ID: 918515967

View in Genome Browser
Species Human (GRCh38)
Location 1:185363554-185363576
Sequence GAGCCTTTGGGCAGAAACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918515967_918515971 12 Left 918515967 1:185363554-185363576 CCATAGTTTCTGCCCAAAGGCTC No data
Right 918515971 1:185363589-185363611 AACAACTTCAGTAACATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918515967 Original CRISPR GAGCCTTTGGGCAGAAACTA TGG (reversed) Intergenic
No off target data available for this crispr