ID: 918515966

View in Genome Browser
Species Human (GRCh38)
Location 1:185363553-185363575
Sequence AGCCTTTGGGCAGAAACTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918515966_918515971 13 Left 918515966 1:185363553-185363575 CCCATAGTTTCTGCCCAAAGGCT No data
Right 918515971 1:185363589-185363611 AACAACTTCAGTAACATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918515966 Original CRISPR AGCCTTTGGGCAGAAACTAT GGG (reversed) Intergenic