ID: 918515965 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:185363552-185363574 |
Sequence | GCCTTTGGGCAGAAACTATG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
918515965_918515971 | 14 | Left | 918515965 | 1:185363552-185363574 | CCCCATAGTTTCTGCCCAAAGGC | No data | ||
Right | 918515971 | 1:185363589-185363611 | AACAACTTCAGTAACATTTCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
918515965 | Original CRISPR | GCCTTTGGGCAGAAACTATG GGG (reversed) | Intergenic | ||