ID: 918499497

View in Genome Browser
Species Human (GRCh38)
Location 1:185178270-185178292
Sequence CAGTATGACTAGAGTCAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 268}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918499497 Original CRISPR CAGTATGACTAGAGTCAAGA TGG Intronic
902051966 1:13570892-13570914 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
903543420 1:24109169-24109191 AAGCATGACTAGAGCCAAGCGGG - Intronic
903955925 1:27025636-27025658 CAGGATGGCTATAGTCAAAAAGG - Intergenic
904582496 1:31556131-31556153 CAGTATTACTAGAGGTAAGATGG - Intergenic
904712971 1:32444891-32444913 CAGTCTGAGCAGAGTCAGGAGGG + Intergenic
907470767 1:54672055-54672077 CAGTGTGACTGGAGCCCAGAGGG + Intronic
908496785 1:64702206-64702228 AAGTGTGATTAGAGCCAAGAAGG - Intergenic
910368094 1:86487742-86487764 CAGTATGGCTAGAGGCTGGATGG - Intronic
910808094 1:91208507-91208529 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
910852974 1:91666627-91666649 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
911403676 1:97408766-97408788 CAGCATGACTAGAATAAAGCAGG + Intronic
911807007 1:102222964-102222986 CAGTGTGGCTAGAGTAAAGCAGG + Intergenic
911889663 1:103352041-103352063 CAGTATGGCTAGAATAAAGCAGG - Intergenic
912022849 1:105127664-105127686 TAGCATGACTGGAGTCAACAAGG - Intergenic
912816005 1:112829222-112829244 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
912980431 1:114366134-114366156 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
914523122 1:148435919-148435941 CAGTAAGACTGGAGTCAAACAGG - Intergenic
915532147 1:156508857-156508879 AAGTATGGCCAGAGTCAAGTGGG - Intergenic
916826668 1:168448464-168448486 CAGTATGGATAGAGTGGAGAGGG - Intergenic
918499497 1:185178270-185178292 CAGTATGACTAGAGTCAAGATGG + Intronic
918716294 1:187790977-187790999 CAGTATGAGTAGAATAAAAAAGG - Intergenic
918837032 1:189479857-189479879 CAGTAAGAATTTAGTCAAGATGG + Intergenic
921074624 1:211690402-211690424 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
922160138 1:223073648-223073670 CAGGATGAATTGAATCAAGAGGG - Intergenic
922190560 1:223315101-223315123 CTGTAAGACTAGAAGCAAGATGG - Intronic
924449560 1:244165300-244165322 CAGTATGACTGTAGTGCAGAGGG + Intergenic
1063993009 10:11586759-11586781 AAGTATAAATAGAGGCAAGAGGG + Intronic
1064016522 10:11776862-11776884 AAGTATTACAAGAATCAAGAAGG - Intergenic
1064854855 10:19754607-19754629 CAGTATGGCTAGAATAAAGCAGG + Intronic
1065930989 10:30479013-30479035 CAGTGTGAGGAGAGTCAGGAGGG - Intergenic
1066343406 10:34558494-34558516 TAGTATAATTAGAGTCAAGGGGG - Intronic
1067978937 10:51060065-51060087 CAGTGTTACTAGAGTTAAAAAGG - Intronic
1068447617 10:57143155-57143177 CAGTATGACTAAATTTTAGAAGG + Intergenic
1068671813 10:59730648-59730670 CAGTCTGAGGAGAGTCATGAGGG + Intronic
1068675816 10:59768215-59768237 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1071048237 10:81411753-81411775 GAGTATGACTAGAGCTCAGATGG - Intergenic
1072334787 10:94388416-94388438 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1072419659 10:95279426-95279448 CTGTATTAGAAGAGTCAAGAAGG - Intronic
1074244483 10:111675232-111675254 CAGTATGGCTAGAATAAAGCAGG + Intergenic
1075370099 10:121928224-121928246 CAGGATGGGGAGAGTCAAGAGGG + Intronic
1077616960 11:3683073-3683095 AAGTATGATTTGATTCAAGATGG + Intronic
1078949400 11:16112778-16112800 CAGCATGCATAGAGTAAAGAAGG - Intronic
1080637180 11:34134360-34134382 CAGTCTGTCTCGAGGCAAGAAGG + Exonic
1083089876 11:60189000-60189022 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1083104444 11:60344599-60344621 CAGGATGGCTACAGTCAGGATGG - Intronic
1085998121 11:81947195-81947217 CAGTATGGCTAGAATAAAGCAGG + Intergenic
1086508437 11:87529368-87529390 CAGTATGGCTAGAATAAAGCAGG + Intergenic
1086973476 11:93107689-93107711 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1087286587 11:96270923-96270945 CAGTGTGGCTAGAGTAAAGCAGG + Intronic
1087456819 11:98396880-98396902 CAGTTTGAGGAGAGTCAGGAGGG + Intergenic
1087490156 11:98815196-98815218 CTGCATGACAAGAGTCATGAAGG + Intergenic
1087684501 11:101248109-101248131 CAGTCTGAGTAGAGTCAGGAGGG - Intergenic
1087894792 11:103575606-103575628 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1090196956 11:124824797-124824819 CAGCATGACTAGAATAAAGCAGG - Intergenic
1091814531 12:3426525-3426547 CAGTCTGAGGAGAGTCAGGAGGG + Intronic
1092052828 12:5484701-5484723 CAGCATGACTGGGGTCACGATGG + Intronic
1093282710 12:17215244-17215266 CAGCAGGACTAGACTCCAGAGGG + Intergenic
1093594130 12:20941218-20941240 CAGTCTGAGAAGAGTCAGGAGGG + Intergenic
1093887693 12:24481361-24481383 CAGGGTGACTATAGTCAATAAGG + Intergenic
1095150811 12:38794926-38794948 CAGTATGGCTAGAATAAAGCAGG + Intronic
1095162369 12:38933279-38933301 CAGTCTGAGTAGAGCCAGGAAGG + Intergenic
1095176878 12:39102847-39102869 CAGTATGACTGCATTGAAGAAGG + Intergenic
1098248377 12:68543781-68543803 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1099077757 12:78132457-78132479 AAGTATGAAGAGAATCAAGAGGG - Intronic
1099560252 12:84164418-84164440 CAATGTGGCTAGAGTCAAGGAGG + Intergenic
1099560345 12:84165234-84165256 CATTATGGCTAGAGTGAAGGAGG + Intergenic
1099583449 12:84483844-84483866 CAGTGTGACTAGAATAAAGCAGG + Intergenic
1100049123 12:90423821-90423843 CAGTCTGCCTGGAGTCATGAAGG - Intergenic
1101509790 12:105382708-105382730 AAGTAAGAATACAGTCAAGACGG - Intronic
1102763326 12:115408624-115408646 CACTATGTCTAGAGTCAAGCGGG + Intergenic
1103657808 12:122487482-122487504 CAGTATTACTGGAGTCAAATAGG - Intronic
1104332149 12:127856916-127856938 CAGAAAGTCTGGAGTCAAGAGGG + Intergenic
1106184984 13:27401439-27401461 CAGTCTGTCTACAGCCAAGATGG - Intergenic
1109175538 13:59150828-59150850 CAGCATGAACAAAGTCAAGAAGG + Intergenic
1109565093 13:64102783-64102805 CAGCATGGCTAGAGTAAAGCAGG + Intergenic
1109909515 13:68891066-68891088 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1110533672 13:76626706-76626728 CAGTGTGGCTAGAGTACAGAGGG - Intergenic
1110650104 13:77934168-77934190 GAGTATGACTAGAGAGAATAAGG + Intergenic
1110653728 13:77972602-77972624 CAGTCTAAAGAGAGTCAAGAGGG + Intergenic
1114236106 14:20825016-20825038 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1115070015 14:29310231-29310253 CAGTATGAAAAGGGTCAGGAGGG - Intergenic
1115745253 14:36429838-36429860 GGTGATGACTAGAGTCAAGAAGG - Intergenic
1122632746 14:103114473-103114495 CAGGAAGACTAGAGATAAGAAGG - Intergenic
1123003432 14:105309258-105309280 CAGGATAACCACAGTCAAGAGGG + Exonic
1123208873 14:106739314-106739336 CAGCATGAATTGAGTCCAGATGG - Intergenic
1124893690 15:33756768-33756790 CAGTATGTCTGGGGTCAATAAGG + Intronic
1129482193 15:75835854-75835876 CAGCATCACTGGAGTCAGGAGGG + Intergenic
1130097630 15:80867756-80867778 CAGTATCCCTAGAGAGAAGAAGG - Intronic
1130654786 15:85784949-85784971 CATTATGACTAGAGGCCAGGTGG - Intronic
1131792964 15:95984644-95984666 CAGTATGACTAAAGTTTGGAAGG + Intergenic
1135569063 16:23534461-23534483 CAGTATGACTAGAATTAATATGG - Intronic
1138284024 16:55794269-55794291 CAGGATGAGCAGAGTCCAGAGGG + Intergenic
1138284978 16:55802718-55802740 CAGGATGAGCAGAGTCCAGAGGG - Intergenic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140285106 16:73595563-73595585 GAGTGTGAATAGAGTCAAAATGG - Intergenic
1142490842 17:278430-278452 CAGTGTGACTTGAGTTAAGTTGG - Intronic
1143811105 17:9472510-9472532 CAGTATGACTAGGGCCAAAGTGG + Intronic
1143890178 17:10096857-10096879 CAGTATGGCTTAAGCCAAGAAGG - Intronic
1144234701 17:13247195-13247217 AAATATGACTAGAGACAATAGGG + Intergenic
1146638816 17:34525329-34525351 CAGGATCACTAGAGTCAAGCAGG + Intergenic
1146764143 17:35504179-35504201 CAGTCTGAGGAGAGTCAGGAGGG - Intronic
1147810324 17:43164376-43164398 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1148724413 17:49778140-49778162 AAGTATGAATAGGGTCAAGAAGG - Intronic
1151299884 17:73216377-73216399 AAGTTTGAATAGAGTCAAGGAGG + Intronic
1152454930 17:80409319-80409341 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1153826397 18:8878872-8878894 CAGTCTGAAGAGAGTCAGGAGGG + Intergenic
1153830371 18:8917220-8917242 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1154014151 18:10601575-10601597 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1159748301 18:72268032-72268054 AAGTAGGATTAGAGGCAAGAAGG - Intergenic
1160886376 19:1350882-1350904 CAGGATGACTTGAGCCCAGAAGG - Intergenic
1162281882 19:9705356-9705378 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1163991832 19:21006199-21006221 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1164121585 19:22270033-22270055 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1164130739 19:22358964-22358986 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1164298132 19:23934555-23934577 CAGTCTTTCTAGAATCAAGAAGG + Intronic
1166219612 19:41355995-41356017 CAGTATGGCTGGAGCCCAGACGG + Intronic
1168182883 19:54674744-54674766 CAGGATGGCTACAGTCAGGATGG + Intronic
1168439201 19:56348984-56349006 CAGGATGGCTACAGTCAGGATGG + Intronic
925828469 2:7873690-7873712 GAGTATGACTAGACAGAAGATGG + Intergenic
926491474 2:13530134-13530156 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
929878678 2:45818030-45818052 GAGTATGACCTGAGACAAGAGGG + Intronic
932874104 2:75432768-75432790 AAGAATGACTGCAGTCAAGATGG + Intergenic
933922942 2:87066776-87066798 AGGTTTGACTAGAGGCAAGAAGG - Intergenic
933999308 2:87693388-87693410 CAGTAGGATTGGTGTCAAGATGG + Intergenic
935048394 2:99502485-99502507 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
936294543 2:111257503-111257525 CAGTAGGATTGGTGTCAAGATGG - Intergenic
937211330 2:120273690-120273712 CTGTAAGACCAGAGGCAAGATGG + Intronic
938317249 2:130338668-130338690 CAATATGACTTGAGTCCACAAGG - Exonic
938703145 2:133897329-133897351 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
938704351 2:133908647-133908669 CTGTATGACAAGAGTATAGAGGG + Intergenic
943408071 2:187513942-187513964 CAGTCTGAGGAGAGTCAGGAAGG - Intronic
945289724 2:208115356-208115378 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
945720272 2:213410380-213410402 CAGTCTGAGAAGAGTCAGGAGGG - Intronic
946899597 2:224359424-224359446 CAGTCTGTCTAGAGTCAGCAAGG - Intergenic
948189978 2:236051074-236051096 CAGTGTGACTAAAGAAAAGATGG - Intronic
948309427 2:236973990-236974012 CAGTGAGGCTAGAGGCAAGATGG - Intergenic
1169174975 20:3502979-3503001 CAGTATCACTGGAGTGAAAAAGG - Intronic
1169224747 20:3848940-3848962 CAGGATGACTATGGTCAGGATGG - Intronic
1170301101 20:14885492-14885514 CATCATGACTAGAGTAAAAAGGG - Intronic
1170411432 20:16096340-16096362 AAGTATGACTAGCTTCAAGAAGG + Intergenic
1175513892 20:59555753-59555775 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1179580453 21:42340150-42340172 CAGTATGGGTTGAGGCAAGAAGG - Intergenic
1179670902 21:42946931-42946953 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1185252250 22:49809692-49809714 CACCATGACTGGAGTGAAGAGGG + Intronic
951248570 3:20368156-20368178 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
952195068 3:31066892-31066914 CATTATGGCTACAGTCAAAATGG - Intergenic
952213971 3:31257129-31257151 CATTAAGACTGGAGTCCAGAAGG - Intergenic
953560138 3:43982661-43982683 CAGAGTGACTATAGTCAATATGG - Intergenic
954604723 3:51900530-51900552 CAGTCTGAGGAGAGTCAGGAGGG - Intronic
957814399 3:85274498-85274520 AAGTATGAATGGATTCAAGATGG + Intronic
957999938 3:87737748-87737770 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
959557091 3:107733040-107733062 CAGTATGAGCAGAGTGGAGACGG - Intronic
960627790 3:119698399-119698421 CTGTGAGGCTAGAGTCAAGATGG + Intergenic
960720372 3:120619286-120619308 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
961854731 3:129858458-129858480 GAGGATGACTAGAGTCCAGGAGG - Intronic
962097360 3:132306220-132306242 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
962277050 3:134023441-134023463 CAGTCTGAGGAGAGTCAGGAGGG - Intronic
964624006 3:158741500-158741522 CAGTCTCACTAGATTCAAGCTGG - Intronic
964785104 3:160387705-160387727 CAGTAAGTCTGGAGTCAAGTGGG + Intronic
964814051 3:160697701-160697723 CAGTATGAGTAGAGTGAAAATGG + Intergenic
964920632 3:161891488-161891510 CTGTAAGGCTAGAGACAAGATGG - Intergenic
964933033 3:162048700-162048722 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
966141224 3:176758464-176758486 CAGTATGACTAAAGACTGGAGGG + Intergenic
967805027 3:193708189-193708211 GATTATGACTAGGGCCAAGATGG - Intergenic
969141789 4:5080969-5080991 CAGTAGGATTGTAGTCAAGACGG - Intronic
970018262 4:11537314-11537336 CAGTATGACTATAGTATTGATGG - Intergenic
970092621 4:12427299-12427321 CAGTCTGAGGGGAGTCAAGAGGG + Intergenic
972784969 4:42318309-42318331 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
974564361 4:63564617-63564639 CAGTATGAATAGAATAAAGCAGG + Intergenic
975205632 4:71641802-71641824 CAGTCTGAGGAGAGTCAAGAGGG - Intergenic
975428613 4:74260054-74260076 CAGTCTGCCTAGAGCCCAGAGGG - Intronic
977043586 4:92042582-92042604 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
977972361 4:103227261-103227283 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
980304845 4:131046017-131046039 TAGTCTGACTAGAGTCAAGGAGG + Intergenic
980438811 4:132814914-132814936 CAGTCTGAGGAGAGTCAGGATGG + Intergenic
982359269 4:154501454-154501476 CAGTAGGACTATTATCAAGAAGG + Intergenic
982442952 4:155458044-155458066 CAGTAGGATTAGAATAAAGAAGG + Intergenic
983708420 4:170686649-170686671 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
983897953 4:173102063-173102085 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
984258143 4:177411516-177411538 TAGTGTGGCTAGAGACAAGAAGG - Intergenic
987203655 5:15602802-15602824 CAGTATGATTAGTTTCAAAATGG - Intronic
987930556 5:24395004-24395026 CAGTGTGAGGAGAGTCAGGAGGG + Intergenic
989096060 5:37782259-37782281 CAGTATGAGGAGAGTCAGGAGGG + Intergenic
989412795 5:41139908-41139930 CAGTCTGACTAGGGAGAAGATGG - Intergenic
989613547 5:43317506-43317528 CAGTATGAGGAGAGCCAGGAGGG + Intergenic
990402246 5:55450728-55450750 CAGTAAAACTACAGTCAAAAAGG + Intronic
990908561 5:60830212-60830234 CTGTATCCCTAGTGTCAAGAAGG - Intronic
991306063 5:65177450-65177472 CAGTCTGAGAAGAGTCAGGAGGG - Intronic
991682745 5:69154752-69154774 CAGTGTGGCTAGAGTATAGAGGG - Intergenic
993552199 5:89287282-89287304 CAGTATGAAGAGAGAGAAGATGG + Intergenic
994204065 5:97013073-97013095 CATTATGGCTAGAGGAAAGAGGG - Intronic
995460814 5:112400791-112400813 CAGCCTGACTAGTGTCAAGAAGG + Intronic
995867408 5:116706532-116706554 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
996036051 5:118759914-118759936 CAGTGTGGCTAGAGTAAAGCAGG - Intergenic
996552289 5:124743705-124743727 AAGCAGGACAAGAGTCAAGAGGG + Intronic
996725261 5:126668738-126668760 GAGTATGACTAGACAGAAGATGG + Intergenic
996859962 5:128054250-128054272 CAGAATGAATAGGCTCAAGATGG - Intergenic
997606950 5:135182037-135182059 CAGTATGAGCTGAGACAAGAAGG + Intronic
999422201 5:151454630-151454652 CAGTACGTGGAGAGTCAAGAGGG - Intronic
1000236810 5:159369685-159369707 CAGTCTGAGGAGAGTCAGGAAGG - Intergenic
1001096523 5:168779728-168779750 CAGAAAGACTTGAGTCACGAGGG - Intronic
1002999132 6:2314572-2314594 CAGTCTGAGGAGAGTCAGGAAGG + Intergenic
1005461922 6:26077563-26077585 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1005533222 6:26729480-26729502 GAGTATAACTAGCGTCAAGTAGG - Intergenic
1005537572 6:26772184-26772206 GAGTATAACTAGCGTCAAGTAGG + Intergenic
1006325793 6:33352865-33352887 CAGTGTGAGGAGAGTCAGGAGGG + Intergenic
1008123454 6:47643992-47644014 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1009008447 6:57814594-57814616 GAGTATAACTAGCGTCAAGTAGG + Intergenic
1011464515 6:87641505-87641527 CAATATGACTAGTGTCAGGATGG - Intronic
1011570368 6:88728322-88728344 CAGTCTGACGAGAGTCAGGAGGG - Intronic
1012724597 6:102794071-102794093 CAAAATGACTACATTCAAGAGGG - Intergenic
1014171700 6:118286108-118286130 CTGTAAGACAAGAGTCAACAGGG + Intronic
1015092620 6:129376590-129376612 CAGTATGGCTGGAGTGCAGATGG - Intronic
1016710614 6:147167073-147167095 CGCTATGACTAGAGTAAAAATGG + Intergenic
1016975355 6:149802275-149802297 CAGTATGACAAGCTACAAGATGG + Exonic
1017112304 6:150943807-150943829 CAGAATGAGTAGAGTCATGAGGG + Intronic
1017894560 6:158668114-158668136 CAGTAAGAACAGAGTGAAGATGG + Intronic
1020043911 7:5025353-5025375 CAGTCTGAGGAGAGTCAGGAGGG + Intronic
1020532353 7:9354392-9354414 GAGTATGACTAGACAGAAGACGG + Intergenic
1020600075 7:10263482-10263504 CAATGTGACTTGAGTCAACATGG + Intergenic
1020655767 7:10926717-10926739 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1022456508 7:30563036-30563058 CATTCTAACCAGAGTCAAGAGGG - Intergenic
1024812927 7:53234896-53234918 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1027676329 7:81162979-81163001 CAGTATGGCTAGAATAAAGCAGG + Intergenic
1028333967 7:89628680-89628702 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1028711376 7:93912910-93912932 CAGTATGACCAAATTCCAGATGG - Intergenic
1029822051 7:103156073-103156095 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1030486095 7:110169818-110169840 CAGTTTGATTAGAACCAAGAGGG - Intergenic
1031038780 7:116817061-116817083 GAGTTGAACTAGAGTCAAGAGGG + Intronic
1031310885 7:120195624-120195646 CAGTAGGAAAAGAGTAAAGAGGG - Intergenic
1032170537 7:129581046-129581068 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1033709261 7:143923748-143923770 CAGAAAGACTAGAGTAAAAATGG + Intergenic
1036221394 8:6923886-6923908 CACTATGTCCAGAGACAAGAGGG - Intergenic
1037185639 8:16059078-16059100 CAGCATGACTAGCCTGAAGAGGG + Intergenic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1038089650 8:24239134-24239156 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1039632804 8:39131399-39131421 GAGTATCACTTGAGTCCAGAAGG + Intronic
1039768948 8:40663196-40663218 CAGCATGACTACAGGCCAGATGG - Intronic
1040939374 8:52817137-52817159 CAGCAAAACTAGAGCCAAGATGG + Intergenic
1041515449 8:58694667-58694689 CAGTCTGAGAAGAGTCAGGAGGG - Intergenic
1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG + Intronic
1045711804 8:104993390-104993412 CAGGACGACTAGAGTAAAGCAGG - Intronic
1046753185 8:117946243-117946265 AAGTATGACTGGGGTCTAGAGGG + Intronic
1049905460 9:212735-212757 CAGTATGATCTGAGGCAAGATGG + Intergenic
1050933441 9:11361243-11361265 CAGCATGGCTAGAATAAAGAAGG + Intergenic
1051792727 9:20826260-20826282 CAGCATGACTAGAGTAAAGCCGG + Intronic
1052247991 9:26361635-26361657 CAGTGCGCCTAGAGTCAATAAGG - Intergenic
1052508073 9:29380709-29380731 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1055304036 9:74910275-74910297 CAGTATTTCTAGTTTCAAGATGG - Intergenic
1055680568 9:78710937-78710959 CTGTATCAGTAGAGTTAAGATGG + Intergenic
1056414437 9:86362616-86362638 CAGTCTGAGGAGAGTCAGGAAGG + Intergenic
1057326087 9:94065452-94065474 CAGTAGGACTAAAGTGAAGGTGG - Intronic
1059436044 9:114277012-114277034 CAGTATGCGTAGAGTCATGCAGG - Intronic
1061359952 9:130135049-130135071 AAGTATGAAGAAAGTCAAGAAGG + Exonic
1188281896 X:28280678-28280700 CAATATGAATAGAGTTAAAATGG - Intergenic
1188379688 X:29476220-29476242 GAGTATAACCAGAGACAAGATGG + Intronic
1189034549 X:37482484-37482506 CAGTCTGAGGAGAGTCAGGAGGG - Intronic
1189833887 X:45001514-45001536 CAGTCTGAGGAGAGTCAGGAGGG + Intronic
1190270251 X:48857614-48857636 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1190771205 X:53516264-53516286 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1191639219 X:63412530-63412552 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1191917993 X:66222732-66222754 CAGTCTGAGGAGAGTCAGGAGGG + Intronic
1193717315 X:84948273-84948295 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1193852289 X:86553344-86553366 CAGCATGGCTAGAATAAAGAAGG - Intronic
1194351526 X:92828379-92828401 GAGTATGACTAGACAAAAGATGG - Intergenic
1195846865 X:109238228-109238250 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1196423019 X:115541848-115541870 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1196460054 X:115920360-115920382 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1196869391 X:120098587-120098609 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1198132770 X:133715116-133715138 CAGTGTGACTAGAATAAAGCAGG + Intronic
1198593347 X:138209221-138209243 CAGTATGGCTAGAATAAAGCAGG - Intergenic
1198742457 X:139855778-139855800 CAGTCTGAGGAGAGTCAGGAGGG - Intronic
1199638339 X:149835062-149835084 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1200659847 Y:5945071-5945093 GAGTATGACTAGACAAAAGATGG - Intergenic
1201260088 Y:12150256-12150278 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1201307103 Y:12560506-12560528 GAGTATGACTAGACAGAAGATGG + Intergenic
1201308891 Y:12576729-12576751 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1202118570 Y:21500524-21500546 CAGTATGCCTAGCCTCTAGATGG - Intergenic
1202121022 Y:21524064-21524086 CAGTATGCCTAGCCTCTAGATGG - Intronic
1202123473 Y:21547605-21547627 CAGTATGCCTAGCCTCTAGATGG - Intronic
1202155535 Y:21881776-21881798 CAGTATGCCTAGCCTCTAGATGG + Intronic
1202157983 Y:21905317-21905339 CAGTATGCCTAGCCTCTAGATGG + Intronic
1202184429 Y:22170243-22170265 CAGTATGCCTAGCCTCTAGATGG + Intronic
1202206931 Y:22416158-22416180 CAGTATGCCTAGCCTCTAGATGG - Intronic