 CATGGTAAACTGCTTCTTAATGG + Intronic
1048975407 8:139669757-139669779 AATGGTATATTCCTTCTAAAAGG + Intronic
1050225835 9:3454221-3454243 AAAGGTATATTTCTACTCACAGG + Intronic
1050364610 9:4862731-4862753 AATGGTACATTGCTTCTCTTGGG - Intronic
1050540927 9:6669131-6669153 AGTGGTATACTGCTTCTCACTGG + Intergenic
1052121306 9:24720540-24720562 TCTGGAATACTGCTTCTCAAGGG - Intergenic
1052323008 9:27188637-27188659 TAGGGGATACTGCTTCTTACTGG + Intronic
1054805495 9:69392946-69392968 AATGGAGTACTGCTTCTTGCTGG + Intergenic
1054936623 9:70695220-70695242 AAGGTTATACTGCTACTAACTGG - Intronic
1055071177 9:72167615-72167637 ATTGGCATACAGCCTCTCACAGG + Intronic
1055907541 9:81311490-81311512 ATTTATATGCTGCTTCTCACAGG + Intergenic
1187796967 X:23014433-23014455 AATGGCATATAGGTTCTCACAGG - Intergenic
1188994717 X:36869667-36869689 AAAGTAATACTGCTTCTGACTGG + Intergenic
1190932408 X:54960510-54960532 AATGGTCTTCTACTTCTGACAGG - Intronic
1193422679 X:81302461-81302483 ATTGGTTTATTGCTTCTCATAGG + Intergenic
1193713786 X:84911368-84911390 AATGGTAAACTGCTTTGTACAGG + Intergenic
1198274705 X:135089687-135089709 AATGGTGGCCCGCTTCTCACAGG - Intergenic
1198985964 X:142454200-142454222 AAACATATACTGCTTCTCAATGG + Intergenic