ID: 918510907

View in Genome Browser
Species Human (GRCh38)
Location 1:185313477-185313499
Sequence CCCGCCCACCTCAAGTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 87}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918510903_918510907 0 Left 918510903 1:185313454-185313476 CCTCATACACTATATACCTACTT 0: 1
1: 0
2: 0
3: 11
4: 135
Right 918510907 1:185313477-185313499 CCCGCCCACCTCAAGTTTGGAGG 0: 1
1: 0
2: 0
3: 6
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918510907 Original CRISPR CCCGCCCACCTCAAGTTTGG AGG Intronic
900414937 1:2530562-2530584 CCTGCCCCCCTCCCGTTTGGCGG - Intergenic
900718801 1:4161734-4161756 CCCGCCCCCATGAGGTTTGGTGG - Intergenic
907076055 1:51579744-51579766 CCCTCCCACCTCAAGGTAGCTGG - Intronic
916089857 1:161299485-161299507 AGCCCCCACCTCAAGTCTGGGGG + Intergenic
918510907 1:185313477-185313499 CCCGCCCACCTCAAGTTTGGAGG + Intronic
919725094 1:200876877-200876899 CCCACACACTTCAAGTCTGGAGG + Intergenic
920541734 1:206783947-206783969 CCAGCCCACCTGAAGTGTAGTGG + Intergenic
1069232697 10:66031549-66031571 CCCTCCCTCCCCAACTTTGGAGG - Intronic
1074963299 10:118467042-118467064 CCCGCCCACCTAATGTATGATGG + Intergenic
1081868975 11:46374751-46374773 CCCGCCCGCCTCCAGTGTGATGG + Exonic
1084772728 11:71354426-71354448 GCCTCCCACCTCAGGTCTGGTGG - Intergenic
1097000628 12:55873488-55873510 CCCGCCCCCCACAAATTTGTGGG - Intergenic
1100337191 12:93642276-93642298 CCCCCCCACCCCAAGGTTGAAGG - Intergenic
1101525655 12:105526788-105526810 CTAGCCCACCTCAAGTTGGGAGG + Intergenic
1104859724 12:131917808-131917830 CCTGCTCACCTCATGTTTTGGGG - Intronic
1105597194 13:21850022-21850044 CCAGGCTGCCTCAAGTTTGGAGG + Intergenic
1105813322 13:24012662-24012684 CCCGCCCACCACACACTTGGGGG - Intronic
1111536358 13:89607030-89607052 CCCTCCCATCACAAGTCTGGAGG - Intergenic
1111628807 13:90824071-90824093 ACGGCACACCTAAAGTTTGGAGG - Intergenic
1117912047 14:60646297-60646319 CCCCCTCACCTCCAGTCTGGTGG - Exonic
1118378896 14:65201592-65201614 TTCTCCCACCCCAAGTTTGGGGG - Intergenic
1120744811 14:88143669-88143691 CCCGCCCCCCTCATGGTTGTTGG - Intergenic
1121109956 14:91305756-91305778 CCCGCTCACCTGCAGCTTGGCGG + Exonic
1122882020 14:104694467-104694489 TCAGCCCACCTCCTGTTTGGCGG - Intronic
1125492319 15:40157580-40157602 CCCGCCCAGAGCAACTTTGGAGG - Intergenic
1128481713 15:68045699-68045721 CCCTCCCCCCTCAGGCTTGGGGG + Intergenic
1128812445 15:70582476-70582498 CCTGACCACCTCACTTTTGGTGG - Intergenic
1129296367 15:74602434-74602456 CCCGCCCACCTCTAAGCTGGTGG - Intronic
1132511848 16:346766-346788 TCAGCCCACTTCAAGTATGGTGG + Exonic
1132934124 16:2472438-2472460 CCCGCCCACCTGGAGGTCGGTGG - Exonic
1141402587 16:83763472-83763494 CCCTCCCACCCTCAGTTTGGGGG - Intronic
1142333086 16:89468326-89468348 CCCCCCGACCTCATGATTGGAGG - Intronic
1145997580 17:29113459-29113481 CCCTCACCCCTCAACTTTGGGGG - Intronic
1147666916 17:42154803-42154825 CCCGCCCAGCCCCAGTTTAGGGG - Intronic
1147746676 17:42699036-42699058 CCCCCCCCCATCAAGTTTGGTGG + Exonic
1148756861 17:49977718-49977740 CACCCCCACCTCAGATTTGGGGG - Intergenic
1150706726 17:67493730-67493752 CCCACCCATCTCACGTCTGGAGG - Intronic
1151829300 17:76540279-76540301 CCTGCCCACCTTCAGCTTGGTGG - Intronic
1156895498 18:42240970-42240992 CCAGGGCACCCCAAGTTTGGGGG - Intergenic
1161336802 19:3718807-3718829 CCCGCACACGTCAAGGTTCGTGG - Intronic
1162564221 19:11436219-11436241 CCCTCCCACCTCCAGCCTGGCGG - Intronic
1164823409 19:31266982-31267004 CCGGCCCACTTCAAGTTTCAGGG + Intergenic
1167238257 19:48327711-48327733 CCCGCCCACTCCAACTTTGTTGG - Intronic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
935584159 2:104785521-104785543 CCAGCCCACCTCCATTTTTGAGG - Intergenic
942825470 2:180169857-180169879 CCCTCCCATCACAAGTCTGGAGG - Intergenic
947943854 2:234082826-234082848 GGTGCCCTCCTCAAGTTTGGAGG + Intergenic
1168795158 20:606340-606362 CCCTCCCACCCCAAGTCTGGAGG + Intronic
1171395335 20:24829419-24829441 CACTCCAACCTCAAGGTTGGAGG - Intergenic
1179786514 21:43733429-43733451 CCCGGCCTCCGCTAGTTTGGGGG - Intronic
1180740731 22:18051527-18051549 TCCTCCCACCTCAGGTTTTGGGG - Intergenic
1184340708 22:43884370-43884392 CCTGCCCACCTGAAGTCTGTGGG + Intronic
949369471 3:3318636-3318658 CCCTCCCATCACAGGTTTGGAGG - Intergenic
950014136 3:9744248-9744270 CCTGCCCACCTCATGTGCGGGGG - Exonic
953471311 3:43169102-43169124 CCAGCCCCCTTCCAGTTTGGTGG + Intergenic
955062549 3:55505824-55505846 CTCTCCCACCTCAGGGTTGGGGG + Intergenic
960902151 3:122564181-122564203 CCCGCCCACCTCGAGCCTGCAGG + Intronic
964806299 3:160613177-160613199 CCTGCCCACCTCAAAACTGGGGG - Intergenic
969197934 4:5577927-5577949 CCAGCCCACCTCAAGAAGGGAGG + Intronic
969463826 4:7343184-7343206 CCAGCCCACCTCACGTCTGAGGG - Intronic
969573900 4:8025439-8025461 CCTACCCACCACCAGTTTGGAGG - Intronic
983977480 4:173953056-173953078 CATGACCACCTCAAATTTGGTGG + Intergenic
986724028 5:10581018-10581040 CCAGCCCACCCCAAGGCTGGAGG - Intronic
987062579 5:14256746-14256768 CCCGTCCTCCTCCTGTTTGGAGG + Intronic
991401174 5:66253283-66253305 CCCCCCCACCCCAGGTTTTGTGG + Intergenic
994067147 5:95555784-95555806 CCAGTTCACCTCAAGTTTGCAGG + Intronic
998143436 5:139712252-139712274 CCCACCCCACTCAAGTTTGGCGG + Intergenic
1001448591 5:171806797-171806819 CCCACCTACCTCCTGTTTGGGGG + Intergenic
1006512049 6:34526697-34526719 CCTGCCCACCTCAGGATGGGGGG - Intronic
1014042580 6:116847050-116847072 CCCGCACACTTCAAGTATGAGGG - Intergenic
1016177552 6:141099026-141099048 CCCTCCCACCACAGGCTTGGAGG + Intergenic
1018836362 6:167487218-167487240 CTCGCCTATCTCAAGTGTGGTGG + Intergenic
1025020339 7:55475351-55475373 CTCGGCCACCACAGGTTTGGCGG + Intronic
1027769789 7:82392314-82392336 GCCCCCCACCTGAAGTTGGGTGG - Intronic
1032672429 7:134097676-134097698 CCCTCCCACATCAAGTTGTGGGG - Intergenic
1034863622 7:154621798-154621820 CCTGCCCACCTCAAGTCAGGTGG + Intronic
1039071336 8:33651900-33651922 CCCTCCCACCACAGGCTTGGAGG + Intergenic
1045013925 8:97982119-97982141 CCTGCCCACCCCAAGCATGGTGG - Intronic
1046831428 8:118751056-118751078 TCCTCCCACCACAGGTTTGGAGG + Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1055435184 9:76285646-76285668 CCCCCCCACCACCAGTTTTGCGG + Intronic
1061961957 9:133992940-133992962 CCCGCCCACCGCAACTTTCGCGG - Intergenic
1191998900 X:67127053-67127075 CCCTCCCATCACAGGTTTGGGGG + Intergenic
1192219650 X:69188754-69188776 CCCTCCGATATCAAGTTTGGTGG + Intergenic
1194220422 X:91183122-91183144 CCCTCCCATCACAAGCTTGGAGG + Intergenic
1200096953 X:153668988-153669010 CCCACCAACCTCCATTTTGGAGG - Intergenic
1200556933 Y:4646874-4646896 CCCTCCCATCACAAGCTTGGAGG + Intergenic
1201497194 Y:14601256-14601278 CTCGCCCACCTAATTTTTGGTGG + Intronic