ID: 918498737

View in Genome Browser
Species Human (GRCh38)
Location 1:185170177-185170199
Sequence TAAAAGAGCTTGCCTACAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 1, 2: 3, 3: 7, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918498737 Original CRISPR TAAAAGAGCTTGCCTACAGT TGG (reversed) Intronic
901008714 1:6185571-6185593 TAAAAGAGCTTGCCTACAGATGG - Exonic
905683480 1:39891616-39891638 AAAAAGAATTTGCCTACCGTAGG - Intergenic
907845641 1:58203939-58203961 TCAAAGAGCATGCATACAGAAGG + Intronic
908137928 1:61152098-61152120 TAAATGACCCTGCCTACACTTGG + Intronic
909323667 1:74322361-74322383 TAAAAGAGGATGCCTACAAGGGG - Intronic
911513370 1:98836081-98836103 AAAAAGTGGTTGCCTACAGGGGG + Intergenic
912917520 1:113830996-113831018 TAAAATAACTGGCATACAGTAGG + Intronic
913575908 1:120174716-120174738 AAAAATAGTTTTCCTACAGTGGG - Intronic
913683360 1:121207875-121207897 TAACAGAGATTACCCACAGTTGG + Intronic
914035202 1:143995499-143995521 TAACAGAGATTACCCACAGTTGG + Intergenic
914154250 1:145072471-145072493 TAACAGAGATTACCCACAGTTGG - Intronic
914558221 1:148790287-148790309 AAAAATAGTTTTCCTACAGTGGG - Intergenic
914614613 1:149339943-149339965 AAAAATAGTTTTCCTACAGTGGG + Intergenic
918498737 1:185170177-185170199 TAAAAGAGCTTGCCTACAGTTGG - Intronic
920470669 1:206226385-206226407 TAACAGAGATTACCCACAGTTGG + Intronic
921375728 1:214471592-214471614 TAAAAGACTTTCTCTACAGTAGG - Intronic
922114291 1:222595703-222595725 TAGCAGAGCTTGCCTGCTGTAGG - Intergenic
923780427 1:237017717-237017739 TGAAAGAGCTTTCCTACAATTGG + Intergenic
1063736365 10:8759634-8759656 AAAAAGAGCCTTCCTAAAGTTGG + Intergenic
1068893649 10:62175395-62175417 TGGAAGAGCTTGCCTAAACTTGG - Intergenic
1069165308 10:65150441-65150463 TAAAAGACCTTGCATATATTTGG + Intergenic
1069752189 10:70751861-70751883 TAAAAGAGCTCACCCACTGTGGG + Intronic
1072996226 10:100246982-100247004 TAAAATAGGTTGATTACAGTTGG - Intronic
1074246080 10:111695145-111695167 TAAAAGAGTTTGCTAACACTTGG + Intergenic
1074294798 10:112175114-112175136 TACAGGAGCTTGCTTACAATAGG - Intronic
1076395158 10:130133176-130133198 TATCAGAGCTTGCCTCCAGAGGG - Intergenic
1080484896 11:32695379-32695401 AAAAAGAGCTTGCCTACAGCTGG + Intronic
1082560471 11:54614363-54614385 TAAAACAGCTTCCATAGAGTTGG + Intergenic
1087082170 11:94181647-94181669 TCAAAGAGTTTGTCTACAGGCGG + Exonic
1090601898 11:128380922-128380944 TAAAAGATGTTGCCTTTAGTTGG - Intergenic
1090679835 11:129043173-129043195 TAAAAGAGCCTACCTGCAGCTGG + Intronic
1095276270 12:40286494-40286516 TAAAAGACTTTGACAACAGTAGG - Intronic
1100378786 12:94042664-94042686 TGAAAGAGGTTCCCTAGAGTAGG - Intergenic
1100901735 12:99249215-99249237 GAAAAGAGCTTGCCTATTGTGGG + Intronic
1105269765 13:18861266-18861288 CAAAGTAGCTGGCCTACAGTTGG - Intergenic
1105843098 13:24272477-24272499 TAATAAAGCTTGCCTATGGTGGG + Intronic
1109058649 13:57583648-57583670 TAAAAGACCTTGAGTGCAGTAGG + Intergenic
1110868181 13:80420732-80420754 TAAAAGAGCTTGGATACAAGAGG - Intergenic
1113404794 13:110028657-110028679 AGAGAGAGCTTGCCTACTGTTGG + Intergenic
1114381446 14:22208937-22208959 GAATAGTGCTGGCCTACAGTGGG + Intergenic
1114415793 14:22543158-22543180 TCAAAGACCTTACCCACAGTGGG + Intergenic
1115539801 14:34409880-34409902 TACAAGAGCTGGCCTGCGGTGGG - Intronic
1122896118 14:104757951-104757973 TAAAAGAGTGTGTCCACAGTGGG - Intronic
1129260965 15:74367036-74367058 TTAAAGAGCTTCCTTACAGATGG + Intronic
1131894390 15:97009980-97010002 TAGAAGTGGTTGCTTACAGTAGG + Intergenic
1135938683 16:26802612-26802634 GAAATGAGCTTGCCTAGAGGTGG + Intergenic
1144170971 17:12659634-12659656 TCCAAGAGCTTGACTGCAGTAGG - Intergenic
1146497538 17:33336526-33336548 TAAATTACCTTGCATACAGTAGG - Intronic
1146820856 17:35982783-35982805 AATAAGAGCTTGCCCAGAGTAGG - Intergenic
1148718135 17:49730347-49730369 TAAAAGATCTGGCCTACAGCTGG + Intronic
1154072186 18:11162613-11162635 TGGAAGACCTTGCCTACAATGGG - Intergenic
1159258343 18:65977546-65977568 TATATTCGCTTGCCTACAGTAGG - Intergenic
1160058463 18:75508510-75508532 TAACAGACCTTGCCCACAGCAGG + Intergenic
1165728825 19:38131129-38131151 GAACAGAGCTTGCACACAGTAGG - Intronic
1165823188 19:38690167-38690189 AAACAGAGCTTCCATACAGTGGG - Intronic
928893311 2:36232675-36232697 CAAAAGAGCTTTCTTGCAGTGGG - Intergenic
930575441 2:53141258-53141280 GAAAAGAGTTTCCTTACAGTAGG + Intergenic
931789085 2:65647401-65647423 TACTAGAGCTAGCATACAGTAGG + Intergenic
933102177 2:78274576-78274598 TAAAACAGCTTGGATACAGAGGG + Intergenic
933122909 2:78564774-78564796 TAAAATAGCTTGCTTCCAGCAGG - Intergenic
935038238 2:99400060-99400082 TAACAGAGCTTGCTTACTGGTGG - Exonic
935188139 2:100752934-100752956 TAAAATGGCTTGCATAGAGTTGG - Intergenic
935752517 2:106249103-106249125 TAAAAGAACTTGCCTACAGATGG + Intergenic
935912935 2:107916646-107916668 TAAAAGAACTTGCCTACAGATGG + Intergenic
936120238 2:109736051-109736073 TAAAAGAACTTGCCTGCAGATGG - Intergenic
939017443 2:136919189-136919211 TCAAAGCTCTTGACTACAGTTGG + Intronic
939302216 2:140358881-140358903 TAACAGAATATGCCTACAGTCGG - Exonic
942932374 2:181510961-181510983 TCAAATAGCGTGCCTACAGCTGG - Intronic
947920928 2:233873305-233873327 TAAAACCGCTGGCGTACAGTTGG + Intergenic
1170321750 20:15107379-15107401 TAAAAGAGCTTGACAACAAATGG - Intronic
1173070727 20:39762527-39762549 TAAAAGAGCTTATCTGCAGCTGG + Intergenic
1177647746 21:23921320-23921342 TGTAAGACCTTGCCTACATTAGG + Intergenic
1179332255 21:40415340-40415362 TAACAGAGCGTGCCAAAAGTTGG + Intronic
1185285031 22:49996276-49996298 CAAAAGAGCTTGCCTAGCTTCGG - Exonic
950267030 3:11581739-11581761 TAAAAGCACTTGGCTGCAGTTGG - Intronic
952420396 3:33125388-33125410 TAAAAGAGCTTCTCTACTGCAGG - Intronic
952996738 3:38890272-38890294 TAAAAGAGTTTGCCCAGAGTGGG + Intronic
958452695 3:94293871-94293893 AAAAAGAGCCTGCCTAAAATAGG + Intergenic
959404706 3:105946566-105946588 GAAAAGTGCTTCCCTAAAGTAGG + Intergenic
965594946 3:170401356-170401378 AAAAAAAACTTGCATACAGTTGG - Intergenic
967278848 3:187803005-187803027 GAGAAGAGCTTGCTGACAGTGGG + Intergenic
969413994 4:7047012-7047034 TAAAGGACCTTGGCTACAGTGGG + Intronic
975658221 4:76662718-76662740 TAAAGAAGCATGCCTACTGTAGG + Intronic
976820101 4:89196434-89196456 TAAATGAGCTTTCCTGCAGCTGG - Intergenic
981537922 4:145819624-145819646 TAAAAGAGCTTTCCTATCATGGG - Intronic
982363786 4:154552424-154552446 TAAAAAATCTTGCCTAAAGAAGG - Intergenic
987832863 5:23119535-23119557 TAAAAGAGTTTTTCTCCAGTTGG + Intergenic
990981827 5:61608369-61608391 TAAAATACCTGGCATACAGTAGG + Intergenic
991066870 5:62433392-62433414 TATACGAACGTGCCTACAGTTGG - Intronic
994357662 5:98812284-98812306 TAAAAAAGATTGCATAGAGTTGG - Intergenic
996300787 5:121981760-121981782 TAAAAGGGCCTGCATAAAGTAGG - Intronic
996914967 5:128701589-128701611 GGAAAGAGATTGTCTACAGTAGG + Intronic
997257561 5:132440818-132440840 TAAAAGTGTTTGCCAACATTTGG - Intronic
1001784467 5:174400292-174400314 TACATGAACTTGCCTACACTAGG - Intergenic
1006693697 6:35912699-35912721 CAAAAGAGCTTACCTAAAGTGGG + Intronic
1007176043 6:39898334-39898356 AAAAAGAGTGTGCGTACAGTTGG + Intronic
1008683384 6:53898244-53898266 TATGAGATCTTGGCTACAGTTGG + Intronic
1015004056 6:128256730-128256752 GAAAATAGTTTGCCTACAGCCGG - Intronic
1015546738 6:134369249-134369271 TGAAAGAGATTGCCTTCAGAGGG - Intergenic
1020426538 7:8072576-8072598 TAAAACATCTTGCTTCCAGTAGG + Intronic
1022181848 7:27928410-27928432 TAAAAGGCCTTGCCTGCAATTGG - Intronic
1023780361 7:43649747-43649769 TAAGACAGTTTGCCAACAGTTGG + Exonic
1024788903 7:52939967-52939989 GAATAGACCTGGCCTACAGTTGG + Intergenic
1029502416 7:100940493-100940515 TGAAAGAGTTTGTGTACAGTTGG + Intergenic
1030317625 7:108132653-108132675 TAAAAAGACTTGCCCACAGTCGG + Intergenic
1034198470 7:149265865-149265887 GAAAACACCTTGCCCACAGTTGG + Intronic
1040389069 8:46933991-46934013 TAGAGGAGCTGGACTACAGTTGG - Intergenic
1042580794 8:70277084-70277106 TTAAAGAGCTTGCCCATGGTTGG - Intronic
1042967864 8:74374933-74374955 TAAAAAAGCTTATGTACAGTTGG - Intronic
1043000453 8:74753608-74753630 AAAAATAGCTTGGGTACAGTGGG - Intronic
1043772107 8:84217143-84217165 TGAAAGAGCTTACCTACTGAGGG - Intronic
1044330481 8:90914193-90914215 TTAAAGAGCTAGCCTAAAATGGG + Intronic
1045056279 8:98370947-98370969 TGAAAGACTTTGCCTAGAGTAGG + Intergenic
1045074828 8:98552781-98552803 TAAAACACCTAGCATACAGTAGG + Intronic
1046458392 8:114500199-114500221 TAAAATAGCTTTCCTAAACTAGG + Intergenic
1047370291 8:124250617-124250639 TCAAAGACCTTGCATCCAGTGGG + Intergenic
1048665355 8:136655350-136655372 TAAAAGTTCTTTCCTTCAGTTGG + Intergenic
1050211122 9:3257519-3257541 TGAAAGACCCTGCCTACTGTAGG - Intronic
1051244440 9:15095457-15095479 TAAAAGTGGTTGCCAAGAGTAGG - Intergenic
1052524633 9:29598835-29598857 TAAAAAAGCTTGCATACATATGG + Intergenic
1056962693 9:91140430-91140452 TAAAAGAGCTTATAGACAGTAGG + Intergenic
1203790281 EBV:147839-147861 TAAGAGAGGTTGCCTAGATTTGG + Intergenic
1187181292 X:16946383-16946405 GAAAAGAGCTTCTCTCCAGTTGG + Intergenic
1188042024 X:25379286-25379308 TCAAAGAGATGGCCTAGAGTGGG + Intergenic
1190785567 X:53644730-53644752 TAAGAAAGCTTTCCAACAGTGGG + Intronic
1193130209 X:77911639-77911661 CAAAAGAGTTTACTTACAGTAGG + Intronic
1193760177 X:85455461-85455483 AAAAAGAGCTTCCCTCCATTAGG + Intergenic
1195727330 X:107932000-107932022 TAAAACAGCTGGCCTGCAGGAGG + Intergenic
1197957424 X:131966865-131966887 TAAAAGAGCTTGAGCAAAGTTGG - Intergenic
1200084269 X:153595648-153595670 CAGAAGAGCTTGCCTGCAGCGGG - Intronic
1200777513 Y:7182681-7182703 TAAAAGAGAATGCCTTAAGTTGG - Intergenic
1201465918 Y:14280642-14280664 TAAAAGATCTTCCCCAGAGTAGG - Intergenic