ID: 918515965

View in Genome Browser
Species Human (GRCh38)
Location 1:185363552-185363574
Sequence GCCTTTGGGCAGAAACTATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918515965_918515971 14 Left 918515965 1:185363552-185363574 CCCCATAGTTTCTGCCCAAAGGC No data
Right 918515971 1:185363589-185363611 AACAACTTCAGTAACATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918515965 Original CRISPR GCCTTTGGGCAGAAACTATG GGG (reversed) Intergenic
No off target data available for this crispr