ID: 918515968

View in Genome Browser
Species Human (GRCh38)
Location 1:185363566-185363588
Sequence TATTAGTTCTAGGAGCCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4198
Summary {0: 9, 1: 116, 2: 525, 3: 1466, 4: 2082}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918515968_918515971 0 Left 918515968 1:185363566-185363588 CCCAAAGGCTCCTAGAACTAATA 0: 9
1: 116
2: 525
3: 1466
4: 2082
Right 918515971 1:185363589-185363611 AACAACTTCAGTAACATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918515968 Original CRISPR TATTAGTTCTAGGAGCCTTT GGG (reversed) Intergenic
Too many off-targets to display for this crispr