ID: 918502431

View in Genome Browser
Species Human (GRCh38)
Location 1:185212351-185212373
Sequence CAGGAAAAACAGATGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 934
Summary {0: 1, 1: 1, 2: 9, 3: 71, 4: 852}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918502431_918502440 11 Left 918502431 1:185212351-185212373 CCATCTTCCATCTGTTTTTCCTG 0: 1
1: 1
2: 9
3: 71
4: 852
Right 918502440 1:185212385-185212407 TGCTCTTAGACGCAGCTGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 89
918502431_918502442 18 Left 918502431 1:185212351-185212373 CCATCTTCCATCTGTTTTTCCTG 0: 1
1: 1
2: 9
3: 71
4: 852
Right 918502442 1:185212392-185212414 AGACGCAGCTGAGAGGTGGTAGG No data
918502431_918502443 21 Left 918502431 1:185212351-185212373 CCATCTTCCATCTGTTTTTCCTG 0: 1
1: 1
2: 9
3: 71
4: 852
Right 918502443 1:185212395-185212417 CGCAGCTGAGAGGTGGTAGGTGG 0: 1
1: 0
2: 1
3: 19
4: 216
918502431_918502441 14 Left 918502431 1:185212351-185212373 CCATCTTCCATCTGTTTTTCCTG 0: 1
1: 1
2: 9
3: 71
4: 852
Right 918502441 1:185212388-185212410 TCTTAGACGCAGCTGAGAGGTGG 0: 1
1: 0
2: 2
3: 8
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918502431 Original CRISPR CAGGAAAAACAGATGGAAGA TGG (reversed) Intronic
900544856 1:3222795-3222817 CAGGAATCACAGATGGATGTGGG - Intronic
901703611 1:11058638-11058660 TAGGAAAACCAGATGGCAGAGGG - Intronic
902980251 1:20117615-20117637 TGGGAGAAACAGATGGCAGAAGG + Intronic
903268698 1:22174348-22174370 CAGGAGAGAGGGATGGAAGAAGG - Intergenic
903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG + Intergenic
904222861 1:28987480-28987502 CAGCACCAACAGAAGGAAGAGGG + Exonic
904726158 1:32549914-32549936 CAGCCAAAACAGAAGAAAGATGG + Intronic
905053534 1:35073761-35073783 CAGGAAAAGCAGTTTTAAGAGGG - Intronic
905236415 1:36553195-36553217 AAGGAAAAACAGACGGCAGGAGG - Intergenic
905248450 1:36630692-36630714 CAGGGAACACAGATGTAAAAGGG - Intergenic
905953492 1:41972991-41973013 CAGGCAAAGAAGATAGAAGAAGG + Intronic
906137714 1:43511396-43511418 TAGGACAAACAGATGGAAGGTGG - Intergenic
906259745 1:44377986-44378008 TAGAGAGAACAGATGGAAGATGG + Intergenic
906409272 1:45566090-45566112 AAAAAAAAAAAGATGGAAGATGG - Intronic
907501499 1:54884910-54884932 CAGGGCCAACAGATGGCAGAGGG + Intronic
907907781 1:58799912-58799934 CAGGAAAGAAGGAAGGAAGAAGG - Intergenic
908562812 1:65323933-65323955 TAGGAAGAACAAATGGAATAAGG + Intronic
908791066 1:67782107-67782129 AAGGCAAAACAGATGTAAAAGGG + Intronic
909339141 1:74511996-74512018 AAGGAAAATCGGAAGGAAGAGGG + Intronic
909521981 1:76579322-76579344 CAAAAAAAACAGGTGGGAGAAGG - Intronic
910770629 1:90827659-90827681 CAGGAAAAAGAAATGAAAGCAGG + Intergenic
911196000 1:94996375-94996397 GAGGAAAAGCAGTGGGAAGAAGG + Intronic
911395973 1:97310621-97310643 TCAGAAAAACAGATGCAAGAAGG - Intronic
911462280 1:98205971-98205993 AAGGAAAAAAGGAAGGAAGAAGG + Intergenic
912083085 1:105962626-105962648 TAGAAAAAGCAGGTGGAAGAAGG + Intergenic
912108380 1:106309504-106309526 CAGAAAAAGCAGTTGTAAGAGGG + Intergenic
912226799 1:107743094-107743116 CAGGGAAAACTGATAGGAGATGG + Intronic
912760740 1:112365137-112365159 TAGGAAAGACAGATGGCAAAGGG + Intergenic
912969363 1:114266086-114266108 CAGGAAGAAGAGAAGGAAAAAGG + Intergenic
913083174 1:115409006-115409028 CAGGTAAAAAAAATGAAAGAGGG + Intergenic
913656099 1:120961609-120961631 CATGACAAACAGAAGGAAGCAGG - Intergenic
914520657 1:148412841-148412863 CATGACAAACAGAAGGAAGCAGG - Intergenic
914850192 1:151308453-151308475 AAGAAAAAGCAGATGGAAGGAGG + Intronic
915192783 1:154165855-154165877 TTGGAAAAACTCATGGAAGAAGG - Intronic
915367069 1:155322648-155322670 CAGGGAAAATTGATGGAGGATGG + Exonic
915450111 1:155998943-155998965 TACCAAAAACAGATGGAAGGGGG - Intronic
915865949 1:159499568-159499590 TAGGAAGAACAGATGGAGAAAGG - Intergenic
915972178 1:160362671-160362693 CAGGGAAGACAGATGGATGGGGG + Intergenic
916090445 1:161304864-161304886 CAGGAAAAACAAATGGGAAATGG - Exonic
916306767 1:163344403-163344425 CTGGAAGTACAGGTGGAAGAGGG + Intronic
916544584 1:165791378-165791400 CAGGAAATACAGAGGGTACAGGG + Intronic
916551577 1:165854845-165854867 CAGGAAAAACAGAAGTATAAAGG - Intronic
916824383 1:168430042-168430064 CAGGTGAGACAGATGGAAAAGGG + Intergenic
916923656 1:169494996-169495018 AAAAAAAAAAAGATGGAAGAGGG + Intergenic
917127086 1:171696572-171696594 CTGGAAAAACAGAGGGTAAAGGG + Intergenic
917539003 1:175895518-175895540 CAGGAGTTACAGATGGAAGCAGG + Intergenic
917698425 1:177554753-177554775 CATGAAAATCAGATGGCTGAGGG - Intergenic
917707266 1:177647238-177647260 CAGGACAAACAGATGAAGAAAGG - Intergenic
918203779 1:182291296-182291318 CAGGAAATACATATGGAGGGGGG + Intergenic
918454021 1:184688506-184688528 CAGGAACCACAGAAGGAAGGTGG + Intergenic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
918691156 1:187480878-187480900 CAGGAACTACAGAAGGCAGAAGG - Intergenic
918722818 1:187875598-187875620 CAGGAGAAATAGAGGGGAGAGGG + Intergenic
918794845 1:188880547-188880569 GAGGAAAAAAGGAAGGAAGAAGG - Intergenic
919411998 1:197257239-197257261 CAGAACAAAAAGGTGGAAGAAGG - Intergenic
919614140 1:199784297-199784319 CAGGAAATACAGATCAAAGCAGG + Intergenic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920259539 1:204679527-204679549 AGGGAAAAACATATGGAAGAAGG - Intronic
920548143 1:206835887-206835909 CAAGAAAGACAGAGGCAAGAAGG + Intronic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
920755495 1:208727114-208727136 CAGGAAGAAGAGATGGACAACGG + Intergenic
921164052 1:212493571-212493593 GAGGAAGAAGAGATGGAAGAAGG + Intergenic
921417658 1:214909254-214909276 CAGGAGGAAGAGAAGGAAGAAGG + Intergenic
921568063 1:216744732-216744754 CTAGAAGAACAGATGGAAGATGG - Intronic
921591326 1:217007718-217007740 GAGGAAGAAAAGATGGAAGGAGG - Intronic
921596510 1:217059717-217059739 CAGGAAATACAGGGGGCAGAGGG + Intronic
921879846 1:220243572-220243594 CTGAAAAAGTAGATGGAAGATGG - Intronic
922027833 1:221768405-221768427 CATGAAAAGCAGATTGAATAAGG - Intergenic
922094644 1:222432629-222432651 CAGGAAAAAACTATGGAAAAGGG - Intergenic
922955452 1:229595508-229595530 CAGCTAAAACTGATGGATGAAGG - Intronic
923388185 1:233486680-233486702 CTTGAAAATCAGAAGGAAGATGG - Intergenic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
923893821 1:238246295-238246317 CAGCAAAAACAGTTTGAAGAGGG + Intergenic
924074775 1:240322609-240322631 GAGGAAAAGTAGTTGGAAGAGGG + Intronic
924135063 1:240957162-240957184 TAGGAAAAGCAGGTGGAAGAAGG + Intronic
924346999 1:243082047-243082069 CAAGAACCACAAATGGAAGAAGG + Intergenic
924526448 1:244855495-244855517 CAGGAAAAACAGGGGCACGAGGG + Exonic
1063169629 10:3495985-3496007 CAGTAAAAATACATAGAAGAAGG - Intergenic
1063311614 10:4957822-4957844 GATGGAAAGCAGATGGAAGATGG - Intronic
1065045806 10:21746886-21746908 CGGGAAAGGCAGATGGGAGAAGG + Intergenic
1065622433 10:27596593-27596615 CAGCAAAAACAGCTCTAAGAGGG - Intergenic
1065740897 10:28796155-28796177 CGGCAAAAACGGATGGAAAACGG + Intergenic
1066247930 10:33602409-33602431 CAGTAAAAACAGTTCTAAGAGGG + Intergenic
1067235033 10:44439862-44439884 CAGAAACATCAGATGGAAGCTGG - Intergenic
1067674667 10:48362089-48362111 CAGGAAATAAAGCTGGAAAAAGG - Intronic
1068114525 10:52722755-52722777 CAGGAGGAACAGAGGGAACAGGG + Intergenic
1068543385 10:58320896-58320918 TAGAAAAAGCAGGTGGAAGAAGG + Intergenic
1068584562 10:58782700-58782722 CTGGAAAACCTGATTGAAGAGGG + Intronic
1069138390 10:64794018-64794040 CAAGAAAGAGAGAAGGAAGAAGG - Intergenic
1070183191 10:74034334-74034356 CAGGAAACATAGCTGGAAAATGG - Intronic
1070210410 10:74313309-74313331 CAAAAAAAACAGAAGAAAGATGG - Intronic
1070267920 10:74922413-74922435 AAGGAAAAAAAGAAGAAAGATGG + Intronic
1070346099 10:75543453-75543475 CAAGAAAAAAAAATGGAAGTGGG + Intronic
1070485693 10:76928910-76928932 CAGGCAAAACAGCTCCAAGAGGG + Intronic
1070603182 10:77879799-77879821 CAGGAAAAACAGATGGGGGAGGG + Intronic
1071074298 10:81732688-81732710 CAAAAGAAACACATGGAAGAAGG + Intergenic
1071110613 10:82150723-82150745 CAGCAGAAGCAGATGAAAGACGG - Intronic
1071407168 10:85348338-85348360 CTGAGAAAACAGATGCAAGAAGG + Intergenic
1071437287 10:85659258-85659280 CAGGAAGAAGAGAGGAAAGATGG + Intronic
1071584013 10:86801691-86801713 CAGGTTAAACAGTTGAAAGAAGG - Intronic
1071926173 10:90412217-90412239 CAGTAAAAACAGTTCTAAGATGG + Intergenic
1071981947 10:91012351-91012373 CAGGACAGACAGATTGAAGGAGG - Intergenic
1072673026 10:97445692-97445714 AGGGAAAAACAGAGGGGAGATGG + Intronic
1072885912 10:99273713-99273735 AAGGACAGACAGATGGATGATGG + Intergenic
1072908221 10:99474978-99475000 CAAGAAAAGGAGAGGGAAGAGGG + Intergenic
1073667296 10:105547868-105547890 CAGGAGAAAGAGAGAGAAGAGGG - Intergenic
1073848545 10:107587596-107587618 CAGCCAAACCACATGGAAGATGG - Intergenic
1073959083 10:108905142-108905164 GAGTAAAAACAGAGAGAAGAGGG + Intergenic
1074022089 10:109594425-109594447 CAGGAAAAACTGAGGCAAGTAGG + Intergenic
1074033887 10:109718346-109718368 CAGGAAAAACACATGGAAGATGG + Intergenic
1074202359 10:111249449-111249471 CAGGAAAGAGGGATTGAAGAAGG + Intergenic
1074323887 10:112429458-112429480 CAGGTAAAATATATGTAAGATGG - Intergenic
1074728565 10:116342815-116342837 CAGGAAGAACAGAGAGAAGCAGG - Intronic
1074736632 10:116441251-116441273 GATGGAAAACAGATGGCAGATGG + Intronic
1074802732 10:117017728-117017750 CAAAAATAAGAGATGGAAGAAGG + Intronic
1076271370 10:129155193-129155215 CAGGAGAAGCAGGTGGAACAAGG + Intergenic
1076444972 10:130508041-130508063 CAGAAAAGACAGATGGATGAGGG - Intergenic
1076504788 10:130964467-130964489 CAGGAAGGACAGATGGATGGTGG - Intergenic
1076621822 10:131793870-131793892 CTGGAAAAAAAGGTGGAAAAGGG - Intergenic
1076814840 10:132909610-132909632 CTGGAAAGCCAGATGGAGGAGGG - Intronic
1078393862 11:10961099-10961121 CAGCAAAATCAGTTTGAAGAAGG + Intergenic
1078740624 11:14062994-14063016 GAGGAAAAAAAGAGGGAAGGAGG - Intronic
1079845834 11:25466616-25466638 CAGCAAAAACAGAACCAAGAGGG + Intergenic
1080057841 11:27925689-27925711 TAGGATAAAAAGATGGAGGAAGG + Intergenic
1080230522 11:30014651-30014673 CAGGAATAACAGGTGACAGAGGG - Intronic
1080248152 11:30203031-30203053 CAAGACAGCCAGATGGAAGAGGG - Intergenic
1080382061 11:31782301-31782323 GGGGAAAAACAGATGAAAAAGGG - Intronic
1080447197 11:32348207-32348229 CAGGAAAAACGGATGTGAGTGGG - Intergenic
1081634830 11:44714158-44714180 CAGAATAAGCAGATGGGAGAAGG + Intergenic
1081842197 11:46210687-46210709 AAGAAAAAACAGATGCTAGAGGG - Intergenic
1082182246 11:49133707-49133729 TAGGAAAACAAGAAGGAAGATGG - Intergenic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1082915040 11:58424335-58424357 GAGGAAAGACAAATTGAAGAAGG - Intergenic
1083028375 11:59570050-59570072 TAGGAAACCTAGATGGAAGATGG - Intergenic
1084022419 11:66425616-66425638 CACAACAAACTGATGGAAGAGGG + Intronic
1084469693 11:69351334-69351356 GAGGAAAAAAAGATTGAAGAAGG - Intronic
1084486579 11:69451682-69451704 AAGGAAGAAAAGAGGGAAGATGG + Intergenic
1085821924 11:79803029-79803051 AAGAAAAAAGAAATGGAAGAAGG + Intergenic
1086285680 11:85247487-85247509 AAGGAAAAAATGAGGGAAGAAGG - Intronic
1086383261 11:86281569-86281591 CAGCAAAAACAGTTTTAAGAGGG - Intergenic
1086683262 11:89701239-89701261 TAGGAAAACAAGAAGGAAGATGG + Intergenic
1086882279 11:92162763-92162785 CATGAAAAATAAATGGAAAAAGG - Intergenic
1088680452 11:112237096-112237118 CAGTGGAAATAGATGGAAGAAGG + Intronic
1088696038 11:112366641-112366663 AAGGAAGAAAAGAAGGAAGAAGG - Intergenic
1088987521 11:114922895-114922917 CAGGAAACAAAGATGGAAAGTGG + Intergenic
1089114123 11:116080374-116080396 AAGGAACAGCAGAGGGAAGAGGG - Intergenic
1089125556 11:116174199-116174221 AAGGAAACACAAATGGCAGAGGG - Intergenic
1089240216 11:117071559-117071581 AAGGATAAATAGAAGGAAGAAGG + Intronic
1090256904 11:125290945-125290967 CAGGAGAAGCTGATGGGAGAAGG + Intronic
1090380290 11:126321924-126321946 AAGACAAAAGAGATGGAAGATGG + Intronic
1091067342 11:132528266-132528288 CAGGAAAAATGTATGGAATATGG - Intronic
1091113810 11:132995462-132995484 AAGGAGAGACAGAGGGAAGAAGG - Intronic
1091352605 11:134909120-134909142 CAGGAAACACAAATGAAAGATGG - Intergenic
1091530093 12:1346361-1346383 GGAGAAAAACAGATGGAAAAGGG - Intronic
1091770716 12:3149391-3149413 CAGGTAAAAAAGAGAGAAGAAGG - Intronic
1092228527 12:6764443-6764465 CAGGAAAAATAGGAGGAAGGTGG + Intronic
1092482217 12:8870196-8870218 CAGGAAACACAGTTAGATGATGG - Intronic
1092507364 12:9117341-9117363 CAGGAAGACCAGATGGGAGCTGG + Intergenic
1092736696 12:11589485-11589507 CAGGAAAGAAGGAAGGAAGAAGG - Intergenic
1093347686 12:18059436-18059458 CAGCAAAACCAGTTGTAAGAGGG + Intergenic
1093391319 12:18627056-18627078 AAGAAAAAAAAAATGGAAGAAGG - Intronic
1093625894 12:21347701-21347723 AAGGAAAAAAGGAAGGAAGAGGG + Intronic
1093670395 12:21867564-21867586 CAGGAATGACATTTGGAAGAAGG + Intronic
1093705881 12:22274720-22274742 CAGGCAACAGCGATGGAAGAAGG - Intronic
1094090664 12:26645441-26645463 AAGGAACCACATATGGAAGATGG + Intronic
1094129901 12:27063562-27063584 CAGAAGAAAAAGAAGGAAGAAGG - Intronic
1094229096 12:28082438-28082460 CAGGAAAAAGAAAAGGAAGTAGG + Intergenic
1094413739 12:30196024-30196046 CAGGAAAAAAAGAAAGAATAAGG - Intergenic
1094672703 12:32586599-32586621 AAGGGAAAACAGATGGAGCAGGG + Intronic
1096278405 12:50230492-50230514 GGGGAAAAACAGAGGCAAGAGGG + Intronic
1096360503 12:50981806-50981828 AAGGAAAAAAAGATGGAAGAGGG + Intronic
1096571393 12:52525399-52525421 CAGGAAAGCCAGATGGAATAAGG - Intergenic
1097249217 12:57623196-57623218 GTGGAGAAACAGGTGGAAGATGG + Intronic
1098179612 12:67832259-67832281 CAGGAGAGGCAGATGGAAGATGG + Intergenic
1098207129 12:68123000-68123022 CAGCAAAAACAGTTCCAAGAGGG - Intergenic
1098990373 12:77059299-77059321 CAGGACAGACAGATGGAGCAAGG - Intronic
1099019590 12:77386920-77386942 CATGAGAAGCAGTTGGAAGAAGG + Intergenic
1099079426 12:78157810-78157832 GAGGAGAAAAAGAAGGAAGAGGG + Intronic
1099536211 12:83848208-83848230 AAGGAAACACAGAGAGAAGAAGG - Intergenic
1099686105 12:85891459-85891481 GAGGAAAAAATGATGCAAGATGG - Intergenic
1099821702 12:87719611-87719633 TAGAAAAAGCAGGTGGAAGAAGG + Intergenic
1100605453 12:96148765-96148787 CTGGAAAAATAGATGGAATGAGG + Intergenic
1100862602 12:98822290-98822312 CTGGAAAAAGAAAGGGAAGAAGG + Intronic
1101022248 12:100565144-100565166 CAGGAGCAACAGAAGGAAGGTGG + Intergenic
1101575660 12:105994155-105994177 GAGGAAAGAGAGATTGAAGAAGG - Intergenic
1101709492 12:107251609-107251631 TAGAAAAAGCAGACGGAAGAAGG - Intergenic
1101994330 12:109514128-109514150 CAGGTAAAAGCGATGTAAGAGGG - Intronic
1102464546 12:113120763-113120785 AAGAAAAATCAGATGGAAGATGG - Intronic
1102709091 12:114909620-114909642 CTGGCGAAAAAGATGGAAGAAGG - Intergenic
1103806472 12:123577546-123577568 CAGGACAAACAGCTGGCACATGG - Intergenic
1105531456 13:21224474-21224496 CAGCAGCAAGAGATGGAAGAAGG + Intergenic
1106041360 13:26096840-26096862 AAGGAGAAAGAGAAGGAAGAGGG - Intergenic
1106221948 13:27753624-27753646 TAGAAAAAAAAGGTGGAAGAAGG - Intergenic
1106287890 13:28334110-28334132 CAGGCAAATCACTTGGAAGAGGG - Exonic
1106355833 13:28982169-28982191 CAGTGAAGACAGATGGAAAAAGG + Intronic
1106736410 13:32592089-32592111 CAGGATAAGCAGATGGTACAAGG - Intronic
1107031494 13:35858450-35858472 AAAGACAAACAGCTGGAAGATGG + Intronic
1107681054 13:42851035-42851057 CAGGAAAAAAGGATTGCAGAGGG - Intergenic
1107694045 13:42982760-42982782 CAGGGGAAAAAGATGGGAGAAGG - Intronic
1107920735 13:45204318-45204340 CAGGAATAACAAATGAAACACGG - Intronic
1108238285 13:48432241-48432263 CTGGAAATACAGATTGGAGAAGG - Intronic
1109002502 13:56824164-56824186 CAGGTATAAAAGATGGAGGAAGG - Intergenic
1109343215 13:61088275-61088297 AAGGAAGTACAGTTGGAAGAGGG - Intergenic
1109413738 13:62008424-62008446 CTGGAACATCAGATGTAAGAGGG + Intergenic
1110019529 13:70453080-70453102 CAGGAAAAAGAGAGAGAGGAGGG - Intergenic
1110348583 13:74478788-74478810 TAGAAGAAAAAGATGGAAGAAGG - Intergenic
1110894916 13:80737446-80737468 CAGAAAAGACACATTGAAGAGGG + Intergenic
1110977030 13:81851420-81851442 TAAGGAAAACAGAAGGAAGAAGG + Intergenic
1111413396 13:87907341-87907363 CAGGAAAAAGAGAGGGCAAAGGG + Intergenic
1111538171 13:89631360-89631382 CAGAAAATACAGATGAAAGAAGG - Intergenic
1111705369 13:91742208-91742230 CAGGAAAAGCAAATGCCAGAAGG + Intronic
1112076243 13:95916250-95916272 CAGGAAAAACAGAAGCAACTAGG + Intronic
1112446761 13:99471574-99471596 CAGGAAAGAGGGAAGGAAGAGGG + Intergenic
1112446772 13:99471644-99471666 TAGGAAGAAGAGAAGGAAGAAGG + Intergenic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1113119077 13:106906984-106907006 CAGACAAAATAGATGCAAGAGGG - Intergenic
1113155905 13:107321636-107321658 CAGGAACAACCCATGGAAGTTGG - Intronic
1113316225 13:109182285-109182307 CTGGACAAACACATGTAAGATGG + Intronic
1113353755 13:109556760-109556782 CAGCAAAAGCAGATCTAAGAGGG + Intergenic
1113794982 13:113051538-113051560 CAGGAAATACACAGTGAAGAAGG - Intronic
1114519674 14:23325312-23325334 GAGGAAAAAAAGAGGAAAGAAGG + Exonic
1114552997 14:23544859-23544881 CAGAAAAAAAAGGTGGGAGAAGG - Intronic
1114712828 14:24795444-24795466 AAGAAAAAACAGCTGGAAGAGGG + Intergenic
1114751750 14:25211845-25211867 CAGGAAAAAAAGTTGGAAGAGGG - Intergenic
1115279379 14:31644301-31644323 CAGGAAAAACAGTATGAAGATGG - Intronic
1115550310 14:34499169-34499191 CAAGAAAACCAGTTGGAAGATGG + Intergenic
1115734834 14:36314682-36314704 CTGGAAAAGCAGAAGTAAGAAGG - Exonic
1116309202 14:43300379-43300401 CAGGAAAAACAGGGGCACGAGGG - Intergenic
1116392578 14:44411174-44411196 AAGGAAAGAAAGATGGGAGAAGG + Intergenic
1116467937 14:45254596-45254618 AAGGAAAAACAGTTGGAGGTAGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117480562 14:56140020-56140042 CAGGAAAAAGAGAAGGGGGAAGG - Intronic
1118131015 14:62963611-62963633 ATAGAAAAAGAGATGGAAGAAGG - Intronic
1118139012 14:63059385-63059407 CAGTGGAAACAGATAGAAGATGG + Intronic
1118245287 14:64104350-64104372 CAAGAAAAGGAGATGGAGGAGGG - Intronic
1118360958 14:65055975-65055997 GAGGAAAAAAAACTGGAAGAGGG - Intronic
1118470117 14:66067596-66067618 CAGGGAAATCAAATGGAAGGGGG - Intergenic
1118656244 14:67952706-67952728 GAGGAAAAGGAGAAGGAAGAGGG + Intronic
1118879533 14:69814433-69814455 CTGGCAAAACAGATAGAAAAAGG + Intergenic
1119294692 14:73523306-73523328 CTTGAAAAACAGATGGAAAGGGG + Intronic
1119329807 14:73785692-73785714 TAGGAAAAGGAGATGGGAGATGG - Intronic
1119400759 14:74360608-74360630 CAGGAAACCCAGACAGAAGAAGG - Intergenic
1119600654 14:75974139-75974161 CAGAAAAAAAAGAAGGGAGATGG + Intronic
1120129990 14:80795322-80795344 CAGATAACACAGAAGGAAGAGGG - Intronic
1120286647 14:82510951-82510973 CAGGGAAAAAAGAGGGAAAAAGG - Intergenic
1120649557 14:87115421-87115443 CAGGGAAAGCAGAGGGAAAAGGG - Intergenic
1121469478 14:94140740-94140762 AAAGAAAAACAGATGGCAGCAGG + Intergenic
1121990958 14:98556763-98556785 CAGGAAAAACATAAGAAATAGGG + Intergenic
1123166917 14:106334475-106334497 CAGGAAAAACAAATGGAAAAAGG + Intergenic
1123169532 14:106359186-106359208 CAGGAAAAACAAATGGAAAAAGG + Intergenic
1123173423 14:106396048-106396070 CAGGAAAAGCAAATGAAAAAGGG + Intergenic
1202837014 14_GL000009v2_random:85866-85888 GAGGAAAAGCAGATGGCAGTTGG + Intergenic
1123680897 15:22762792-22762814 CAGGGAGAACAGCTGGAATACGG - Intergenic
1124153103 15:27199932-27199954 CAGGAAAGAGAGAAGGATGAAGG - Intronic
1124479172 15:30062771-30062793 AAGAAAAGACAGAAGGAAGAAGG + Intergenic
1124608756 15:31193266-31193288 GAGGGAAAGCAGATGGAAGAGGG - Intergenic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1126215579 15:46150577-46150599 CAGGAAAACTAGATGGCAAAAGG - Intergenic
1126473673 15:49044637-49044659 TAGGAAAAAAACATGGAAGAAGG - Intronic
1126525887 15:49653880-49653902 AAGGAAAAATAGATGGAAGATGG + Exonic
1127064439 15:55222342-55222364 CAGGAAAAACACATAGAGTAGGG - Intronic
1127249451 15:57215917-57215939 CAGAAAAGTAAGATGGAAGAGGG + Intronic
1127481448 15:59381222-59381244 CATTAAAAAGAGATGGCAGATGG + Intronic
1127588878 15:60402854-60402876 CAGGAAAACAGGATGGAGGAAGG - Intronic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1128522191 15:68382805-68382827 CAGGAAGAAAAGATTCAAGAGGG + Intronic
1128681917 15:69658643-69658665 CAGGAAACAGAGAAGGCAGAAGG - Intergenic
1129125644 15:73438644-73438666 CAGGAAACACTGATAGCAGAGGG + Intergenic
1129368963 15:75076022-75076044 CAGAAAAAATGGAGGGAAGAAGG + Intronic
1129573742 15:76718265-76718287 CAGCAAAAGCAGTTGTAAGAGGG + Intronic
1129596736 15:76970634-76970656 AAGGAGGTACAGATGGAAGAAGG + Intergenic
1129718581 15:77865639-77865661 CAAGGGAAACAGATGGTAGAAGG - Intergenic
1129792644 15:78351720-78351742 CAGGTAAAACAGAAAGAACAAGG + Intergenic
1130460347 15:84155227-84155249 CAAGGGAAACAGATGGTAGAAGG + Intergenic
1130712950 15:86301964-86301986 GAGGAAAAACAAATTTAAGATGG - Intronic
1131072970 15:89477453-89477475 CAGGAAGAAGGGATGGGAGAAGG + Intronic
1131101303 15:89691980-89692002 CTGGAAACACAGCTGGAATATGG + Intronic
1131693130 15:94847405-94847427 CAGGATAATCAGATGTAGGAGGG - Intergenic
1132536334 16:482936-482958 CAGGAAAGTCAGCTGGAACAGGG - Intronic
1133999930 16:10775060-10775082 TCGGAAAAACAGGTGGAAAAAGG + Exonic
1134079856 16:11317206-11317228 CAGGAGACACAGCTGGAAGGAGG + Intronic
1134811631 16:17172221-17172243 AAGGAAAGAGAAATGGAAGAGGG - Intronic
1135208876 16:20507173-20507195 CAGGACACACTGATGCAAGAGGG + Intergenic
1137346689 16:47668444-47668466 CATGAAAAAGAGATGGAAAGGGG + Intronic
1137406888 16:48196279-48196301 CAGGAGGAGGAGATGGAAGAAGG - Exonic
1137483977 16:48876439-48876461 CAGGAGAAAGAGATGAAACAAGG - Intergenic
1137882263 16:52062381-52062403 CTGGCAATGCAGATGGAAGAAGG - Intronic
1138137666 16:54537476-54537498 CAGGAAAAACTGCTGGGAGCAGG - Intergenic
1138490299 16:57372609-57372631 CAGGACAGTCAGATGGCAGAAGG - Exonic
1138750979 16:59420672-59420694 TAGTAAAAGCAGGTGGAAGAGGG - Intergenic
1138897331 16:61222621-61222643 GAGGAAAACCAGAAGGTAGAAGG - Intergenic
1138923858 16:61566959-61566981 TAGAAAAAGCAGGTGGAAGAAGG - Intergenic
1140484794 16:75285121-75285143 CCTGAAAAACAGGTGTAAGAAGG + Intergenic
1140582243 16:76245203-76245225 AAAGAAAAACAGAAGGAAGTGGG + Intergenic
1140665687 16:77225132-77225154 CAGGAGAGACAGAAGGAAAATGG - Intergenic
1140845709 16:78885266-78885288 AAGAAAATACAGATGGAAGAAGG - Intronic
1141322491 16:83025038-83025060 TAGAAAAATCAGCTGGAAGAAGG + Intronic
1141368922 16:83469444-83469466 CAGGAAAAACATATTGAGGCTGG + Intronic
1141827104 16:86488267-86488289 CCCCAAAAACAGGTGGAAGAGGG - Intergenic
1141898342 16:86972839-86972861 AAGCAAAGACAGATGGTAGATGG + Intergenic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1143262937 17:5613865-5613887 AAGGAAAAGCAGGAGGAAGAGGG + Intronic
1143455353 17:7064191-7064213 CAAGAAAAACAGGGCGAAGAGGG + Intergenic
1143881892 17:10036180-10036202 CAGGAAAAGCGGATGGGAGGAGG - Intronic
1143902405 17:10184118-10184140 CAGGAAAAACATATGCAACGGGG - Intronic
1144813242 17:18015519-18015541 CAGGAACAAGAGAAGGCAGAAGG + Intronic
1144856312 17:18270274-18270296 CCAGAACAACAGGTGGAAGAAGG - Intergenic
1145103307 17:20094501-20094523 GATGAAAAACAGCAGGAAGAGGG - Intronic
1146122456 17:30207732-30207754 CAGGAGAAACAGAGGGCTGATGG + Exonic
1146573827 17:33974875-33974897 CAGGAAAAGCTGAGGGATGAGGG - Intronic
1147205107 17:38831815-38831837 AAGGAAAAAAGGAAGGAAGAAGG - Intergenic
1147745443 17:42691783-42691805 CTAGAAAAGCAGATGGAGGAAGG - Intronic
1148552150 17:48556865-48556887 CTGGCAGAAGAGATGGAAGATGG + Intronic
1149096741 17:52850856-52850878 AATGAAATAAAGATGGAAGATGG - Intergenic
1149540910 17:57467529-57467551 AAGGAAGAACTGATGAAAGATGG + Intronic
1150206510 17:63412623-63412645 GAGGAAAAAAAAATGGATGAAGG - Intronic
1150518394 17:65838493-65838515 CAGGAAAATCAGTTCAAAGAGGG + Intronic
1150645689 17:66976317-66976339 GAGGAAAGACAGAGGGAGGAGGG - Intronic
1150915207 17:69429787-69429809 CAGGATAATCTGATGGATGATGG - Intronic
1151315596 17:73320147-73320169 CAGTAAAAAGAGAAGGAAGGAGG - Intergenic
1151937312 17:77270522-77270544 CAGGAAAAACAGAGGGCTGAGGG - Intergenic
1152322916 17:79618321-79618343 CAAGACAAGGAGATGGAAGACGG - Intergenic
1152513007 17:80803082-80803104 CAGGATAAACAGATCCAAGGAGG - Intronic
1152529542 17:80909221-80909243 AAGAAAAAAAAAATGGAAGAAGG - Intronic
1152768424 17:82153200-82153222 CTGGTAAAACAGATTGCAGATGG + Intronic
1152772555 17:82179241-82179263 CAGGAAAAGCAGAGGCACGATGG + Intronic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1153140313 18:1964645-1964667 TGGGAAAAACAGCTGGAAAAAGG + Intergenic
1153960114 18:10133301-10133323 CAGGAGAAACCCATGGCAGATGG + Intergenic
1154453544 18:14501248-14501270 CAGGAAAAGCAGATGGCACTGGG - Intergenic
1155363509 18:25027832-25027854 TAGGGAAAACAAAAGGAAGAAGG + Intergenic
1155442008 18:25871873-25871895 AAAGAAAAAGAGAAGGAAGAAGG + Intergenic
1156008279 18:32469564-32469586 CAGAATAAACAGTTGGAGGAAGG + Intronic
1156191886 18:34729739-34729761 CACAAAGAAAAGATGGAAGATGG + Intronic
1156330374 18:36115852-36115874 CAGGAAAAACAGGAGAAACATGG + Intronic
1156824835 18:41418568-41418590 CAGGAATAAAAGAGGGAAGAAGG - Intergenic
1157110481 18:44816068-44816090 CAGGGACAATAGATGAAAGAAGG + Intronic
1157433169 18:47646921-47646943 CAGGAAAGGCAGGAGGAAGAAGG - Intergenic
1157824736 18:50802542-50802564 CAGGTAAACCAGAGGGAGGAGGG + Intronic
1158079886 18:53577278-53577300 CAGGAGAAAGAGAGGGAAGCAGG - Intergenic
1158106566 18:53891344-53891366 CAGGAAAGACAGAGGAAACAAGG + Intergenic
1158107270 18:53899861-53899883 CAGGAAAGAGAGATTGAAGGGGG - Intergenic
1158207646 18:55011277-55011299 CAGGAAATACACATGGTGGAAGG - Intergenic
1158501789 18:58008855-58008877 CAGGAAAAGCATATGGGAGTGGG + Intergenic
1158857244 18:61554873-61554895 AAGGAAACCCAGAAGGAAGAGGG + Exonic
1159116490 18:64119245-64119267 GAGGAAGAACAGAAGGAAGGAGG + Intergenic
1159529619 18:69639142-69639164 TAGGAAAAACAGATGAACCAAGG + Intronic
1159583427 18:70260768-70260790 AAGGGAAAACAGATGGAAAGTGG + Intergenic
1159978513 18:74746646-74746668 CAAGATACAGAGATGGAAGATGG - Intronic
1160068842 18:75606561-75606583 CAAAAAAAAAAGGTGGAAGAGGG + Intergenic
1161412941 19:4126954-4126976 TAGGCAAAACAGAAGGAACATGG - Intergenic
1162090430 19:8276218-8276240 AATGAAAAAGAGATGGAAGCGGG - Intronic
1162092663 19:8291051-8291073 AATGAAAAAGAGATGGAAGCGGG - Intronic
1162164954 19:8745997-8746019 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162166025 19:8753461-8753483 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162167091 19:8760917-8760939 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162169100 19:8774673-8774695 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162595201 19:11623269-11623291 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1163894815 19:20049452-20049474 CAGGAAAAACTAGTGGAGGATGG + Intergenic
1163933823 19:20423906-20423928 CAGGGAAAGAAGAGGGAAGAAGG + Intergenic
1164073505 19:21791387-21791409 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1164230870 19:23287096-23287118 TAGGAAAAAAAAAAGGAAGAAGG + Intergenic
1164887579 19:31795492-31795514 CAGGAAGGAAAAATGGAAGATGG - Intergenic
1167188777 19:47967831-47967853 CAAGCAACACAGATGGAAGTAGG - Intergenic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167406120 19:49309913-49309935 AAGGAAAAAGAAATGGGAGAGGG - Intronic
1167808630 19:51809015-51809037 CTGGAAAAACAGATAGAAAAGGG - Intronic
1167882849 19:52476477-52476499 CTGGAAAAACAGATAGAAAAGGG - Intronic
1167924297 19:52810731-52810753 GAGGAAAAAAAGAGGAAAGAAGG + Intronic
1168011070 19:53533144-53533166 CAGGAAAAGCAGTTCTAAGAGGG - Intronic
1168102296 19:54147734-54147756 AAGGAAAAACAGCTGGAAATTGG - Intronic
925443319 2:3907074-3907096 AGGGAAAAACGGAGGGAAGAAGG - Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
925720479 2:6821892-6821914 CAGGAAACAAAGACGGAAGGAGG - Intergenic
925768891 2:7263252-7263274 AAGGAAAGAAAGATGGATGAAGG - Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
926271108 2:11366716-11366738 ATGGAAAAAAACATGGAAGAGGG - Intergenic
926364054 2:12116664-12116686 GCTGAGAAACAGATGGAAGAAGG + Intergenic
926534358 2:14092511-14092533 CGGGAAGAAAAGAGGGAAGATGG + Intergenic
926719307 2:15947518-15947540 CAGAATAAACAGATGGAAATGGG + Intergenic
926747021 2:16167188-16167210 CAGAAAACTCAGATAGAAGAGGG - Intergenic
926899985 2:17740245-17740267 TAGGAGAAACAGATGGACAAGGG - Intronic
927477711 2:23426440-23426462 GGGGAAAAGCTGATGGAAGAGGG - Intronic
927842244 2:26453158-26453180 CAGGAGAAAGAGTGGGAAGAAGG - Intronic
927877330 2:26666998-26667020 AAGGAAAGAGAGAAGGAAGAAGG - Intergenic
928117916 2:28560992-28561014 CAGGAATAACAGGAGGATGAGGG - Intronic
928264517 2:29800437-29800459 CACATAAAACAGTTGGAAGAAGG + Intronic
928324829 2:30311157-30311179 CAGGAAAATGAGAGGGAGGAGGG + Intronic
928334497 2:30384787-30384809 AAGGGAAATCAGATGGAAAAGGG + Intergenic
928696030 2:33851179-33851201 ATGGAAAAACTGATTGAAGAAGG + Intergenic
928704334 2:33931410-33931432 CAGGAAAAAGAGCAGCAAGATGG - Intergenic
928795028 2:35007773-35007795 CAGGATAAACAGGTGAAAGGAGG + Intergenic
929120648 2:38481372-38481394 CAAGAAAAACAGATAGAGGAAGG + Intergenic
929389897 2:41458005-41458027 CATGAAAAACTGATGAAAGATGG - Intergenic
929419810 2:41779092-41779114 CCAGGGAAACAGATGGAAGAGGG + Intergenic
929437479 2:41939572-41939594 TAGGAAGGACAGATGGATGAGGG - Intronic
929960494 2:46492609-46492631 CAGGCATAGCAGATTGAAGAGGG - Intronic
930225684 2:48790194-48790216 CAGACACAGCAGATGGAAGAAGG + Intergenic
930868875 2:56149897-56149919 CAGGAAGAACAGAATGAAGGTGG + Intergenic
931322252 2:61182495-61182517 AAGGAAGAAGAGAGGGAAGAAGG - Intronic
931992014 2:67799896-67799918 AGGGAAAAGCATATGGAAGAAGG + Intergenic
932539370 2:72636274-72636296 AAGGAAAAATGGAGGGAAGAAGG + Intronic
932933468 2:76072970-76072992 CAGCAAAAGCAGTTGTAAGAGGG + Intergenic
932965554 2:76470963-76470985 CAAGAAAAGCAGATAAAAGAAGG + Intergenic
933469544 2:82703844-82703866 AAGGAAAAACTGATGGTAGTTGG + Intergenic
934033087 2:88065280-88065302 CAGAAAAAAAAGAGGGAAGGGGG - Intergenic
935358456 2:102226694-102226716 GAGGGAAAACGGAGGGAAGAAGG + Intronic
935410596 2:102757881-102757903 CAGGAAAAAGAGAGTGAAGTGGG + Intronic
936255094 2:110904440-110904462 CAGGAAAGACAGAGGCAGGAGGG - Intronic
936376547 2:111946065-111946087 CAGGGAGCACAGATGGAAGGAGG + Intronic
936499860 2:113058684-113058706 CAGGAAAGACAGAGGAAGGAAGG + Intronic
936628768 2:114177514-114177536 CAAAAAAAAAAAATGGAAGAAGG - Intergenic
936984912 2:118300010-118300032 CAGGAAAAACTGAAAGGAGAGGG + Intergenic
937615835 2:123921358-123921380 AAGGAAAGAAAGAAGGAAGAAGG + Intergenic
937665701 2:124484357-124484379 CAGGAAATATATATGGATGAAGG + Intronic
937792941 2:125981656-125981678 CAGGGAAACCATTTGGAAGATGG - Intergenic
937800970 2:126079841-126079863 CAGAAAAAACAGAGAGAAGGAGG + Intergenic
937846896 2:126588609-126588631 CAAGAAAAATAGATGGCATAAGG + Intergenic
938572373 2:132572236-132572258 CAAGAACACCAGACGGAAGAAGG - Intronic
938731102 2:134148459-134148481 AAGGAAGAAGAGAGGGAAGAAGG - Intronic
938800098 2:134754828-134754850 CAGCAAAAGCAGTTGTAAGAGGG + Intergenic
938929486 2:136074194-136074216 CTGGAAAAACAGATAGAAAAGGG - Intergenic
939131245 2:138237980-138238002 AAGGAAATACAGTTGGAAGAAGG - Intergenic
939183637 2:138833679-138833701 AAGGATAAAGAAATGGAAGAAGG - Intergenic
939244530 2:139606624-139606646 CAGCAAAAACAGTAGTAAGAGGG - Intergenic
939355455 2:141095827-141095849 CATGAATATCAGATGGAGGAGGG - Intronic
939655772 2:144822509-144822531 CATGAATCACAAATGGAAGAGGG + Intergenic
939706822 2:145465172-145465194 CAGGAAAAGAAGAAGAAAGAAGG + Intergenic
940405133 2:153292700-153292722 CAGGGAAAAGAGATGGAACCAGG + Intergenic
940506641 2:154563363-154563385 CAGAAAAAACAGATGTAAAAGGG - Intergenic
940518958 2:154718105-154718127 CAGGAAAAACTAATGGCACATGG + Intronic
941198587 2:162480840-162480862 AAGGAAAAAGAGGTGGAAAAAGG + Intronic
941467872 2:165851965-165851987 CAGTAAAAATAGATAGAAAAAGG - Intergenic
942695407 2:178636966-178636988 CAGGAAAATGAGATGGTATAAGG + Intronic
942929492 2:181472794-181472816 AGGGGAAAACAGAGGGAAGATGG - Intronic
943113967 2:183643246-183643268 AAAAAAAAAAAGATGGAAGATGG - Intergenic
943128603 2:183827988-183828010 CAGGAAAGAGAGAGTGAAGAGGG + Intergenic
943575933 2:189631076-189631098 GAGGAAAAACAAAAGGAAGGAGG + Intergenic
943828019 2:192420804-192420826 CAGGCAAGACAGAGTGAAGATGG - Intergenic
944397721 2:199288439-199288461 CAGGGGAAAGAGATGAAAGAAGG + Intronic
944737575 2:202581696-202581718 CAGCAAAAGCAGTTAGAAGAGGG - Intergenic
944937578 2:204585136-204585158 CAAGAAAACAAGAGGGAAGAGGG - Intronic
945460457 2:210101881-210101903 CAGGAAAATTAGATGCAAGCAGG + Intronic
945632742 2:212302936-212302958 TAGGAAGAAAAGATGAAAGAGGG + Intronic
946130611 2:217603817-217603839 GACGAAAAACAGAGTGAAGAAGG + Intronic
946460035 2:219860810-219860832 AAGGAAAAAAAGAAGGAAGAAGG + Intergenic
946626577 2:221618489-221618511 TAGAAAAAACGTATGGAAGATGG + Intergenic
946760146 2:222985457-222985479 TAGGCTAAACACATGGAAGATGG + Intergenic
946919637 2:224565388-224565410 CAGGCACAAGAGATGGAGGAGGG + Intronic
947014178 2:225599666-225599688 CCAGTAAAACTGATGGAAGAAGG + Intronic
947248341 2:228074976-228074998 GAGGAAAAAGAGAAGGAGGAAGG + Intronic
947692948 2:232156446-232156468 CAAGAAAAAGAAATGGCAGAAGG - Intronic
947880428 2:233505183-233505205 CAGCAAAAACAGTTCTAAGAGGG + Intronic
948458425 2:238117972-238117994 GAGGAGAAATAGATGGAGGAAGG + Intronic
948743032 2:240060661-240060683 ATGGAAAAACTGATTGAAGAAGG - Intergenic
948945137 2:241215513-241215535 CAGGAATAGCAGTTGGGAGATGG + Intronic
1169750137 20:8983337-8983359 TAGGAAAAAGAGTTGGAGGATGG - Intergenic
1169974476 20:11307959-11307981 CAGGAAAAAAATATGGACTAAGG + Intergenic
1170010835 20:11721896-11721918 AAGCAAAAGCAGATGGAACAAGG + Intergenic
1170280323 20:14639220-14639242 CAGGAAAAAAAGAAAGGAGAGGG - Intronic
1170706499 20:18749010-18749032 CAGGCAAAAGAGGAGGAAGAGGG + Intronic
1170926352 20:20727944-20727966 CTGGAAGGACAGAGGGAAGAGGG + Intergenic
1171078286 20:22151459-22151481 CAGAACAAAAAGATGGAGGAAGG - Intergenic
1171370883 20:24661358-24661380 GAGGGAAAACCGAGGGAAGAGGG + Intronic
1172017332 20:31885470-31885492 CTGGATAAACATATGGAAAATGG + Intronic
1172336298 20:34119092-34119114 CAAGAAAAAGATATGGGAGAAGG - Intergenic
1172477800 20:35252059-35252081 CAGGAAAAACAGAGTGAGGGTGG - Intronic
1172572649 20:35982518-35982540 GTGGACAAAGAGATGGAAGAGGG - Intronic
1173186008 20:40840801-40840823 AAGGAAAAACAGAAGGAAGGAGG + Intergenic
1173372173 20:42446861-42446883 CAGGATTACCAGATGGAAGGAGG - Intronic
1173684872 20:44916250-44916272 AAGAAAAAACAGATTTAAGAGGG - Intronic
1174166444 20:48586910-48586932 CAGTACAAGCAGCTGGAAGACGG - Intergenic
1175238894 20:57532028-57532050 CAGGAAAAACAGCTGGGAGTGGG + Intergenic
1175354403 20:58352044-58352066 CATGAAAACAAGGTGGAAGAAGG + Intronic
1175663131 20:60834832-60834854 GAGGAAAAACAGTTGCAGGAGGG - Intergenic
1175738848 20:61406452-61406474 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175738853 20:61406480-61406502 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175738867 20:61406550-61406572 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175738880 20:61406620-61406642 CAGGCAGAACAGATGGCAGATGG - Intronic
1175738895 20:61406690-61406712 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175738942 20:61406921-61406943 CAGGCAGAGCAGATGGCAGATGG - Intronic
1176525259 21:7861534-7861556 CAGGAAATACAGAGGAGAGAAGG - Intergenic
1176970013 21:15254103-15254125 CAGGGAAAACAGAGGAAAGGAGG + Intergenic
1177955104 21:27588486-27588508 CAAGGAAAAAAGATGGAAGAAGG + Intergenic
1178005140 21:28210365-28210387 GAGGAGAACCAGATGGATGATGG - Intergenic
1178265311 21:31137634-31137656 CTGGAAAATCACATGGCAGAAGG - Intronic
1178369731 21:32017517-32017539 CAGGCAAAACAGGTGAAACAGGG - Intronic
1178579775 21:33828622-33828644 CAGAAAAAAAAGAAGAAAGAGGG - Intronic
1178659279 21:34491547-34491569 CAGGAAATACAGAGGAGAGAAGG - Intergenic
1179196718 21:39171058-39171080 CAGAAACTACAGATGGATGATGG + Intergenic
1179229543 21:39489037-39489059 CAAGAAGACCAGAGGGAAGAAGG + Intronic
1179336693 21:40463450-40463472 CTGGAAGAACTGATGGAAGAAGG - Intronic
1179638640 21:42732035-42732057 GAAGAAAGACAGATGGAACACGG - Intronic
1181792641 22:25280025-25280047 CAAGAAAAAGAGAAAGAAGAGGG + Intergenic
1181813176 22:25417610-25417632 CAAGAAAAAGAGAAAGAAGAGGG + Intergenic
1182015442 22:27035418-27035440 AAAGAAAAAAAGAAGGAAGAGGG - Intergenic
1182353678 22:29712631-29712653 GAGGACAGACAGATGGCAGAGGG - Intergenic
1182822881 22:33233866-33233888 CAGGAAGAACCAATTGAAGATGG - Intronic
1183240488 22:36654199-36654221 TAGTACAAACAGATTGAAGAGGG - Intronic
1184003850 22:41694655-41694677 GTGGAAATTCAGATGGAAGAGGG + Exonic
1184080815 22:42218780-42218802 CAGGGAAAACAGATACAGGAAGG + Intronic
1184093731 22:42305570-42305592 CAGGACAAATGGATGGATGAAGG + Intronic
1184702451 22:46185185-46185207 GAGTGAAAACAGATGGAACATGG - Intronic
1184747255 22:46463594-46463616 CGGGGAAAACAGCTGGAGGATGG - Intronic
1184821064 22:46909636-46909658 CAGCAGCAACAGAAGGAAGAAGG - Intronic
949091323 3:32944-32966 CAGGAAACTCAGATCTAAGAGGG + Intergenic
949205480 3:1433175-1433197 CAGGAAAAACAGAGAGAGGGAGG - Intergenic
949237414 3:1826652-1826674 CAGGGAAAACACATAGAACAGGG - Intergenic
950134849 3:10573835-10573857 GAGGAAAAGCAAATTGAAGAAGG - Intronic
950623603 3:14227512-14227534 CTGGAAAAACAGATAGAAAAGGG + Intergenic
950860423 3:16142918-16142940 CAGGAAAAACAGAAAGGAAATGG + Intergenic
951399337 3:22212191-22212213 GAGAAAAGACAGGTGGAAGAAGG + Intronic
951575372 3:24107906-24107928 CATGAAACTCAGATAGAAGAAGG - Intergenic
951618347 3:24573173-24573195 GAGAAAAAATACATGGAAGAAGG + Intergenic
951643817 3:24865583-24865605 CAGGACAGAGAGGTGGAAGAGGG - Intergenic
952055489 3:29439952-29439974 CAGGAAGACCAGACGGAAGTCGG + Intronic
952202421 3:31144828-31144850 CAGGGAAAACAGAACTAAGAGGG - Intergenic
952213328 3:31251330-31251352 GAGGATAAAGAGAAGGAAGAAGG + Intergenic
952590117 3:34942518-34942540 AAGGAAAAAGGGAAGGAAGAAGG - Intergenic
952962000 3:38598177-38598199 CAGGAAACAAAGATGGAGGTGGG + Intronic
953032505 3:39187722-39187744 CAGGAACGACAGAAAGAAGAAGG - Exonic
953117096 3:40003959-40003981 CAGAAAAGACAGATGGCAGGTGG - Intronic
953118269 3:40014384-40014406 CAGGAAAATAATATGAAAGATGG - Intronic
953436559 3:42881875-42881897 CAGGAAAAACAGAAGGAACCTGG - Intronic
953654743 3:44841128-44841150 CAAGAACAAGAGATAGAAGATGG + Exonic
953711207 3:45272779-45272801 AAGGAAAAACAGGTGGAAACAGG + Intergenic
953881105 3:46691901-46691923 AAGGACAAACAGGTGGAAGGGGG + Intronic
954172317 3:48814616-48814638 CTGGAAATACAAATGGAACAAGG - Intronic
954843069 3:53530273-53530295 CAGGAAAAATACAGGGAAAAAGG + Intronic
954901291 3:54022204-54022226 CAGGATAGACAGAGGGAACAGGG + Intergenic
955307446 3:57848530-57848552 GAGGAAAAAGGGAAGGAAGAAGG - Intronic
956054511 3:65284339-65284361 CAGGAAGAACAGAGTGAAGGAGG + Intergenic
956643374 3:71435217-71435239 CAGGAAAGAAGGAAGGAAGAAGG + Intronic
957031641 3:75249169-75249191 CAGGAAACTCAGATCTAAGAGGG + Intergenic
957573739 3:81983102-81983124 CAGGAAAAACACATTGAAGAGGG - Intergenic
957928568 3:86847283-86847305 CAGGAAAGGGAGAAGGAAGAGGG - Intergenic
958638277 3:96773932-96773954 CAGCAAAAACAGTTCTAAGAGGG + Intergenic
958742068 3:98086533-98086555 AAGAAACAGCAGATGGAAGAAGG + Intergenic
959152246 3:102621188-102621210 CAGGAGAAAGAGATAGAAGTGGG + Intergenic
959167142 3:102794566-102794588 CTGGAAACACAGAAGGGAGAAGG - Intergenic
959182131 3:102994609-102994631 AAGGAAGAATAGAAGGAAGATGG + Intergenic
959363094 3:105419965-105419987 CTGGATATATAGATGGAAGACGG + Intronic
959440220 3:106365080-106365102 GAGGAAAAAAGGAAGGAAGAAGG - Intergenic
959463043 3:106650552-106650574 AAAAAAAAGCAGATGGAAGAAGG - Intergenic
959905898 3:111711077-111711099 CAGGAAAAACATGGGAAAGAAGG - Intronic
959952998 3:112202178-112202200 CAGAAAAAAATGATGGATGAGGG + Intronic
959962898 3:112320749-112320771 CAGGAAAGAAAGAAAGAAGAAGG + Intergenic
960009275 3:112815809-112815831 AAGAAAAGAAAGATGGAAGAAGG - Exonic
960744992 3:120877662-120877684 AAGGAAAAAGAGGTGGAAGAGGG - Intergenic
960864466 3:122185057-122185079 CAGGAAATACACATGGAGGCTGG - Intronic
960920726 3:122745389-122745411 CAGCAAAAAAAGATGAAATATGG + Intronic
961613767 3:128162646-128162668 CAGGAAAGAAAAATGGAAGCAGG + Intronic
961927812 3:130501075-130501097 CAGGAAGAAGTGTTGGAAGAAGG - Intergenic
962209269 3:133463351-133463373 AAGGAAATACACTTGGAAGAGGG + Intronic
962266516 3:133948220-133948242 CAGGAACAACACAGGAAAGAGGG - Intronic
962907256 3:139815424-139815446 AAGGAAAAATAGAGGGGAGAAGG - Intergenic
962962769 3:140326322-140326344 GAGGCAAGACAGAGGGAAGAAGG + Intronic
963053534 3:141163388-141163410 CCAGAAAAAGAGAGGGAAGAGGG - Intergenic
963217929 3:142771999-142772021 CAGTAGAAACAGATGCCAGAAGG - Intronic
963631001 3:147729652-147729674 CAGGAAAAAGAGAGGGAGGCAGG + Intergenic
963660361 3:148118604-148118626 CAGGAAAAGCAGTTCTAAGAAGG + Intergenic
964027132 3:152088161-152088183 CAGGAAAAACAGCAGGATGGGGG + Intergenic
964139820 3:153384835-153384857 CAGAAAAAACAGAAGCAAGCAGG + Intergenic
964346638 3:155760430-155760452 CAGGAAAGAAAGGTGGCAGAAGG + Intergenic
964472778 3:157072086-157072108 AAGGAAAAAAAGAGAGAAGAAGG + Intergenic
965001847 3:162964107-162964129 CAGGAAACAGAGATGGCAAAAGG - Intergenic
965084505 3:164077476-164077498 CAGGGAAAGCAGAGGGAAAAAGG + Intergenic
965258445 3:166446756-166446778 CAGGAAAAGCTTATGGAATAGGG - Intergenic
967061908 3:185880128-185880150 CAGGTAAAACATGTGGGAGAGGG + Intergenic
967214136 3:187195991-187196013 CAGGAGAAGCACTTGGAAGATGG + Intergenic
967218865 3:187232520-187232542 CTGGAAAAACAAAGGGGAGAAGG - Intronic
967327129 3:188252347-188252369 GAGGAAAAAAAAACGGAAGAAGG - Intronic
969217418 4:5733421-5733443 CAGGAAAAGCATATGGTAGGTGG + Exonic
970266607 4:14295211-14295233 TAGGAAAATCAGATGAATGATGG - Intergenic
970406152 4:15766306-15766328 AAGGAAAAACAACTGGATGAGGG + Intergenic
970486703 4:16531912-16531934 CAGTTCAAACAGATGGAGGAAGG + Intronic
971344583 4:25800019-25800041 CAGGATAGACAGAAAGAAGATGG - Intronic
971523918 4:27591576-27591598 CAGCAAAAACATTTGGAAAAGGG + Intergenic
971603282 4:28623725-28623747 CAGGAATGAGAGATGGAAAAGGG - Intergenic
971797455 4:31246350-31246372 AAGAAAGAACAAATGGAAGAGGG + Intergenic
972103268 4:35447996-35448018 GAGGAAGAAAAGAAGGAAGAAGG + Intergenic
972176869 4:36419166-36419188 AAGAAAACACAGATGGCAGATGG + Intergenic
972709663 4:41582312-41582334 ATGGAAAACTAGATGGAAGATGG + Intronic
973107160 4:46354476-46354498 CAAGAAAAACACAGGGAACAAGG + Intronic
973579532 4:52328555-52328577 CAGCAAAAGCAGTTGTAAGAGGG - Intergenic
973961176 4:56111358-56111380 TAGGAAAAAGGGATGGAGGAGGG + Intergenic
974246371 4:59324645-59324667 AAGAAAAAACATATTGAAGAGGG - Intergenic
974266885 4:59597591-59597613 AAGAAAAAACACATAGAAGAGGG + Intergenic
974297732 4:60024265-60024287 CAGAAACAATAGATGCAAGAAGG - Intergenic
974315660 4:60277391-60277413 CAGCAAAAGCAGTTGTAAGAAGG - Intergenic
974771045 4:66414064-66414086 CAGGAAACACAGATGCTGGAGGG + Intergenic
975389522 4:73800865-73800887 CAGCAAAAACAGTTATAAGAAGG + Intergenic
975432088 4:74305447-74305469 CAGGAAAAAAAGATAGAAAGGGG + Intergenic
975858276 4:78648352-78648374 CAGAAAAGAAAGATGAAAGAAGG - Intergenic
975882757 4:78930254-78930276 CAGAAAAAACATGTCGAAGATGG - Exonic
976298764 4:83498433-83498455 AAGGAAAAAAAGAAGGAAAATGG + Intronic
977030537 4:91876842-91876864 CAGGACACACTGATGGAAGAGGG - Intergenic
977073344 4:92421368-92421390 GAGGAAATACAGATGGAAAAAGG + Intronic
977166703 4:93708765-93708787 CAGGAAAGAAGGAAGGAAGAAGG - Intronic
977292924 4:95182516-95182538 GAGGAGAGACAGATGGAGGATGG + Intronic
977418071 4:96761083-96761105 CAGGAAAAACAGTGCTAAGAGGG - Intergenic
977700911 4:100021749-100021771 GAGGAAAGAAAGAAGGAAGAGGG - Intergenic
977932015 4:102759979-102760001 CAGCAAAAGCAGTTGGAGGATGG + Intronic
978214254 4:106179388-106179410 CAGCAAAAACAGTTCTAAGAGGG - Intronic
978482542 4:109210741-109210763 CAGGGGAAACAGCTGGAACATGG - Intronic
978957989 4:114638520-114638542 CAAGGAAAACAGATGGAGGGAGG - Intronic
979502173 4:121453236-121453258 AAGGAAAAAGAAAGGGAAGAAGG + Intergenic
979909542 4:126344542-126344564 AAGGAAAAAGAGAGGGAAGGAGG + Intergenic
980094249 4:128473188-128473210 GAAGAGAAACAGATTGAAGATGG + Intergenic
980096241 4:128494013-128494035 CAGAAAAGAAAGAAGGAAGAGGG - Intergenic
980239749 4:130158383-130158405 TAGAACAAAAAGATGGAAGAAGG + Intergenic
980269271 4:130563416-130563438 CAGGAAAAATTGAAGGAAAATGG - Intergenic
980792145 4:137633432-137633454 TAGAAAAAGCAGGTGGAAGAAGG + Intergenic
982068635 4:151675706-151675728 CAAGACAAACAGATGTAACAAGG + Intronic
982434415 4:155367269-155367291 CAGAGAAAACACAGGGAAGAAGG + Intronic
982475013 4:155839825-155839847 CAGAAAAAAAAGATGGTAGATGG + Intronic
982829335 4:160041790-160041812 CAGGATGAAAAGATGGCAGAAGG + Intergenic
982972354 4:162005190-162005212 CAGGAAACAGAGCTGGAAGTTGG - Intronic
983583425 4:169331339-169331361 AAGGAAAAACAGAAGGGATAAGG - Intergenic
983890021 4:173021120-173021142 GAGGAAAGACAGAGGGGAGAGGG - Intronic
984046919 4:174812828-174812850 TAGGAAAAAAAGACGGAGGAAGG - Intronic
984125407 4:175803131-175803153 GAGGAGAAAGAGAAGGAAGAGGG - Intronic
984237555 4:177179060-177179082 CAGGAAGAGCAGATGGAAGATGG - Intergenic
984287597 4:177752453-177752475 CAGTAAAAGCAGTTGTAAGAGGG + Intronic
984510612 4:180674103-180674125 CAGGAGAAGCAGGTGAAAGATGG + Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
984998867 4:185465433-185465455 AAGGAAGAAGAGATGGAAGATGG - Intronic
985132249 4:186750455-186750477 CAGGAAAACCAGATAGTGGATGG + Intergenic
985416178 4:189737913-189737935 CAGGAAAATCAGAAGGATGCTGG + Intergenic
1202762946 4_GL000008v2_random:127364-127386 GAGGAAAAGCAGATGGCAGTTGG - Intergenic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985818271 5:2142779-2142801 CAGAAAACACACAGGGAAGAAGG - Intergenic
986054415 5:4121632-4121654 CAGCAATAACAGATGGAAGTTGG - Intergenic
986202776 5:5593023-5593045 GAGGAAAAAAAGAAGGAAGCTGG - Intergenic
986750743 5:10785412-10785434 CAGGGGAAACAGATAGAACAGGG + Intergenic
986879083 5:12147813-12147835 AAGGAAAGAAAGAGGGAAGAAGG - Intergenic
987793077 5:22593408-22593430 CAGGGAAAACAGGAGAAAGAAGG - Intronic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
988268773 5:28986889-28986911 CTGGAAAAAATGATGAAAGAAGG - Intergenic
988717501 5:33842638-33842660 CTGGAAAAACAGAGGAAAGTGGG + Intronic
988962689 5:36385455-36385477 CAAGAAAAACAGAAGTAACAAGG - Intergenic
989123496 5:38028203-38028225 GAGGAAAAACAGAAAGAAGTTGG + Intergenic
989202065 5:38773549-38773571 CAGAAGGAACAGATGGAGGAAGG + Intergenic
989236724 5:39156426-39156448 CAGCAAAACCAGAGGGAAGCAGG + Intronic
989665227 5:43846301-43846323 AAGGAAAAAGAGAGGGAGGAAGG - Intergenic
990004142 5:50924777-50924799 CAGCAAAAGCAGATCTAAGAAGG + Intergenic
990027621 5:51214420-51214442 AAGGAAAAAGAGATGCAAAATGG + Intergenic
991179247 5:63729745-63729767 TAGGAAACATAGATGGAAGTAGG + Intergenic
991474270 5:67003473-67003495 GAGGATAAAGAGAAGGAAGAGGG - Intronic
991557881 5:67915808-67915830 CACATAAAACAGATGGAAAATGG - Intergenic
991912465 5:71575258-71575280 CTGGAAAAACAAATAGAAAAGGG + Intergenic
992464434 5:76989858-76989880 GAGCAAAAAAAGGTGGAAGAAGG - Intergenic
992675659 5:79103454-79103476 AAAAAAAAACAAATGGAAGAGGG + Intronic
993275505 5:85851418-85851440 CAGGAAAAAGAGAGAGAAGGAGG + Intergenic
994259214 5:97637059-97637081 CAGGAAAAAAAGATTAAAGTTGG - Intergenic
994311923 5:98282953-98282975 TAGGAAACACAGAAGGAAGAAGG - Intergenic
994549525 5:101213181-101213203 CAGAAAAAGCAGGTGGTAGAAGG + Intergenic
994626348 5:102224896-102224918 CAAGGAAAAGAGAGGGAAGAAGG + Intergenic
995796794 5:115949752-115949774 AAGGAAAACCAGATAGAAGAAGG + Intergenic
995918705 5:117284142-117284164 CAGGAGAAGCAGATTGAACACGG - Intergenic
997653457 5:135538535-135538557 CTCAAAAAACAGATGGAACAAGG - Intergenic
997665319 5:135625718-135625740 CAGGTAGAACAGGGGGAAGAAGG + Intergenic
997845893 5:137285646-137285668 CAGGAAAAAGACATGAAACATGG + Intronic
1000046210 5:157523986-157524008 CAGGAACAGCAGTTGGAGGAAGG - Intronic
1000046517 5:157526255-157526277 CAGTAATAACAGATGGAGAATGG + Intronic
1000412893 5:160952203-160952225 CAGGAAAATCAAGTGGAGGAGGG + Intergenic
1000451524 5:161394808-161394830 CAGAAAATAGAGAAGGAAGATGG + Intronic
1000452615 5:161408712-161408734 AGGGAAAAACAGAGGGAAGGAGG + Intronic
1000918949 5:167116164-167116186 AAGGATAAACAGAAGGAAGTAGG + Intergenic
1000969323 5:167696608-167696630 TAGGAAAAACAGATGGTGAAAGG + Intronic
1001848772 5:174944541-174944563 CAGTAAAAAGACATGGAGGATGG + Intergenic
1001893818 5:175361913-175361935 GAGGAAAAAGAGAAGGAAGAGGG + Intergenic
1001906192 5:175475644-175475666 TGGGAAAAGCAGATGGATGAAGG - Intergenic
1002110636 5:176908404-176908426 CAAGATAAATAGAGGGAAGAGGG + Intronic
1002551683 5:179998232-179998254 CAGCAAAAGCAGTTTGAAGAAGG - Intronic
1002971101 6:2021035-2021057 CAGGAGAAGCAGCTGGGAGAAGG - Intronic
1003142597 6:3483952-3483974 CGGGAAACAAAGATGGAAGCAGG + Intergenic
1003341471 6:5225293-5225315 CAGGTAAAAAAGATGTAAGGTGG + Intronic
1003833764 6:10044249-10044271 CAGAAAACACACAGGGAAGAAGG - Intronic
1004293653 6:14390555-14390577 CAGGGGAAAAAGATGGTAGAAGG + Intergenic
1004325284 6:14668978-14669000 CATTAAAAACAGATCGATGATGG + Intergenic
1004378752 6:15114380-15114402 AAGGACACACAGATGGTAGATGG + Intergenic
1004634995 6:17458277-17458299 CAGGATAAAGAGAAAGAAGATGG + Intronic
1004673943 6:17823437-17823459 AAGGAAAAAGAGAGGGAGGAAGG - Intronic
1004759687 6:18652815-18652837 AACGAAAAACAAATGGAAGGAGG + Intergenic
1004798165 6:19113116-19113138 AAAGAAAAAGAGAAGGAAGAAGG - Intergenic
1005500614 6:26426141-26426163 AAGGAAAAAAAGAGGGAAGTAGG - Intergenic
1005740397 6:28785782-28785804 AAGGAAAAGAAGATGTAAGAAGG - Intergenic
1005995386 6:30927869-30927891 CAGGAAAATAAGATTGAAGGAGG - Intergenic
1006219462 6:32476269-32476291 TGGAAAAAACAGATAGAAGAGGG - Intergenic
1006228787 6:32564302-32564324 CTGGAAAAACAGATAGAAAAGGG - Intronic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007263771 6:40582197-40582219 CAGGAAACATGGAAGGAAGAGGG + Intronic
1007650793 6:43419625-43419647 CTGGAAAATTAGGTGGAAGAAGG + Intergenic
1007814601 6:44512443-44512465 CAGAAAAGACAGAATGAAGAAGG + Intergenic
1008483871 6:52014554-52014576 CTGGATAAACAGATGGATCATGG + Intronic
1008858310 6:56117924-56117946 CAGCAAAAACAGTAGTAAGATGG + Intronic
1008898191 6:56581544-56581566 GAGGAAAAAAAGGTGGAAGCAGG + Intronic
1008914776 6:56775143-56775165 CAGGAAGAACAGAAAGAACAAGG + Intronic
1008938288 6:57016664-57016686 CAGGAAAAAGAGACAGAAGAGGG - Intronic
1009434163 6:63599329-63599351 TAGGAAAAACAGACTGAAGTAGG + Intergenic
1009437902 6:63638480-63638502 CAGAAAAAACATATGTAAAAAGG - Intronic
1011719865 6:90144357-90144379 AGGGAAAAACAGAGGGAAGGAGG + Intronic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012279741 6:97314586-97314608 CAGAAAGATCATATGGAAGAAGG - Intergenic
1012633413 6:101502993-101503015 GAGGAATAACAGATGGAGGTGGG + Intronic
1012779245 6:103535886-103535908 TCAGAAAAACAGAGGGAAGAGGG - Intergenic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1013784464 6:113764334-113764356 CAGCAACAACAGATGGAAATGGG + Intergenic
1014042846 6:116849879-116849901 TAGAAAAAGCAGGTGGAAGAAGG + Intergenic
1014498974 6:122163150-122163172 TAGGAAAAGCAGGTGGAAGGTGG - Intergenic
1014505546 6:122249649-122249671 TAGGAAAGAAAGAAGGAAGATGG + Intergenic
1014616576 6:123608870-123608892 CATGAAAAAAAAATGGAAGCAGG + Intronic
1014688276 6:124530894-124530916 TAGAACAAAAAGATGGAAGAAGG - Intronic
1014828245 6:126071029-126071051 CATGAAGAACATGTGGAAGAAGG + Intergenic
1014855845 6:126399500-126399522 AAAGAAAAACAGATGTAAAATGG - Intergenic
1014855847 6:126399556-126399578 AAAGAAAAACAGATGTAAAATGG - Intergenic
1014884637 6:126764791-126764813 AGGGGAGAACAGATGGAAGAGGG + Intergenic
1014890091 6:126833452-126833474 AAGGAAAAAAGAATGGAAGAAGG + Intergenic
1015382846 6:132589303-132589325 AATGAAACAGAGATGGAAGATGG + Exonic
1016086971 6:139926367-139926389 CACAAAACGCAGATGGAAGAGGG - Intergenic
1016483913 6:144513557-144513579 AAAGAAAAAAAGATTGAAGAGGG + Intronic
1016839941 6:148516179-148516201 CAGGCTTCACAGATGGAAGATGG + Intronic
1017041134 6:150309327-150309349 AAGGAAAGACAGAAGGAAGGAGG + Intergenic
1017047191 6:150357671-150357693 AAGGAAATAGAGATGGCAGAGGG + Intergenic
1017684993 6:156904233-156904255 GAGGAAAAAAATATGGAAGAAGG - Intronic
1017894560 6:158668114-158668136 CAGTAAGAACAGAGTGAAGATGG + Intronic
1017912803 6:158808758-158808780 CAGGATAAATAGAGGGAAGAAGG - Intronic
1018087038 6:160311360-160311382 CAGCAAAAACAGTTCTAAGAGGG - Intergenic
1018302581 6:162419046-162419068 CAGGAAAAGCAGGTGCAAGCAGG + Intronic
1018550768 6:164996138-164996160 CAGCAAAAACATAAGGAAGAGGG + Intergenic
1018614431 6:165673180-165673202 CAGATAAACTAGATGGAAGAAGG + Intronic
1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG + Intronic
1018831988 6:167450293-167450315 CAGGAAAAAAAGATGTAATGAGG - Intergenic
1020085814 7:5309534-5309556 CATGTCAAAGAGATGGAAGAGGG - Intronic
1020412863 7:7912415-7912437 AAAGAAAAACAAAGGGAAGAAGG - Intronic
1020507514 7:9011394-9011416 CAGCAAAAACAGAACTAAGAGGG - Intergenic
1020649584 7:10857964-10857986 CTGCAATAACAGATGGGAGAAGG + Intergenic
1020766575 7:12329366-12329388 CAGGAAAAAGACCTGGAAAAGGG + Intergenic
1020986043 7:15135845-15135867 GAAGAAAGACAGCTGGAAGAAGG - Intergenic
1021059991 7:16099457-16099479 CAGGAAAAACATAAGGAGAAGGG + Intronic
1021263818 7:18494382-18494404 CAGAACAATCCGATGGAAGAGGG - Intronic
1021773086 7:24024757-24024779 CAGGCTGAACAGATGGAACACGG - Intergenic
1022030092 7:26484659-26484681 CAGGAAATACATATGGCTGAAGG - Intergenic
1022309005 7:29177621-29177643 ATAGATAAACAGATGGAAGAAGG - Intronic
1023087078 7:36581503-36581525 TTGGAAAAACAGATGGGAAATGG + Intronic
1023284853 7:38608435-38608457 CAGTGAAAAAAGGTGGAAGAAGG - Intronic
1023480745 7:40631388-40631410 CAGGAAAAACAAATGTCACATGG - Intronic
1024907904 7:54409795-54409817 CAGAAAAGACACATTGAAGAGGG + Intergenic
1026148868 7:67771512-67771534 CATGAACAAGAAATGGAAGAGGG - Intergenic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1026671188 7:72392035-72392057 CAAGAGAAACAGATGGAACCCGG - Intronic
1026742250 7:72986186-72986208 CAGGAAAGGCAGATGGGGGAGGG - Intergenic
1026802098 7:73406606-73406628 CAGGAAAGGCAGATGGGGGAAGG - Intergenic
1027028374 7:74870925-74870947 CAGGAAAGGCAGATGGGGGAAGG - Intergenic
1027101485 7:75378892-75378914 CAGGAAAGGCAGATGGGGGAGGG + Intergenic
1027542697 7:79487925-79487947 CATGACAAACAGATGGATGGAGG - Intergenic
1027665158 7:81035700-81035722 CAGAGAAAACAGATTGAATATGG + Intergenic
1028338678 7:89691076-89691098 CAGGAAAAACTGATGCTACAAGG + Intergenic
1028569716 7:92273613-92273635 AAGGGAAAACAGATGGAAGATGG + Intronic
1028638928 7:93021763-93021785 CAGGAAAAAGAGAAGGAGAAAGG + Intergenic
1029175691 7:98662805-98662827 CAGGAAAGACAGCTGAAACAAGG + Intergenic
1030230007 7:107197883-107197905 CAGGAAAAACAAATTGAGCAAGG - Intronic
1030552294 7:110977726-110977748 CAGGAAAAAGAAAGGAAAGAAGG - Intronic
1030562483 7:111107194-111107216 GAGGAAAGAGAGAAGGAAGAAGG - Intronic
1030829236 7:114200462-114200484 CAGGAAACACTGAAAGAAGAAGG + Intronic
1031448093 7:121879786-121879808 AAGGAAAAATAGAAGGAAGGAGG - Intronic
1031895746 7:127346758-127346780 AAGGATAAACAGAAGGAAGCAGG + Intergenic
1032259134 7:130320707-130320729 AAGGAAATACAGATGGAAAATGG - Intronic
1032503288 7:132416198-132416220 CAGGATAACCAGCTGGAGGAAGG + Intronic
1032644349 7:133805828-133805850 AAGGAAGAAGGGATGGAAGAAGG + Intronic
1032803875 7:135337514-135337536 CAGGAACAGCAGCTGGAAGAAGG + Intergenic
1033549274 7:142431814-142431836 CAGTAAGAACAGATGGAACTGGG + Intergenic
1033625064 7:143102491-143102513 AAGGAAAAAAATATGGAAGAGGG + Intergenic
1033728690 7:144150314-144150336 CAGAAAAAACAGTTCTAAGAGGG + Intergenic
1033832600 7:145271570-145271592 GAGGAAGAAAAGAAGGAAGAAGG + Intergenic
1033954878 7:146834490-146834512 AAGGAAAGACAGATGGAGGATGG + Intronic
1034033806 7:147798958-147798980 CAGGCAAAGAAGATGGATGATGG + Intronic
1034212801 7:149379699-149379721 GAGGAAAAACAGATGCAGAAAGG - Intergenic
1034405865 7:150902105-150902127 CAGGACACACAGAAGGAAGGAGG + Intergenic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035929030 8:3761217-3761239 CATGAAAAACAGTTAAAAGAAGG + Intronic
1036012638 8:4744292-4744314 CAGGAAAGCAAAATGGAAGAAGG - Intronic
1036648222 8:10625402-10625424 GAGGAAAGACACAGGGAAGAGGG + Intronic
1036962921 8:13265670-13265692 AAGGAAGAAGAGAAGGAAGAAGG - Intronic
1037071222 8:14651979-14652001 CAGGAAACACAGCTGGTAGTAGG - Intronic
1037875466 8:22544985-22545007 CAGGCAGAAAAGATGGCAGAGGG + Intronic
1038472293 8:27835486-27835508 AAGATAACACAGATGGAAGAAGG - Intronic
1038612287 8:29068263-29068285 CAAGAAAAGAAGATAGAAGACGG + Exonic
1039272006 8:35892282-35892304 TAGGAAAAACACTTGGGAGAAGG + Intergenic
1040097137 8:43456946-43456968 CAGGAGAAAAAGCTGGCAGAAGG - Intergenic
1040345447 8:46488492-46488514 TTGGAAAAACAGATAGAAAAGGG - Intergenic
1040652704 8:49466563-49466585 CAGGACAAAATGAGGGAAGAGGG + Intergenic
1040861414 8:52002901-52002923 CATAAAAAACAAAGGGAAGATGG - Intergenic
1041067041 8:54092087-54092109 GAGGAAAAGGAGAAGGAAGAGGG + Intronic
1041492460 8:58449621-58449643 AAGCAGAAACAGATGGAAAAAGG + Exonic
1042397825 8:68311905-68311927 AGGGAAAAAGAGAAGGAAGAAGG - Intronic
1042678523 8:71351226-71351248 GAGGGAAAACAGTTGAAAGACGG + Intronic
1042765416 8:72315850-72315872 CAGGAGACAGAGAGGGAAGAGGG + Intergenic
1042880244 8:73479928-73479950 CAGGGAAACCAGTAGGAAGACGG - Intronic
1042936801 8:74067503-74067525 CAAAAAAAACACATGGAAGGCGG - Intergenic
1043398861 8:79864470-79864492 GAGGAAAAAGAAAAGGAAGATGG - Intergenic
1043519026 8:81024847-81024869 AAGGTAGAAAAGATGGAAGAAGG - Intronic
1043566303 8:81552355-81552377 CAGGAAACACTTAAGGAAGAAGG + Intergenic
1043619040 8:82165020-82165042 CAGGTAAAGAAGATGGGAGAAGG + Intergenic
1043674080 8:82927449-82927471 AAAGAAAAACAGAAGGAAGGAGG + Intergenic
1044030569 8:87230109-87230131 CAGGAGGAACAGAGAGAAGAGGG + Intronic
1044189463 8:89297660-89297682 CAGGAACAAGAGAGGGGAGAAGG + Intergenic
1044392735 8:91670847-91670869 CAGGAAAGATAAATTGAAGAGGG + Intergenic
1044681712 8:94785667-94785689 CAGAAAGAACAGATTGAAGCAGG + Intronic
1045000153 8:97871345-97871367 CAGGAAAAGCAGGCCGAAGAGGG + Intronic
1045062976 8:98424580-98424602 AAAGAAAAACAGAAGGCAGAGGG + Intronic
1045117157 8:98995205-98995227 CTGGGAAAGCATATGGAAGAAGG - Intergenic
1045755277 8:105534204-105534226 GAGGAAGAAAAGAAGGAAGAAGG - Intronic
1045891306 8:107161040-107161062 CAATGAAAAAAGATGGAAGAAGG - Intergenic
1046766458 8:118074835-118074857 GAGAAAAAAAAGATGGATGAGGG + Intronic
1046885059 8:119357348-119357370 AAGAAAAGACAGATGGAAGAAGG - Intergenic
1046906586 8:119580375-119580397 AAGGAAACAGAGATTGAAGAAGG - Intronic
1047329973 8:123878108-123878130 AATTAAAAACAGCTGGAAGAAGG + Intronic
1047480223 8:125275162-125275184 CAGGAAAAGGATATGGAAGGGGG - Intronic
1047781090 8:128111705-128111727 AAGGAAAAAGAGAGGGCAGAGGG + Intergenic
1047928615 8:129704461-129704483 CAGGAAAAAAGGAGGGAAGAAGG - Intergenic
1047930746 8:129726357-129726379 AAGGAGAAAGACATGGAAGAGGG + Intergenic
1047981185 8:130184380-130184402 CAGGTAAAAGAGTTGGAAAAAGG + Intronic
1048077790 8:131092308-131092330 CAAGAAAAACAGGTAGAAGGCGG - Intergenic
1048369880 8:133768028-133768050 CAGGAGGAAGAGATGGAGGAAGG - Intergenic
1048551653 8:135438887-135438909 AAGGAAGAAGAGAAGGAAGAAGG + Intergenic
1048551657 8:135438914-135438936 AAGGAAGAAGAGAAGGAAGAAGG + Intergenic
1048557919 8:135499088-135499110 CAGGTAAAAGAGGTGGAACATGG + Intronic
1048644236 8:136400237-136400259 GAAGAAAAAGAGATGGAAAAGGG + Intergenic
1048755713 8:137735716-137735738 TAGGAAAAATAGATTAAAGATGG + Intergenic
1048777217 8:137960407-137960429 GAGGAAGAAGAGAAGGAAGAGGG - Intergenic
1048778119 8:137970105-137970127 GAGTAAAAACAGATGGTAGAGGG + Intergenic
1049066437 8:140320047-140320069 AAGGAAAAACCTAAGGAAGAAGG + Intronic
1049388186 8:142354774-142354796 CACGAAAAGCAGGGGGAAGAGGG + Intronic
1049579266 8:143404022-143404044 AAGGAAAAACAAAGGGAACATGG + Intergenic
1049824381 8:144658762-144658784 CAGGAAAAAGAAAAGGTAGAAGG + Intergenic
1049952576 9:659691-659713 CAGGAGAAAAAGAGGGAAGAAGG + Intronic
1050259649 9:3828061-3828083 CAGGAAAACCAGAGAGAAAAAGG + Exonic
1051423884 9:16915379-16915401 CAGAGAAAAGAGATGGAAGAGGG - Intergenic
1052015572 9:23461427-23461449 CAGCAAAAACAGTTCTAAGAGGG + Intergenic
1052081925 9:24216838-24216860 CTGGAAAAAAAGAAGGAAGTTGG - Intergenic
1052178512 9:25495662-25495684 CAAGAAAAAGAGATTGAAGTTGG - Intergenic
1052799943 9:32957634-32957656 GAAGAAAAACAGCTGGAGGAGGG + Intergenic
1052957720 9:34267070-34267092 CAGGAAAATCAGATAGTTGAGGG + Intronic
1053198479 9:36137184-36137206 AAGGAACAACAAATGGATGAGGG - Intronic
1053554764 9:39124362-39124384 CAGGAAAAAAAGAAGAAACAAGG + Intronic
1053818882 9:41944620-41944642 CAGGAAAAAAAGAAGAAACAAGG + Intronic
1054109150 9:61088272-61088294 CAGGAAAAAAAGAAGAAACAAGG + Intergenic
1054611707 9:67242853-67242875 CAGGAAAAAAAGAAGAAACAAGG - Intergenic
1055018549 9:71645078-71645100 AAGGAAAAAAAGAGGGAAGGAGG - Intergenic
1055130685 9:72770867-72770889 GAGGAAGAACAAAAGGAAGAAGG - Intronic
1055153159 9:73027668-73027690 CAGAAAAACCAAATGGAAGTAGG - Intronic
1055379702 9:75692782-75692804 CAGGGAATACAGAAAGAAGATGG - Intergenic
1055624948 9:78166836-78166858 CAGGGAAAAAAGCAGGAAGAAGG - Intergenic
1055722240 9:79188292-79188314 AAGGAGAAAGAGAGGGAAGAGGG - Intergenic
1055983909 9:82036247-82036269 CAGAAAAAACAGATGGCAGTGGG + Intergenic
1055984713 9:82045728-82045750 CAGCAAAAACAGTTCTAAGAGGG - Intergenic
1056329257 9:85508470-85508492 CTGAAATAACAGATGGAACAGGG + Intergenic
1056456754 9:86767869-86767891 AAGGACAAAGAGAGGGAAGAGGG - Intergenic
1056974241 9:91236066-91236088 CAGGAAGTACAGATGGATGGAGG + Intronic
1057396939 9:94689032-94689054 CAGGAAATACACAAGGAAGGTGG - Intergenic
1057931312 9:99195955-99195977 GAGGAAGAGCAGAGGGAAGAGGG - Intergenic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1058096177 9:100862716-100862738 TAGAAAAAGCAGGTGGAAGACGG + Intergenic
1058203173 9:102068713-102068735 CAGGAAAAACAAACGAAAAAAGG - Intergenic
1058309095 9:103478588-103478610 TAGGAAAAAAAGAAGGAAGGAGG - Intergenic
1058776489 9:108289318-108289340 CTGGAGAAGCAGATGGAAGGGGG - Intergenic
1059370018 9:113822641-113822663 TAGAAGAAAAAGATGGAAGAAGG + Intergenic
1059648379 9:116290261-116290283 AACGAAAAGCAGATGGAATAAGG - Intronic
1060104945 9:120867851-120867873 AAGGAACCACAGATGTAAGAGGG - Intronic
1060507983 9:124212728-124212750 CAGGACACACACATGGGAGAAGG - Intergenic
1060967705 9:127720974-127720996 CAGGAAAAAAGAAAGGAAGAGGG - Intronic
1061281937 9:129602583-129602605 AGGGAAAAACAGAGAGAAGAAGG + Intergenic
1061673907 9:132204545-132204567 CAGGAAAAACAGGGGCAAGAAGG + Intronic
1061964830 9:134007310-134007332 GAGGAGAGACAGACGGAAGAGGG + Intergenic
1203543709 Un_KI270743v1:112245-112267 GAGGAAAAGCAGATGGCAGTTGG - Intergenic
1185726529 X:2426387-2426409 AAGGAAAAAGAGAAGGAAGGAGG - Intronic
1186149746 X:6661661-6661683 CATCAGAAAGAGATGGAAGAAGG - Intergenic
1187017896 X:15348643-15348665 CAGGGAAAAGGGATGGCAGAAGG - Intronic
1187043542 X:15622736-15622758 CAGGAAAATAAGATGTAAAATGG + Intergenic
1187046592 X:15653494-15653516 GAGGAAAAAGAGGAGGAAGAAGG - Intronic
1187073857 X:15914838-15914860 CAGGAGAAAGAAATGGAAGATGG - Intergenic
1187264472 X:17718628-17718650 AAGGAAAAAAGGAAGGAAGAAGG + Intronic
1187439165 X:19302416-19302438 CAGGGAAAACAGAAGACAGATGG - Intergenic
1187736703 X:22312174-22312196 GAGGGAAGACAAATGGAAGAAGG + Intergenic
1187891264 X:23937133-23937155 CAGGAACAACTGAAGGGAGAGGG + Intronic
1187912104 X:24120559-24120581 AAGGAAAAAAAGAAGGAAGGAGG - Intergenic
1188097139 X:26037426-26037448 TAGGAAAAACAGATTGATTATGG - Intergenic
1188448156 X:30279051-30279073 AAGGAGAAAAAAATGGAAGATGG + Intergenic
1189843109 X:45103341-45103363 CAGGAAAAAGAGTTGGGGGAAGG - Intronic
1190363984 X:49674613-49674635 AAGGAAAAAGATATGCAAGAGGG - Intergenic
1190553187 X:51606285-51606307 CTGTAAAAACAGATGACAGAAGG - Intergenic
1191139934 X:57105972-57105994 CTGGAAAAACAGATAGCAAAGGG + Intergenic
1191612674 X:63133818-63133840 AAGAAAAAACAGGAGGAAGAAGG + Intergenic
1191623623 X:63245108-63245130 AAGAAAAAACAGGAGGAAGAAGG - Intergenic
1191679775 X:63829232-63829254 AAGTAAAAACACATGGAAGTGGG - Intergenic
1191896688 X:66000299-66000321 GAAGAAAAAGAGAAGGAAGAAGG - Intergenic
1192377379 X:70577270-70577292 CAGAAAAAAAAAATGGCAGATGG + Intronic
1193558629 X:82988977-82988999 GAAGAAAAACTGATGAAAGATGG - Intergenic
1193932718 X:87575631-87575653 CAGGAAAAACAGGTGATATAAGG + Intronic
1194215430 X:91124732-91124754 AAGGAAATACACCTGGAAGAGGG - Intergenic
1194280261 X:91943114-91943136 GAGGATAAACAGTTGGAACATGG + Intronic
1194531258 X:95051929-95051951 TAGGAAAAACAGGCAGAAGAAGG + Intergenic
1194721628 X:97346988-97347010 AAGGAAACAGAGAAGGAAGAAGG - Intronic
1194859940 X:98985600-98985622 CAGGAGAAAGAGAAAGAAGAGGG + Intergenic
1194954530 X:100163166-100163188 CAGCAAAAGCAGTAGGAAGAAGG - Intergenic
1195025519 X:100873080-100873102 CAGGCAAAACAGAAGAGAGAAGG - Intronic
1195146464 X:102022234-102022256 CAGGAAGAAGAGAGTGAAGAGGG - Intergenic
1195558096 X:106250335-106250357 GAGTAACAACAGATGCAAGAAGG - Intergenic
1195574554 X:106435417-106435439 AAGGAAAGACAAATGTAAGATGG + Intergenic
1195999684 X:110768554-110768576 CAGAAAAAGCAGGTAGAAGAAGG + Intronic
1196068120 X:111488228-111488250 AAGGAAAGAAGGATGGAAGAAGG - Intergenic
1196802906 X:119559526-119559548 AAGGAAAAACAGGTGGGAGTGGG - Intronic
1197622544 X:128766593-128766615 CAAGAAAAACAGAGGGAGAAAGG - Intergenic
1197633269 X:128886599-128886621 TAGAAAAAGCAGGTGGAAGAAGG - Intergenic
1197815983 X:130499293-130499315 CAAGAAAAACAAAGGGAATAAGG - Intergenic
1197889549 X:131255590-131255612 CAGGAGAAACAGGTGGTATATGG - Intergenic
1197993797 X:132350220-132350242 CAGTAAAAACACATGGACTAAGG + Intergenic
1198064209 X:133080258-133080280 CAGGAGAATCAGAAGAAAGAAGG + Intronic
1198314605 X:135453035-135453057 GAGCAAAAGCATATGGAAGAGGG - Intergenic
1198549982 X:137735186-137735208 CAGGGAGAACAGATGCATGAAGG - Intergenic
1199581232 X:149362465-149362487 CAAAACAAAAAGATGGAAGAAGG + Intergenic
1200107334 X:153722349-153722371 CTGGAAAAGCAAATGAAAGAGGG - Intronic
1200351932 X:155506168-155506190 CATGAAAAATTAATGGAAGAGGG + Intronic
1200384904 X:155880818-155880840 CAGGGAATAGAGATGGAAGAGGG + Intergenic
1200597738 Y:5166608-5166630 GAGGATAAACAGTTGGAACATGG + Intronic
1201073578 Y:10170810-10170832 AAGGAAGAACAGAGGGAAGGAGG - Intergenic
1201368297 Y:13233467-13233489 CAGCAAAAATAGATGGGTGAAGG - Intergenic
1201517668 Y:14835446-14835468 AAGGAAAGAAAGAGGGAAGAGGG + Intronic
1201697389 Y:16840952-16840974 AAGGAAAAATAGAAGGAAGAAGG + Intergenic
1201723577 Y:17131100-17131122 CAAGAAAAATGGATGCAAGATGG - Intergenic
1201742080 Y:17335120-17335142 CTGGAAAATCAGATAGAAAAGGG + Intergenic
1202598582 Y:26569395-26569417 CAGGAACAACAGAAGAATGACGG + Intergenic