ID: 918515969

View in Genome Browser
Species Human (GRCh38)
Location 1:185363567-185363589
Sequence TTATTAGTTCTAGGAGCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1143
Summary {0: 3, 1: 37, 2: 99, 3: 296, 4: 708}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918515969_918515971 -1 Left 918515969 1:185363567-185363589 CCAAAGGCTCCTAGAACTAATAA 0: 3
1: 37
2: 99
3: 296
4: 708
Right 918515971 1:185363589-185363611 AACAACTTCAGTAACATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918515969 Original CRISPR TTATTAGTTCTAGGAGCCTT TGG (reversed) Intergenic
903107135 1:21091869-21091891 TTATTAGTTTAAGGAGATTTTGG + Intronic
904958505 1:34310149-34310171 TTATCTGTTCTGGGAGCCTTGGG - Intergenic
906051121 1:42873806-42873828 TTATCAGGTCTAGAAGCTTTTGG + Intergenic
906441389 1:45848845-45848867 TTATCAGTTGAAGGAGCTTTTGG - Intronic
906441602 1:45851346-45851368 TTATCAGTTCCAGGAGCCTTTGG + Intronic
906449864 1:45936268-45936290 TTATCAGATCTAGGAACCTTTGG + Intronic
906585445 1:46972809-46972831 TTCTGAGATCTAGGAGCCTTTGG + Intergenic
906757702 1:48334898-48334920 TTATCAGTTCAAGGAGCTTTGGG - Intronic
906836653 1:49090351-49090373 TTGTCAGATCTAGGAGCTTTTGG - Intronic
906979739 1:50617020-50617042 CTATCAGTTCTAGGAGCTTCTGG + Intronic
907008394 1:50939442-50939464 TTAACAGTTCTAGGAGCTTTTGG + Intronic
908018147 1:59868945-59868967 ATATTATTTTTATGAGCCTTAGG + Intronic
908204354 1:61830128-61830150 TTATCAGATCTAGGAGGCTTTGG - Intronic
909033025 1:70564190-70564212 TTATCAGATCAAGGAGCTTTTGG + Intergenic
909068106 1:70960819-70960841 TTCTTAGTCCTAGGAGAATTTGG + Intronic
909180942 1:72423200-72423222 TTATCAGATCAAGGAGCTTTTGG + Intergenic
909273896 1:73659905-73659927 TTATCAGCTCTGGGAGCTTTTGG - Intergenic
909695257 1:78461348-78461370 TTATCAGGCCTAGGAACCTTTGG + Intronic
909806606 1:79880417-79880439 TTATCAGATCAAGGAGCTTTTGG - Intergenic
909874310 1:80783462-80783484 TTATCAGATCAAGGAGCTTTGGG - Intergenic
910204012 1:84729467-84729489 TTATCAGATCAAGGAGCTTTGGG + Intergenic
910512683 1:88024264-88024286 CTATCAGATCTAGGAGCCTTTGG + Intergenic
910619715 1:89239691-89239713 TTATCAGTTCTAGGAATATTTGG + Intergenic
910768259 1:90804382-90804404 CTAATAGTTCTAGGAGTTTTTGG + Intergenic
910984077 1:92987901-92987923 TTATTAGTTCTAGTAGATTTTGG + Intergenic
911374855 1:97039813-97039835 TTATCAGATCTAGGAGTTTTTGG + Intergenic
911514361 1:98848612-98848634 TTATTAGCTCAAGGAGCTTTTGG + Intergenic
911900292 1:103494960-103494982 TTATCATATCTAGGAGCTTTTGG - Intergenic
912283482 1:108342719-108342741 TTACCAGTTCTAGGAGCATTTGG - Intergenic
912590911 1:110819303-110819325 TTATCAGTACTTGGAGCCTTTGG + Intergenic
912599316 1:110912117-110912139 TTACCAATTCTAGGAGCCTTTGG - Intergenic
912611445 1:111049545-111049567 TTATCAGATCTAGGAGCTTTGGG + Intergenic
912611863 1:111055629-111055651 TTATTAGATCTAGGAGCTTTTGG + Intergenic
912957012 1:114161614-114161636 TTATCAGATATAGGCGCCTTTGG - Intergenic
913408152 1:118519071-118519093 TTATTAGTTCTAGCAGGTTTTGG + Intergenic
914347965 1:146815936-146815958 TAATTTGTTGTAGCAGCCTTGGG - Intergenic
914383330 1:147141062-147141084 TTATCAGTTCTAGGAGCCTTTGG - Intergenic
915000831 1:152588839-152588861 TTATCAGTTCTAGGAAACTTAGG - Intronic
916032588 1:160891090-160891112 TTATGAGATCTAGGAGATTTTGG - Intergenic
916151563 1:161797433-161797455 TTATCAGATCTAGGAGTCTTGGG - Intronic
916396366 1:164392743-164392765 GTATCAGATCTAGGAGCTTTTGG - Intergenic
916807768 1:168276242-168276264 TTATCATATCTAGGAGCCTTTGG + Intergenic
916872809 1:168935709-168935731 TTATCAGTTCTAGGAGCTTTTGG + Intergenic
917012915 1:170495442-170495464 TTCTTAGTTCTAGAATACTTTGG - Intergenic
917184780 1:172341005-172341027 TTATCAGCTCAAGGAGCTTTTGG - Intronic
917260904 1:173167350-173167372 TTATTAGTTCTAATAGTTTTTGG + Intergenic
917274825 1:173320592-173320614 TTATTAGTTTAAGGAGTTTTTGG - Intergenic
917374100 1:174330165-174330187 TTATTAGTTCTAAGAGTTTTTGG - Intronic
917524746 1:175778038-175778060 TTATCAGTTTAAGGAGCTTTGGG - Intergenic
917681156 1:177369243-177369265 TTATCAGCTCAAGGAGCTTTTGG + Intergenic
917832702 1:178910138-178910160 TTATCAGATCTAGGAGCTTTGGG + Intronic
918171075 1:181998028-181998050 TTATTTGTTCAAGGAACCTCAGG - Intergenic
918249757 1:182691923-182691945 TTATTAGATTTAGGAGCCTTTGG - Intergenic
918273222 1:182923998-182924020 TTATCAGATCTAGAAGCTTTTGG - Intronic
918358298 1:183727720-183727742 TTATTAGTTCTACTAGTTTTTGG - Intronic
918362244 1:183771352-183771374 TTATTCATTCTTGGGGCCTTAGG + Intronic
918515969 1:185363567-185363589 TTATTAGTTCTAGGAGCCTTTGG - Intergenic
918819428 1:189233298-189233320 GTACTAGTTCTAGGAACTTTGGG + Intergenic
918841643 1:189548796-189548818 TTATTAGTTCTAAGACTTTTTGG + Intergenic
918843162 1:189571703-189571725 TTACTTGTTATAGCAGCCTTAGG - Intergenic
919073084 1:192780590-192780612 TTATCAGTTCTAGGAGCTTTTGG + Intergenic
919304731 1:195817588-195817610 TTATTAGTTTAAGGAACATTTGG + Intergenic
919330627 1:196165877-196165899 TTATTAGTTCTAATAGCTTTTGG - Intergenic
919584901 1:199424776-199424798 TTATTAAATCTAGGAGCTTTTGG - Intergenic
921186685 1:212676452-212676474 TTATTAATTCTAGAAGGGTTGGG - Intergenic
921191829 1:212716335-212716357 TTGTAAGTTCTAGGAGTTTTTGG + Intergenic
921476293 1:215614696-215614718 TTATTAGATGTAGGAGCCTTTGG + Intronic
921736031 1:218629673-218629695 TTATCAGTTCAAGAAGCTTTTGG + Intergenic
922380703 1:225021406-225021428 TTATCAGATGTAGGAGCTTTTGG - Intronic
923179768 1:231505161-231505183 TTATCAGATCAAGGAGCTTTTGG + Intergenic
924198332 1:241633872-241633894 TTATTGGTTCCAGGAGCCTCTGG + Exonic
924691887 1:246360076-246360098 GTACTAGTTCGAGGAGCTTTTGG - Intronic
924919745 1:248615810-248615832 TTATCAGATCAAGGAGCTTTGGG - Intergenic
1064104028 10:12486128-12486150 CTATTAATTCTATGAGTCTTGGG + Intronic
1064313414 10:14232800-14232822 TTATCAGATCTAAAAGCCTTTGG + Intronic
1064525561 10:16252811-16252833 TTATCAGATCTAGGAGCCTCTGG - Intergenic
1064776523 10:18784327-18784349 TTATCAGTTCTAGGAGCCTATGG + Intergenic
1064814293 10:19240359-19240381 TTATTATTTCTAGTAGTTTTTGG + Intronic
1065392779 10:25201375-25201397 TTCTCAGTTCTAGGAGCTTTTGG + Intronic
1066141540 10:32508173-32508195 TTATTAGTTCTAAGAGTTTTGGG - Intronic
1066356665 10:34691207-34691229 TTATCAGATCAAGGAGCTTTTGG - Intronic
1067212900 10:44276163-44276185 TTAGTAGTTTAAGGAGACTTTGG - Intergenic
1067707353 10:48618964-48618986 TTATTAGTTCTAAGAGTTTTTGG - Intronic
1068126445 10:52847143-52847165 TTATCAGTTCAAGGAGTTTTGGG + Intergenic
1068146791 10:53082215-53082237 TTATCAGTTCTGGGAGTCTTTGG + Intergenic
1068269604 10:54703493-54703515 TTATCAGATCTAGGTGCTTTTGG - Intronic
1068271270 10:54728695-54728717 TTATCAATTCTAGGAGTGTTTGG - Intronic
1068314711 10:55324835-55324857 TTATTAGCTCAAGAAGCTTTTGG - Intronic
1068353956 10:55886016-55886038 TTATTAGTTCTAAGAGCCTTTGG - Intergenic
1068396419 10:56467373-56467395 TTATCAGTTCTAGTAGCTTTTGG - Intergenic
1068562988 10:58537742-58537764 TTATCAGATCTAGGATTCTTTGG - Intronic
1068890405 10:62142673-62142695 TTATCAGTTCAAGGAGCTTTTGG - Intergenic
1069221011 10:65883519-65883541 TTGTTAGTTCTAAGAGATTTTGG + Intergenic
1069356591 10:67593634-67593656 TTATCAGGTCTAGGAGCCTCTGG + Intronic
1071022755 10:81078271-81078293 TTAACAGATCTAGGAGCATTTGG + Intergenic
1071040435 10:81302371-81302393 TTACCAGTTCTAGAAGCCTTTGG - Intergenic
1071060715 10:81569064-81569086 TTATCAGATCTAGGAGTTTTGGG - Intergenic
1071214981 10:83390727-83390749 TTATCAGTTGAAGGAGCTTTGGG - Intergenic
1071799765 10:89045802-89045824 CTGTCAGTTCTAGGACCCTTTGG + Intergenic
1071825737 10:89323549-89323571 TTATTAGACCTACGAGCTTTTGG - Intronic
1072368469 10:94739663-94739685 TTATCAGATCAAGGAGCTTTTGG + Intronic
1072402475 10:95119533-95119555 TTATCAGTTTAAGGAGCTTTTGG + Intergenic
1072509820 10:96109415-96109437 TTATTAGTTCTAGCATTTTTTGG + Intergenic
1073481856 10:103791044-103791066 GTGTGAGTGCTAGGAGCCTTGGG - Intronic
1073944671 10:108736764-108736786 TTATCAGATCAAGGAGCTTTTGG + Intergenic
1074219577 10:111423266-111423288 ATATGAGTTCTTGGAGGCTTTGG + Intergenic
1074474823 10:113761641-113761663 TTATTAGCTCTAGTAGTTTTTGG + Intronic
1074612193 10:115032919-115032941 TTATCAGTTCTAGGAGCCTTTGG + Intergenic
1074645787 10:115450396-115450418 TTAAAAGTTGAAGGAGCCTTTGG - Intronic
1074648758 10:115494211-115494233 TTATCAGATCTAGGAGCTTTTGG + Intronic
1074746306 10:116536474-116536496 TTATCAGATCAAGGAGCCTTTGG + Intergenic
1075628368 10:123982240-123982262 TTATCAGGTCTAGGAGCTTTTGG - Intergenic
1075828374 10:125380831-125380853 TTATCAGTTCTAGGAGCCTTTGG + Intergenic
1077775306 11:5264706-5264728 TTATCAGTTCTAGGGGGTTTTGG - Intronic
1077833898 11:5906470-5906492 TGACCAGTTCTAGGAGCTTTTGG + Intronic
1077912372 11:6584216-6584238 TTATCAGTTCTAATAGCTTTTGG - Intronic
1077955028 11:7008699-7008721 TTATTAGCTAAAGGAGCTTTGGG - Intronic
1077989622 11:7392976-7392998 TTATCAGGTCTAGGAGACTTTGG + Intronic
1078517645 11:12037585-12037607 TTATCAGATCTAGGAGCTTTTGG - Intergenic
1078694402 11:13616189-13616211 TTATCAGTTCTAGGAGCCTTTGG + Intergenic
1078788970 11:14524545-14524567 TTATTAGTTCTTAGAGGTTTTGG - Intronic
1078816474 11:14827430-14827452 TTATTAGCTTAAGGAGCTTTCGG - Intronic
1079257252 11:18842107-18842129 TTATTAGCTTAAGGAGCTTTTGG - Intergenic
1079691928 11:23429281-23429303 TTATTAGTTCTAACAGTTTTTGG + Intergenic
1079736042 11:23998648-23998670 TTATTGATTCTAGGAGCCTTTGG - Intergenic
1079747054 11:24146882-24146904 TTATCAGGTCTAGGAGCCTTTGG + Intergenic
1079757661 11:24285275-24285297 TTATCAGTTCCAGGAGCCTTTGG - Intergenic
1079920902 11:26433269-26433291 TTATCAGCTCTAAGAGCTTTGGG + Intronic
1080018803 11:27536967-27536989 TTATCAGATCTAGGAGCTTTTGG + Intergenic
1080148081 11:29013055-29013077 TTATTAGTTCTAACAGTTTTTGG + Intergenic
1080164509 11:29220867-29220889 TTATCAGTTCAAGGAGTTTTGGG + Intergenic
1081096804 11:38946259-38946281 TTATCAGATATAGGAGCTTTTGG - Intergenic
1081293377 11:41354140-41354162 TTATCAGTTATAGGAGCCTTTGG - Intronic
1082629550 11:55525829-55525851 TTATTAGTTTAAGGAGTTTTTGG + Intergenic
1083495058 11:63044500-63044522 TTATCAGATCTAGGAGCCTTTGG - Intergenic
1084754652 11:71229335-71229357 TTATTATTTCCAGGAGGTTTTGG - Intronic
1084891792 11:72240312-72240334 TTACTAGTTGGAGGGGCCTTCGG + Intronic
1085222447 11:74886326-74886348 TTATCAGATCTAGGAGCTTTTGG - Intronic
1085731744 11:79005859-79005881 TTATCAGATCTAGGAGCTTTTGG - Intronic
1085828248 11:79871039-79871061 TTATCAGATCAAGGAGCTTTTGG - Intergenic
1085860707 11:80231243-80231265 TTATTAGTTGTAGTAGTTTTTGG - Intergenic
1085901558 11:80706131-80706153 TGATTAGATCTAGAAGCTTTTGG - Intergenic
1086008191 11:82065514-82065536 TTATTGGTTCTAGGAGAATTTGG + Intergenic
1086119341 11:83289422-83289444 TTATCAGTTCCAGGGGCCTTTGG + Intergenic
1086172700 11:83853993-83854015 TTATTAGTTCCAGGAGATTTTGG - Intronic
1086388017 11:86329477-86329499 TAATTAGCTCTAGTAGCTTTAGG + Intronic
1086468442 11:87079499-87079521 TTATTAGTTTTAAGAGTTTTTGG + Intronic
1086497968 11:87423409-87423431 CTATTATTTCTAGGATCCTGTGG - Intergenic
1086563329 11:88194597-88194619 TTATCAGATCTAGGAGCTTTTGG + Intergenic
1087089941 11:94259113-94259135 TTATTAGTTCTAATAGTCTTTGG + Intergenic
1087251728 11:95908108-95908130 TTATCAGATCTAGTAGCTTTTGG - Intronic
1087358804 11:97130948-97130970 TTATTTGTTCTAGCAGTTTTGGG + Intergenic
1087358891 11:97132400-97132422 TTATTTGTTCTAGTAGCTTTTGG + Intergenic
1087381938 11:97416124-97416146 TTATCAGTTCCAGGAACCTTTGG + Intergenic
1087502546 11:98976751-98976773 TTACCAGTTCTAGAAGCTTTTGG - Intergenic
1087503424 11:98989733-98989755 TTATCAGCTCTAGGAGTTTTTGG + Intergenic
1087561764 11:99799139-99799161 TTATCAGTTCCTGAAGCCTTGGG + Intronic
1087792123 11:102417260-102417282 TAATCAGATCTAGGAGCCCTTGG - Intronic
1087868652 11:103264983-103265005 TTATTAGCTTAAGGAGCTTTTGG - Intronic
1088338973 11:108741676-108741698 TTATCAGATCAAGGAGCTTTTGG + Intronic
1088410539 11:109529476-109529498 TTACTAGTTCTAGATGCCTGAGG - Intergenic
1088800407 11:113301246-113301268 TGATCAGATCTAGGAGCTTTTGG - Intergenic
1088854411 11:113734070-113734092 TTATTAGTTCAAAGAGGCCTTGG - Intronic
1090545269 11:127758758-127758780 TTATCAGACCTAGGAGCTTTTGG + Intergenic
1090690121 11:129172045-129172067 TTATCAGTTCAAGGAGTTTTTGG + Intronic
1090697886 11:129267024-129267046 TTCATAGTTCAAGGAGCCTGGGG + Intronic
1090766677 11:129882261-129882283 TTATGACTGCTAGGAGGCTTGGG - Intronic
1090817176 11:130308723-130308745 TTATATGTTCTAAGAACCTTGGG + Intronic
1091512770 12:1146455-1146477 TTATCAGATCTAGGAGCTTTTGG + Intronic
1092334088 12:7613180-7613202 GTATTAGATCTAGGAGCTTTTGG - Intergenic
1092393816 12:8106753-8106775 TTATCAGATCTAGAAGCTTTTGG + Intergenic
1093008949 12:14083670-14083692 TTATTAGCTTAAGGAGACTTTGG - Intergenic
1093061210 12:14607623-14607645 TTATTAGTTCTAACAGTTTTTGG + Intergenic
1093120230 12:15261770-15261792 TTATTAGTTCTAACAGTTTTGGG - Intronic
1093344183 12:18020240-18020262 TTATCTGTTCTAGGAGCTTTTGG - Intergenic
1093481776 12:19611798-19611820 TTATCAGATCTAGGAGCTTTTGG + Intronic
1093496873 12:19767830-19767852 TTATCAGTTCTAGAAGCCTTTGG - Intergenic
1093633450 12:21437261-21437283 TTATGAGTAGAAGGAGCCTTCGG - Intergenic
1093677472 12:21960603-21960625 TTATTAATTCTAAGAGATTTTGG - Intergenic
1094139640 12:27167707-27167729 TTATCAGTTTTAGGAGATTTTGG + Intergenic
1094775951 12:33727976-33727998 TTATCAGTTCAAGAAGCTTTTGG + Intergenic
1095259082 12:40078028-40078050 TTATCAATTCTAGAAGCCTCTGG + Intronic
1095298338 12:40552819-40552841 TTATCAGGTCTACGAGCTTTTGG + Intronic
1095519412 12:43044600-43044622 TTACCAGATCTAAGAGCCTTTGG - Intergenic
1095625831 12:44313980-44314002 TTATCTGGTCTAGGAGCCTTTGG + Intronic
1095634469 12:44416594-44416616 TTGTCATTTCTAGGAGGCTTCGG + Intergenic
1095725815 12:45451744-45451766 TTATTGGTTCTAACAGCTTTTGG - Intergenic
1095816429 12:46427397-46427419 TTATCAGATCTAGGAGTCTTTGG - Intergenic
1095867612 12:46989875-46989897 TTATTAGTTCCAGGAGCCTTTGG - Intergenic
1096346739 12:50854573-50854595 TTATCAAATCTGGGAGCCTTTGG - Intronic
1096348625 12:50874677-50874699 TTATCAGTTCCAGGAGCCTTTGG - Intronic
1096894384 12:54806190-54806212 TTATCAGATCAAGGAGCTTTTGG + Intergenic
1096900095 12:54868352-54868374 TTATCAGATCTAGGAGCCTTTGG + Intergenic
1097303078 12:58039159-58039181 TTATCAGATTTAGGAGCCTTTGG + Intergenic
1097320108 12:58216235-58216257 TTATTGGATCTAGGAGCCTTTGG + Intergenic
1097374623 12:58826653-58826675 TTATTAGATCTAAGAGTTTTTGG - Intergenic
1097736516 12:63188047-63188069 TTATTAGTTCTAACAGTTTTTGG + Intergenic
1098044043 12:66381672-66381694 TAAGTAGTTCTTGGAGACTTAGG + Intronic
1098327729 12:69319911-69319933 TTATCAGATCTAGGAGCTTTTGG + Intergenic
1098347463 12:69521278-69521300 TTATCAGATCTAGGAGCTTTTGG + Intronic
1098399622 12:70060184-70060206 TTATCAGATCTAGGAGCCTTTGG - Intergenic
1098563264 12:71901854-71901876 TTATCAGATCTAGGAGCCTTTGG - Intronic
1099164037 12:79279756-79279778 TTATCAAATCTAGGAGTCTTTGG - Intronic
1099252986 12:80281073-80281095 TTATCAGTTCTAGGAGCCTTTGG + Intronic
1099323171 12:81177425-81177447 TTATCAGATCTAGGAGCTTTTGG - Intronic
1099398042 12:82166184-82166206 ATATCAGTTCTATGAGCCTTTGG + Intergenic
1099634828 12:85200345-85200367 TTATCAGATCAAGGAGCTTTTGG + Intronic
1099648708 12:85395964-85395986 TTATCAGCTCAAGGAGCTTTTGG - Intergenic
1099868529 12:88316680-88316702 TTATCAGCTCAAGGAGCTTTTGG + Intergenic
1100094325 12:91013259-91013281 TTATCAGATCTAGGAGCCTTTGG + Intergenic
1100114890 12:91292567-91292589 TTATTAGATCTAGGAGTCTTTGG + Intergenic
1100215926 12:92448495-92448517 TTATTAGTTAGAGGAACCTGGGG + Intergenic
1100266635 12:92982937-92982959 TTATCAGTTCTGGTAGCCTTTGG - Intergenic
1100706642 12:97207631-97207653 TTATCAGTTCTAGGAGCTTTTGG - Intergenic
1100926578 12:99555317-99555339 TTATCAGTTCTAGGAGCTTTTGG + Intronic
1100928500 12:99578470-99578492 TTGTTTATTCTAGGAGCTTTTGG - Intronic
1101037669 12:100721263-100721285 TTATTCGTTCTAGTAACCCTGGG - Intronic
1101507025 12:105356556-105356578 TTGTTAGTTCTAGAAGCCTAAGG + Intronic
1103111288 12:118281072-118281094 TTATTAGATCAAAGAGCATTTGG + Intronic
1103169892 12:118808458-118808480 TTATCAGATCTAGGAGCTTTTGG + Intergenic
1103729195 12:123014832-123014854 TTATTAGGTCTAACAGGCTTTGG - Intronic
1103832964 12:123795284-123795306 TCATTAGTTCCAGCAGCATTGGG - Intronic
1104677672 12:130724839-130724861 TTATTAGCTGAAGGAGCTTTTGG - Intergenic
1106272130 13:28165217-28165239 TCATTAGGTATAGGATCCTTTGG + Intronic
1106424886 13:29617796-29617818 TTATCAGATCTAGGAGCTTTTGG - Intergenic
1106979778 13:35265000-35265022 TTATTAGTTCTAATAGTTTTTGG - Intronic
1107232798 13:38130666-38130688 TTGTCAGATCTAGGAGCCTTTGG + Intergenic
1107233596 13:38141048-38141070 TTATCAGCTTTAGGAGCCTTTGG + Intergenic
1107567861 13:41624934-41624956 TTATCAGTTCTAGGAGCCTTTGG - Intronic
1107764252 13:43716645-43716667 TTGTCAGTTCCAGGAGCCTTTGG - Intronic
1108261693 13:48663715-48663737 TTATTAGTTCTAAGAGTTTTTGG + Intronic
1108335786 13:49440872-49440894 TTATCAGTTCCAAGAGCCTTTGG + Intronic
1108426343 13:50305702-50305724 TTATCAGATCTAGGAGCTTTTGG + Intronic
1108609830 13:52073739-52073761 TCATCAGTTCCAGGAACCTTTGG - Intronic
1108816105 13:54292237-54292259 TTATCAGCTTTAGGAGCATTTGG + Intergenic
1108978000 13:56473678-56473700 TTATCATTTCAAGGAGCTTTGGG + Intergenic
1109577464 13:64280474-64280496 TTATCAGATCTAGGAGCTTCTGG - Intergenic
1109916978 13:69001935-69001957 TTATCAGTTTAAGGAGCTTTTGG - Intergenic
1110258843 13:73462499-73462521 ATATTAGTTCTAAGAGCTGTTGG - Intergenic
1110481952 13:75988820-75988842 TTATCAGATCTAGGAGCTTTTGG - Intergenic
1110710001 13:78640242-78640264 GGATTGGTTCTAGGACCCTTAGG + Intronic
1110803777 13:79731591-79731613 TTATCAGATCAAGGAGCTTTTGG + Intergenic
1111040064 13:82736409-82736431 TTATCAGTTCTAGCAGCCTTTGG + Intergenic
1111144581 13:84164070-84164092 TTATCAAATGTAGGAGCCTTTGG + Intergenic
1111179240 13:84640113-84640135 TTATCAGATCTAGGAGCTTTGGG - Intergenic
1111419655 13:87996179-87996201 TTATTAGATCTAGGAGCCTTTGG + Intergenic
1111449609 13:88397586-88397608 TTATCAGATCAAGGAGCTTTTGG - Intergenic
1111817841 13:93176501-93176523 TTATCAAATCTAGGAGCATTTGG - Intergenic
1111945328 13:94659066-94659088 TTATCAGTTTTAGGAGCCTGAGG - Intergenic
1111956081 13:94759848-94759870 TTATCAATTCTAGGAGGCTTTGG + Intergenic
1112175961 13:97024416-97024438 TTATTAGCTGGAGGAGCTTTTGG - Intergenic
1112223060 13:97510966-97510988 TTATCAGTTTCAGGAGTCTTTGG + Intergenic
1112253291 13:97803728-97803750 TTGTCAGTCCTAGGAGCCTTTGG - Intergenic
1112987116 13:105464892-105464914 TAATTAGTTTAAGTAGCCTTAGG + Intergenic
1113202274 13:107879491-107879513 TTATCAGTTCTAGGAGCCCTTGG - Intergenic
1113243508 13:108367396-108367418 TTATCAGTTCTAGAAGCCCTTGG + Intergenic
1113244722 13:108382176-108382198 TTATTAGCTGAAGGAGCTTTTGG - Intergenic
1113586086 13:111466939-111466961 TTATTAGTTCCAGGAGCCTTCGG + Intergenic
1114394718 14:22347192-22347214 TTATCAGTTGAAGGAGCTTTGGG + Intergenic
1114658386 14:24329603-24329625 TTGTCAGTTCTAGGAGCCATGGG - Intronic
1115021503 14:28686243-28686265 TTATCAGATTTAGGAGCTTTTGG + Intergenic
1115182506 14:30645704-30645726 TTATTAGTTCTGGGAGCCTTTGG + Intronic
1115371733 14:32623356-32623378 TTGTTAGTTCTAGTATCCATAGG + Intronic
1115840102 14:37460623-37460645 TTATCAAATCTAGGAGTCTTTGG - Intronic
1116089723 14:40289981-40290003 TTATCAATTCTAGGAGCCTTTGG + Intergenic
1116119932 14:40709904-40709926 TTATTAGACCTAGGAGATTTTGG - Intergenic
1116348611 14:43829440-43829462 TTATTAGCTTAAGGAGCCTTTGG + Intergenic
1116503245 14:45646756-45646778 CTATTAGTACTGGCAGCCTTGGG + Intergenic
1116578701 14:46609779-46609801 TTGTCAGATCTAGGAGCCTTTGG - Intergenic
1116800065 14:49433822-49433844 TTATCAGATCTAGGAGTTTTTGG - Intergenic
1117259606 14:54017808-54017830 TCATCAGATCAAGGAGCCTTTGG - Intergenic
1117561423 14:56943360-56943382 TTATCAGATCTGGGAGCCTTTGG + Intergenic
1117948270 14:61054743-61054765 TTATCAGCTCAAGGAGCTTTTGG + Intronic
1118045056 14:61960577-61960599 TTATCAGATCAAGGAGCTTTTGG + Intergenic
1118114939 14:62764632-62764654 TGATCAGTTTTAGGAGACTTTGG - Intronic
1118426315 14:65667287-65667309 TTGTCAGATCTAGGAGCTTTTGG - Intronic
1118651920 14:67905790-67905812 TTATCAGATCTAGGAACATTTGG + Intronic
1118666046 14:68071144-68071166 TTATCAGATCTAGGAGCCTTTGG + Intronic
1118965476 14:70579625-70579647 TTATTATGTCTAGGAGTCTTTGG - Intergenic
1119657839 14:76430194-76430216 ATAGTAGTTCTAGGTGCCTGAGG + Intronic
1120430993 14:84415044-84415066 TTATCAGTTCTAAGAGTTTTTGG + Intergenic
1120448658 14:84636849-84636871 TTATCATATCTAGGAGCTTTGGG + Intergenic
1121371408 14:93361574-93361596 TTCTCAAATCTAGGAGCCTTTGG + Intronic
1121472872 14:94169799-94169821 TAATTAGTTATAGCAGCCATAGG - Intronic
1121741706 14:96257317-96257339 TAATTAATTATAGCAGCCTTAGG - Intronic
1122498333 14:102175928-102175950 TTATCAGATCTAGGAGCTTTTGG + Intronic
1123501785 15:20892553-20892575 TTATTAGTTTTATGTGCATTTGG + Intergenic
1123559038 15:21466252-21466274 TTATTAGTTTTATGTGCATTTGG + Intergenic
1123595268 15:21903533-21903555 TTATTAGTTTTATGTGCATTTGG + Intergenic
1124153528 15:27204918-27204940 TTATTGGATCTACGAGTCTTTGG + Intronic
1124473986 15:30015300-30015322 TTATCAGTTCTGGGAGCTTTGGG + Intergenic
1125787662 15:42335731-42335753 TTATTAGCTTAAGGAGCTTTTGG - Intronic
1126233836 15:46358605-46358627 TTATCAGATCTAGGAGCTTTGGG - Intergenic
1126255813 15:46624411-46624433 TTATCAGCTCTAGGAGCCTTTGG - Intergenic
1126496621 15:49298294-49298316 TTGTCAGTTCCACGAGCCTTTGG + Intronic
1126676288 15:51161673-51161695 TTATTAGTTCTTGTTGCCTCAGG + Intergenic
1126695856 15:51324797-51324819 TTATCAGTTCTAGGGACCCTAGG + Intronic
1126873930 15:53018201-53018223 TTATCAGTTCTGCAAGCCTTTGG + Intergenic
1127140884 15:55975351-55975373 TTATCAGTTCTAATAGCTTTTGG - Intronic
1129560055 15:76556870-76556892 TTATTAGACATAGGAGCTTTTGG - Intronic
1129583273 15:76835042-76835064 TTATCAGTTCTAGGAGCCTTTGG - Intronic
1129583325 15:76835804-76835826 TTAACACTTCTGGGAGCCTTTGG - Intronic
1129588707 15:76895627-76895649 TTATTAGTTCTAATAGTTTTTGG - Intronic
1129803646 15:78436789-78436811 TTTTTAGTTTGAGGTGCCTTGGG + Intergenic
1130345243 15:83038107-83038129 TTATCAGTTCCAGGCGCCTTTGG - Intronic
1130366641 15:83246474-83246496 TTATCAGTTCAAGGAGCTTTTGG + Intergenic
1130622681 15:85479900-85479922 TTATTGGTTCTAGGGACTTTTGG + Intronic
1130782342 15:87055150-87055172 TGATCAGATCTAGGAGCCTCTGG - Intergenic
1131597909 15:93817429-93817451 TTATCGGATCTAGGAGCTTTTGG - Intergenic
1131933849 15:97479208-97479230 TTATCAGTTCTTTGAGACTTTGG + Intergenic
1132007788 15:98245593-98245615 TTATCAGTTCTAGGAGCCTTTGG + Intergenic
1132245177 15:100290129-100290151 TTATCAGATCTAGGAGCTTTTGG - Intronic
1202967387 15_KI270727v1_random:193411-193433 TTATTAGTTTTATGTGCATTTGG + Intergenic
1135731343 16:24897509-24897531 TTGGTAGTTGTAGGAGACTTAGG - Intronic
1135796819 16:25452591-25452613 TTATTATTTCTAGGACTCTTTGG + Intergenic
1136650884 16:31669353-31669375 TTATCAATTCTATGAGCATTTGG + Intergenic
1136651360 16:31674673-31674695 TTATTAGTTCTAACAGTTTTTGG + Intergenic
1138226148 16:55296801-55296823 TTTTGAGTTCTATGAGGCTTGGG - Intergenic
1138893285 16:61171341-61171363 TTATCAGTTCTAAGAGAATTTGG - Intergenic
1138989570 16:62375025-62375047 TTATTAGTTTAAGGAGTTTTTGG - Intergenic
1139186834 16:64816283-64816305 TTATTAGCTTAAGGAGCTTTGGG + Intergenic
1139986070 16:70899596-70899618 TAATTTGTTGTAGTAGCCTTGGG + Intronic
1140018227 16:71209650-71209672 TTATCAGCTCAAGGAGCTTTGGG - Intronic
1140460624 16:75136966-75136988 TTATTATTTTTAGGACCCCTTGG - Intergenic
1141494898 16:84402198-84402220 TTATGAGTTCTAATAGCTTTAGG + Intronic
1143231308 17:5357927-5357949 TAATTAATTCCAGCAGCCTTTGG + Intronic
1143257380 17:5571372-5571394 TTATTAGATCTAGCAGATTTGGG - Intronic
1143418895 17:6773665-6773687 TTATCAGATCTAGGAGCTTTTGG - Exonic
1143774634 17:9190020-9190042 TTATTAGTTCTAACAATCTTCGG - Intronic
1143795208 17:9330583-9330605 TTATTAGTTCTAGGTCCCTCAGG + Intronic
1144137420 17:12310859-12310881 TTATCAGATCTAGGAGCCTTTGG + Intergenic
1145719344 17:27054246-27054268 TTATCAGATCTAGGAGTCTTTGG - Intergenic
1146614184 17:34339168-34339190 TTATCAGATCTAAGAGGCTTTGG + Intergenic
1148672882 17:49425344-49425366 TTGTTAGTTCTAATAGCTTTTGG - Intronic
1149014946 17:51897942-51897964 TTATCAGATCTAGGAGCTTTTGG + Intronic
1149062621 17:52441026-52441048 TTATCAGATCTAAGAGCCTTGGG - Intergenic
1149141985 17:53442051-53442073 TTATCAGATCTAGGAGCTTTTGG - Intergenic
1149362255 17:55908086-55908108 TTATCAGATCTAGGAGCTTTTGG + Intergenic
1149479085 17:56987002-56987024 CTTTTAGTTCTAGGAGGCTTGGG - Intronic
1150853431 17:68727366-68727388 TTATCAGATCAAGGAGCTTTTGG - Intergenic
1150940152 17:69684218-69684240 TTATCAGATCAAGGAGCTTTTGG + Intergenic
1151260790 17:72914536-72914558 GTATTAGTTCCAGGACCCTGTGG - Intronic
1153085590 18:1282470-1282492 TTATCAAGTCTAGGAACCTTTGG - Intergenic
1153175966 18:2373645-2373667 TTACCAGTTCTAGGAGCTTTTGG + Intergenic
1153446947 18:5184456-5184478 TTATCAGAACTAGGAGCATTTGG - Intronic
1153462210 18:5348468-5348490 TTATCAGACCTAGGAGCTTTTGG - Intergenic
1153563048 18:6391596-6391618 TTATCAAATCTAGGAGCCTTTGG - Intronic
1153876633 18:9378379-9378401 TTATCAGTTCAAGGAGCTTTTGG - Intronic
1154298279 18:13170102-13170124 CCATCAGTTCTAGGAGCTTTTGG - Intergenic
1154298929 18:13175672-13175694 TTATTAGTGCCAGGAGATTTAGG - Intergenic
1154392932 18:13957532-13957554 TTATCAGATCTGGGAGCTTTTGG - Intergenic
1154469791 18:14688592-14688614 TTTCCAGATCTAGGAGCCTTTGG + Intergenic
1155641233 18:28018024-28018046 TTACTAGTTCTAGGAGCTTTTGG - Intronic
1155667698 18:28331348-28331370 TTATTAGTTCTAGGAGTGTTTGG + Intergenic
1155672811 18:28392356-28392378 TTATCAGCTCAAGGAGCTTTTGG - Intergenic
1156060496 18:33068933-33068955 TTATTAGTTCTTAGAGTTTTTGG - Intronic
1156125142 18:33895918-33895940 TTATCAGCTGTAGGAGCTTTAGG - Intronic
1156156225 18:34305646-34305668 TTATTAGTTCTAAGAGTTTTTGG - Intergenic
1156212031 18:34954947-34954969 TTATCAGATCTAGGAGCTTTTGG + Intergenic
1156340764 18:36208669-36208691 TTATTAGTTCTAGGAGCCTTTGG + Intronic
1156752825 18:40481022-40481044 TTATTATTTCTAACAGTCTTAGG - Intergenic
1157054551 18:44211101-44211123 TTATCAGATCAAGGAGCCTTTGG + Intergenic
1158037453 18:53050651-53050673 TTATCAGATCAAGGAGCTTTTGG + Intronic
1158127054 18:54112130-54112152 TTATCAGATCTAGGAACTTTTGG + Intergenic
1158268672 18:55688462-55688484 TTAGTACTTCCAGGAGCCCTAGG + Intergenic
1158327903 18:56329987-56330009 TTATTAGTTACAGCAGGCTTAGG + Intergenic
1158337545 18:56429983-56430005 TTATCAGATCAAGGAGCTTTTGG - Intergenic
1158790883 18:60779069-60779091 TTTTCAGTTCTAGGAGCCTTTGG - Intergenic
1158822841 18:61180532-61180554 TTATCAGTTCTACAAGCCTTTGG - Intergenic
1159137939 18:64359349-64359371 TTATCAGTTCTAGGAGCCTTTGG + Intergenic
1159231728 18:65616736-65616758 TTATCAAATCTAGGAGCCTTTGG + Intergenic
1159291204 18:66423471-66423493 TTATTAGTTCTAAAAGTTTTTGG - Intergenic
1159574662 18:70160696-70160718 TTATCAGTTCTAAGAACTTTTGG - Intronic
1164046655 19:21548980-21549002 TTATCAGCTCAAGGAGCTTTTGG + Intronic
1164122304 19:22277068-22277090 TTATTAGCTTAAGGAGCTTTTGG - Intergenic
1165646722 19:37445562-37445584 TTGCCAGTTCTAGGAGCTTTTGG - Intronic
1166898930 19:46043058-46043080 TTATTAGTTCCCGGAGCTTTGGG - Intronic
1167865558 19:52324060-52324082 TTATCAGATCTAGGAGCCTTTGG - Exonic
1167887878 19:52516774-52516796 TCATTAGTTCTTGTAGCTTTTGG - Intergenic
1168199204 19:54802077-54802099 TTCTCAGATGTAGGAGCCTTTGG + Intronic
925071305 2:969739-969761 TTATCAGATCTAGGAGCTTTTGG + Intronic
925078880 2:1044281-1044303 TTCTCAGATCTAGGAGCCTTTGG + Intronic
925453626 2:3993947-3993969 TTATTAATTCTAATAGCATTTGG + Intergenic
925477780 2:4237669-4237691 TTGTCAGTTCTAGGAGCCTTTGG - Intergenic
928075715 2:28262679-28262701 TAATGAGTTTTAGGAGCCTGTGG + Intronic
928490941 2:31782484-31782506 TTATCAGCTCAAGGAGCTTTTGG - Intergenic
928754983 2:34513593-34513615 TTATTAGCTCAAGGAGCTTTTGG - Intergenic
928757298 2:34542867-34542889 TTATTAGCTTAAGGAGCTTTTGG + Intergenic
928805818 2:35153196-35153218 TTATCAGTTCTAGTAGCCTTGGG - Intergenic
928955596 2:36864033-36864055 TTATCAGATCTGGGAGCTTTTGG + Intronic
929072059 2:38041081-38041103 TTATTAGTTGAAGGAGGTTTGGG + Intronic
929510383 2:42561897-42561919 TAATTTGTTACAGGAGCCTTAGG - Intronic
930464366 2:51727687-51727709 TTACTAGTTCTAGCAGCTTTGGG + Intergenic
930476060 2:51883730-51883752 TAATTAGATCTAGGAGCTTCTGG + Intergenic
930567581 2:53042132-53042154 TTATTAGTTCCAAGAGCTTTTGG + Intergenic
930677158 2:54215124-54215146 TTATCAGATCTAGGAACCTTTGG + Intronic
930749634 2:54921223-54921245 TTATTAATTCTAATAGCTTTTGG - Intronic
930900301 2:56498459-56498481 TTATTAGATCAAGGAGCTTTTGG + Intergenic
931539726 2:63316812-63316834 GTATCAGATCTAGGAGTCTTTGG - Intronic
931545956 2:63387738-63387760 TTCTCAGATCTAGGAGCTTTTGG - Intronic
931557752 2:63523568-63523590 TTATCAGATCAAGGAGCTTTTGG - Intronic
932015851 2:68025278-68025300 TTATTAGTTCTAATAGTTTTGGG + Intergenic
932037927 2:68266919-68266941 TTATTAAATCTAGAAGTCTTTGG - Intergenic
932833751 2:75014842-75014864 TTATTAGTTCTAGTAGCTTGGGG - Intergenic
932852977 2:75204958-75204980 TTATCAGATCTAGGTGCTTTTGG + Intergenic
932930109 2:76025803-76025825 TTATCAGTTCTAGGAGGTTTTGG - Intergenic
933052802 2:77620825-77620847 TTATCAGATCAAGGAGCTTTGGG - Intergenic
933085572 2:78050737-78050759 TTATTAGCTGAAGGAGCTTTTGG + Intergenic
933181497 2:79231934-79231956 TTATTAGTTCCAGGAGCCTTTGG + Intronic
933872454 2:86581383-86581405 TCTTTAGTTCTAGGAGTTTTTGG - Intronic
934149524 2:89132205-89132227 TTATTAGATCCAGGAACATTTGG - Intergenic
934167968 2:89313018-89313040 TTATGAGATCTAGAAGCTTTTGG - Intergenic
934199315 2:89869564-89869586 TTATGAGATCTAGAAGCTTTTGG + Intergenic
934217770 2:90049823-90049845 TTATTAGATCCAGGAACATTTGG + Intergenic
935003028 2:99040381-99040403 TTATCAGATCTGGGAGCTTTTGG - Intronic
935436088 2:103034765-103034787 TTATTAGTTCTAACAGTATTTGG + Intergenic
935449667 2:103194540-103194562 TTATTAGCTTAAGGAGCTTTTGG - Intergenic
936259416 2:110946259-110946281 TTATCAGCTCTAAGAGCTTTTGG + Intronic
936273830 2:111074114-111074136 TTATTAGTTCTAGAGGATTTAGG + Intronic
936274901 2:111086918-111086940 TTATTAGCTCAAGGATCTTTTGG - Intronic
936390839 2:112071659-112071681 TTATCAGCTCAAGGAGCTTTTGG + Intronic
936693203 2:114917083-114917105 TTATCAGTTCTAGGAACATTTGG - Intronic
937315749 2:120931064-120931086 TAATTAGTTACAGCAGCCTTAGG - Intronic
937722694 2:125122111-125122133 TTCTCAGTTCTAGGAGTTTTTGG + Intergenic
937762750 2:125625633-125625655 TTATTAGTTTAAGGAGTTTTGGG - Intergenic
937848285 2:126606226-126606248 TTATCAGTTGACGGAGCCTTTGG - Intergenic
938391275 2:130908328-130908350 TTATCAGTTCTAAGAGCCTTTGG + Intronic
938866535 2:135427327-135427349 TCATCAGATCTAGGAGCTTTTGG - Intronic
939263087 2:139835129-139835151 TTGTTAGTTCTAGGAGCCTTAGG + Intergenic
939312953 2:140508417-140508439 TTATTTGTTCATGGAGCCTGGGG - Intronic
939987472 2:148844548-148844570 TTATCAGTTCTAGGAGCCTTTGG + Intergenic
940186472 2:150990299-150990321 TTATCAGTTCTAAGAGTTTTTGG - Intergenic
940546009 2:155086320-155086342 TTATCAGATCTAGGAGCCTTTGG + Intergenic
941061009 2:160846987-160847009 TTACCAGTTCTAGGAGCATTTGG - Intergenic
941119412 2:161511814-161511836 TTATCAGATCAAGGAGCTTTTGG - Intronic
941191105 2:162383525-162383547 TTATTAAATCTAGGATACTTAGG - Intronic
941358320 2:164519622-164519644 TTATCAGTTCTAGGAGTTTTTGG - Intronic
941487323 2:166098624-166098646 TTATTTGATCTAGGAGCCTTTGG - Intronic
941539936 2:166769765-166769787 TTATCAGTTTAAGGAGCTTTTGG + Intergenic
941561027 2:167044538-167044560 TTATCAGTTCTAAGAGCCTTTGG - Intronic
941561151 2:167046236-167046258 TTATCAGTTCTAGGAGCTTTTGG + Intronic
941566174 2:167111051-167111073 TTATCAGATCAAGGAGCTTTTGG + Intronic
942274081 2:174305866-174305888 TTATTAGTTCTAAGAGTTTTTGG + Intergenic
942405079 2:175645616-175645638 TTATTAGTTCTGGCAGGTTTTGG + Intergenic
942632492 2:177966233-177966255 TTACCAGATCTAGGAGCTTTGGG + Intronic
942729086 2:179043920-179043942 TTATTAGTTTCAGAAGCTTTTGG - Intronic
942819613 2:180096801-180096823 TTATCAGATCAAGGAGCTTTGGG - Intergenic
942829083 2:180217386-180217408 TTATCAGATCTAGGAGCTTTTGG - Intergenic
943124433 2:183779206-183779228 TTATCGGGTCTAGGAGCCTTTGG + Intergenic
943150361 2:184104688-184104710 TTACTAGTTATAGGATCCTTGGG - Intergenic
943205042 2:184884071-184884093 TTATCAGATCTAGGAGCTTTGGG - Intronic
943297672 2:186159123-186159145 TTATCAGATCTAGGAGCTTTTGG - Intergenic
943312129 2:186339098-186339120 TTCTCACTTCTAGGAGCTTTTGG + Intergenic
943316206 2:186391052-186391074 TTGTCAGTTCTAGGAGGCTTTGG - Intergenic
943391563 2:187275832-187275854 TTAAAAGATCTAGGAGCTTTGGG + Intergenic
943468612 2:188263225-188263247 TTATTAGTTCTAGCAGATTTTGG - Intergenic
943505819 2:188756220-188756242 TTATCAGGTCTAGGAGCCTTTGG + Intronic
944012996 2:194996956-194996978 TTATCAGTACTAGGAGTCTTCGG + Intergenic
944335939 2:198534726-198534748 TTATCTGATCTAGGAGCTTTCGG + Intronic
944426512 2:199588988-199589010 TTATCAGTTCTGGGACCCTGGGG + Intergenic
944436958 2:199700164-199700186 TTATCAGATCTAGGAGCCTTTGG - Intergenic
944604420 2:201338275-201338297 TTATTAGTTCTAAGAGTTTTTGG + Intronic
944622155 2:201527024-201527046 TTATCAGATCTAGAAGCCTTTGG - Intronic
944627676 2:201588873-201588895 TTATCAGTTTTAGAAGCTTTTGG - Intronic
945342850 2:208678092-208678114 TTATCAGCTCAAGGAGCTTTTGG + Intronic
945526365 2:210892526-210892548 TAATTAGATCTAGGAGGCTTTGG - Intergenic
945909434 2:215631463-215631485 TTATCAGATCTAGGAGCTTTGGG + Intergenic
946319405 2:218942526-218942548 TTTATAGATCTAGGAGCTTTTGG + Intergenic
946542638 2:220702036-220702058 TTGTCAGTTCTAAGAGCTTTTGG + Intergenic
946907659 2:224431842-224431864 TCATTTGTTTTAGGAGCCTTAGG + Intergenic
947312036 2:228814763-228814785 TTATCAGTTCTAGGAGTTTTGGG - Intergenic
1169678234 20:8179512-8179534 TTATTAGATCAAGGAGCTTTTGG + Intronic
1170126965 20:12974507-12974529 TTATCAGTTCTAGGGGCTTTTGG + Intergenic
1170247458 20:14238671-14238693 TTATCAGCTCAAGGAGCTTTTGG - Intronic
1170280855 20:14647241-14647263 TTTTCAGTTCCAGGAGCCCTGGG - Intronic
1170378326 20:15727802-15727824 TTATCAGATCTAGGAGGTTTTGG + Intronic
1170931890 20:20776241-20776263 TTATTAGTTCTAGTAGTTTTTGG + Intergenic
1171158746 20:22901791-22901813 TTATCAGATCTAGTAGTCTTTGG - Intergenic
1171362162 20:24594892-24594914 TTATCAGATCTAGGAGCTTTCGG + Intronic
1171721360 20:28566427-28566449 TTACCAGTTCTAGTAGCTTTTGG - Intergenic
1171785558 20:29460792-29460814 TTACCAGTTCTAGTAGCTTTTGG - Intergenic
1172864045 20:38081428-38081450 TTATCAGAACTAGGAGCCTTTGG + Intronic
1173055584 20:39609189-39609211 TTATCAGTTCAAGGAGTTTTGGG - Intergenic
1173700373 20:45064828-45064850 TTATCAGATCAAGGAGCTTTTGG + Intronic
1173772250 20:45670995-45671017 TTATCAGATCTAGAAGCTTTGGG - Intergenic
1175570529 20:60016490-60016512 TTATCAGTTCTAAGAGTTTTTGG + Intronic
1176658287 21:9608997-9609019 TTATTAGATCTATGAGCTTTTGG + Intergenic
1176804710 21:13469054-13469076 TTTTCAGATCTAGGAGCCTTTGG - Intergenic
1176898288 21:14409326-14409348 TTATTAGTTCTAATAGTTTTTGG + Intergenic
1176898437 21:14411473-14411495 TTATGTGGTCTAGGAGCCTCTGG + Intergenic
1177089301 21:16746703-16746725 TTTTAAGGTCTAGTAGCCTTGGG - Intergenic
1177470522 21:21555462-21555484 TTATTAGTTCTAGGATTCTTTGG + Intergenic
1177878541 21:26665436-26665458 TTATCAGTTCAAGGAGTTTTTGG + Intergenic
1178034573 21:28565052-28565074 TTATCAAATCTTGGAGCCTTTGG - Intergenic
1178039341 21:28622093-28622115 TTATTAGTTTAAGGAGATTTTGG - Intergenic
1178203174 21:30431560-30431582 TTATTGGGTCCAGGAGGCTTCGG + Intergenic
1180294902 22:10925088-10925110 TTACCAGTTCTAGTAGCTTTTGG - Intergenic
1181593206 22:23897012-23897034 TTATTAGTCCCAGGGGACTTAGG - Intronic
1182094815 22:27618945-27618967 TTCTTAGTGCTCGCAGCCTTCGG - Intergenic
1182938546 22:34251319-34251341 TTATTAGTTCAAGAAGTTTTGGG + Intergenic
1184822736 22:46922806-46922828 CTATCAGATCTAGGAGCTTTTGG + Intronic
949119543 3:369476-369498 TTATCAGTTCAAGGAGTTTTGGG + Intronic
949229954 3:1739080-1739102 TTATCATATCTAGGAGCATTTGG + Intergenic
949376515 3:3396347-3396369 TTATCAGCTCTAGGAACCTTTGG + Intergenic
949442692 3:4099723-4099745 TTATCAGTTCTAGTAGGTTTTGG - Intronic
949579489 3:5373192-5373214 TTATTAGTTTAAGGAGATTTTGG + Intergenic
950819940 3:15746085-15746107 TTACCAGTTCTAGGAGGTTTTGG + Intronic
950848578 3:16039766-16039788 TTATCAGATCTAGGAGCCTTTGG + Intergenic
951275591 3:20681561-20681583 TTATCAGATCTAGGAGCCCTTGG - Intergenic
951309123 3:21102368-21102390 TTATTAGATGTAGGAGGATTTGG + Intergenic
951341757 3:21497164-21497186 TTGTTAGATCTAGGAGCTTTTGG - Intronic
951499235 3:23365381-23365403 TTATCAGATCTAGGAACTTTTGG - Intronic
951852641 3:27159747-27159769 TTATTTGTTCTAGAAGAGTTTGG + Intronic
952441769 3:33337729-33337751 TTATCAGATCTAAGAGCCTTTGG - Intronic
952478690 3:33737332-33737354 ATCTAAGTTCCAGGAGCCTTTGG + Intergenic
952582818 3:34854506-34854528 TTAGAAGTTCTAGAAGTCTTTGG - Intergenic
952616757 3:35282514-35282536 TTATTAGCTTAAGAAGCCTTCGG - Intergenic
952669513 3:35949313-35949335 TTATCAGTTCAAGGAGCCTTTGG + Intergenic
952704051 3:36359056-36359078 TTATCAGCTCAAGGAGCTTTTGG - Intergenic
952990248 3:38825178-38825200 CTATTAGAACTAGGAGCCTGGGG - Intergenic
953249307 3:41229581-41229603 TTATTGGATCAAGGAGCTTTTGG + Intronic
953333892 3:42077825-42077847 TTGTCAGAACTAGGAGCCTTTGG + Intronic
953816968 3:46166250-46166272 TTATCAGCTCAAGGAGCTTTTGG + Intronic
954183130 3:48897396-48897418 TTATTAGTTCTAGGCCTCTGGGG - Intronic
954527608 3:51286082-51286104 TTATCAGATCTAGGAACTTTTGG - Intronic
954536719 3:51365363-51365385 TTATTAGCTTAAGGAGCTTTTGG + Intronic
955559278 3:60171349-60171371 TTATGTGTACTTGGAGCCTTTGG + Intronic
955725896 3:61932375-61932397 TGATTATTTCTAGCAGCCTCAGG + Intronic
956355157 3:68383079-68383101 TTATTAGCTTAAGGAGCCTTTGG + Intronic
957136031 3:76290395-76290417 TTATCAGATCTATGAGCTTTTGG + Intronic
957306416 3:78463778-78463800 TTATCAGTTCAAGGAGATTTTGG + Intergenic
957395146 3:79626764-79626786 TTATTAGTTTGAGGAGGTTTGGG - Intronic
957445770 3:80311507-80311529 TTAATAATTCTAGGGGTCTTTGG - Intergenic
957454786 3:80427555-80427577 TTATCAGTTCTAAGAGTTTTTGG - Intergenic
957532167 3:81454278-81454300 TTATCAGTTCTAGGAGCCTTTGG - Intergenic
957580204 3:82062348-82062370 TTATCAGCTCCAGGAGCCTTTGG + Intergenic
957652699 3:83029630-83029652 TTAGCAGTTGTAGGAGGCTTTGG - Intergenic
957681640 3:83443487-83443509 TTATCAGATTTAGGAGTCTTTGG - Intergenic
957879273 3:86188898-86188920 TTATCAGTTACAGGAGCTTTTGG - Intergenic
957896122 3:86423143-86423165 TTATTACTTCTAGTATCCTATGG - Intergenic
957951524 3:87133441-87133463 TTATCAGATCTAGGTGCTTTTGG + Intergenic
957992225 3:87640855-87640877 TTGTCAGTTACAGGAGCCTTTGG + Intergenic
958046862 3:88295497-88295519 TTATCAGTTCAAGGAGTTTTTGG + Intergenic
958063908 3:88518616-88518638 TTATCAGATCTAGGAGCTTTTGG + Intergenic
958088883 3:88849999-88850021 TTATCAGTTCTAGGAGCCTTTGG - Intergenic
958152451 3:89707853-89707875 TCATCAGATCTAGGAGCCTTAGG - Intergenic
958460605 3:94389997-94390019 TTTATCGTTCTAGGAGGCTTTGG - Intergenic
958687813 3:97423268-97423290 TTATCAGATCTAGGAGCTTTTGG - Intronic
958849748 3:99310227-99310249 TTATTAGCTGGAGGAGCTTTGGG - Intergenic
959009396 3:101057437-101057459 TTACCAGTTCTAGGAGCTTTTGG + Intergenic
959046008 3:101474556-101474578 TTATCAGTTTAAGAAGCCTTTGG + Intronic
959125566 3:102286521-102286543 TTATCGGTTCTAGGAGCTTTTGG + Intronic
959128408 3:102319679-102319701 TTATCAGTTCAAGGAGCATTTGG + Intronic
959250769 3:103941215-103941237 TTATCTGTTCTAAGAGTCTTTGG + Intergenic
959274976 3:104267197-104267219 TTATCAGTTCTAGGAGTTTCTGG + Intergenic
959407937 3:105984121-105984143 TTATTAGTTCTAAAAGTATTTGG - Intergenic
959482627 3:106891939-106891961 TTATCAGATCAAGGAGTCTTTGG - Intergenic
959488206 3:106953205-106953227 TTATTAGTTACAGGAGTTTTGGG + Intergenic
959719921 3:109475028-109475050 TTATAAGATCTAGAAGCCTGTGG + Intergenic
959734178 3:109639037-109639059 TTATCAGATCAAGGAGCTTTTGG + Intergenic
959779085 3:110206317-110206339 TTATTAGCTTAAGGAGCTTTTGG - Intergenic
959870193 3:111318264-111318286 TTATCAGATCAAGGAGCTTTGGG - Intronic
960015311 3:112881119-112881141 TTATCAGTTCTAGGAGCCTTTGG + Intergenic
960118540 3:113923152-113923174 TTATCAGATCTAGGAGCTTTTGG + Intronic
960560472 3:119077793-119077815 TTATAAAATCCAGGAGCCTTTGG - Intronic
960617726 3:119611734-119611756 TTATCAGGTCTAGAAGTCTTTGG + Intronic
960721633 3:120629888-120629910 TTATTGGTTGAAGGAGCTTTTGG - Intronic
960758393 3:121045736-121045758 TTATTAGCTTAAGGAGCTTTTGG + Intronic
961938692 3:130613892-130613914 TTATCAGATCAAGGAGCTTTTGG + Intronic
961985857 3:131133817-131133839 TTATTATTTCAAGGAGATTTTGG + Exonic
962478188 3:135775651-135775673 TTATCAGTTCTAGGAGCCTTTGG - Intergenic
962503024 3:136014705-136014727 TTATCAGATCTAGGAGCTTTTGG + Intronic
962512074 3:136112402-136112424 TTATCAGATCTAGGAGCCTTTGG - Intronic
962706480 3:138049591-138049613 TTAGTAGATCTAGGTGCATTTGG - Intergenic
962910479 3:139844553-139844575 TTATCAGTTCAAGGAGTTTTTGG + Intergenic
962972320 3:140414160-140414182 TTATTAGTTACAGCAGTCTTTGG - Intronic
962994225 3:140609494-140609516 TTATCAGTTCTAGGAGCCTTTGG - Intergenic
963362174 3:144288539-144288561 TTATCAGATCTAGGAGCTTTGGG + Intergenic
963509784 3:146232717-146232739 TTATCAGTTCTAGGAGCCTTTGG + Intronic
963579365 3:147105225-147105247 TTATTAGTTCTAACAGATTTTGG + Intergenic
963692911 3:148527024-148527046 TTATCAGTTCCATGAGTCTTTGG - Intergenic
964076001 3:152692569-152692591 ATATCAGTTCTAGGAGCTTTTGG - Intergenic
964142187 3:153416562-153416584 TTATCAGTTCTAGGAGCGTTTGG + Intergenic
964148150 3:153491142-153491164 TTATTAGTTCTAAGAGTTTTGGG - Intronic
964486886 3:157194825-157194847 TTATCAGATCTAGGAGCTTTTGG - Intergenic
964807727 3:160630005-160630027 TTATCAGTTTAAGGAGCTTTTGG - Intergenic
965075309 3:163967848-163967870 TTATCAGTTCTAAGAGTTTTTGG - Intergenic
965093882 3:164197285-164197307 TTATCAGTTCGAGGAGCAGTTGG - Intergenic
965147324 3:164923502-164923524 TTATCTGATCTAGGAGCTTTTGG + Intergenic
965228262 3:166019603-166019625 TTATATGTTTTAGGAGCTTTTGG - Intergenic
965636157 3:170783108-170783130 TTATCAGATCAAGGAGCTTTTGG - Intronic
965649829 3:170922229-170922251 TTATCAGATCAAGGAGCTTTTGG - Intergenic
965796129 3:172440365-172440387 TTATTAAATATTGGAGCCTTTGG + Intergenic
965850014 3:173011708-173011730 TTATCAGTTCTAGGAGCTTTTGG - Intronic
966122729 3:176540690-176540712 TTATCAGTTCCAGGAGTTTTTGG - Intergenic
966361990 3:179139816-179139838 TCATCAGATCTAGAAGCCTTTGG - Intergenic
966512346 3:180777983-180778005 TTGTCAGATCTAGGAGCCTTAGG + Intronic
966636676 3:182142181-182142203 TTATTAGTCCTGGGTGACTTTGG + Intergenic
966654491 3:182339872-182339894 TTATCAGTTCCAGGAGCCTTTGG - Intergenic
966746873 3:183285445-183285467 TTACTAGTTGTATGACCCTTGGG + Intronic
966970019 3:185035872-185035894 TTATCAGTTCTAGGAGCCTCTGG - Intronic
966977889 3:185102183-185102205 TTATTAGCTGAAGGAGCTTTTGG - Intronic
967025744 3:185562222-185562244 TTATTCGTTCTGGGCTCCTTAGG - Intergenic
967146656 3:186612349-186612371 TTACTAGTGCTAGGAGACTCTGG + Intergenic
967449859 3:189612004-189612026 TTATTAGCTGGAGGAGCTTTTGG + Intergenic
967637794 3:191824429-191824451 TTATTAGCTGAAGGAGCTTTGGG - Intergenic
967670921 3:192234413-192234435 TTGTCAGTTCTATGAGCTTTTGG + Intronic
969908577 4:10421463-10421485 TTATCAGTTCTAGGAGGCTTTGG + Intergenic
970170670 4:13286669-13286691 TTATCAGATCTAGGAGTCTTTGG + Intergenic
970248258 4:14086880-14086902 TTATCAGTTTAAGAAGCCTTTGG + Intergenic
970379935 4:15496677-15496699 TTATCAGATCTAGGAGCCTTTGG - Intronic
971558056 4:28038510-28038532 TTATCAGTTCTAGCAGCCTTTGG - Intergenic
971933072 4:33110853-33110875 TTATTAGTCCTAGAAGCCTTTGG + Intergenic
971954548 4:33399483-33399505 TTATTAGTTCTAATAGTTTTTGG - Intergenic
972010543 4:34175229-34175251 TTATCAGGTCTAGGAGCTTTGGG - Intergenic
972071676 4:35027422-35027444 TTATTACTTCTCAAAGCCTTTGG + Intergenic
972097012 4:35360602-35360624 TTATCAGTTCTAAGAGTTTTTGG + Intergenic
972214996 4:36887478-36887500 TTATCAGATATAGGAGCCTTTGG + Intergenic
972419688 4:38875547-38875569 TTATCAGATCTAGGAGCCTTTGG + Intronic
972466153 4:39358990-39359012 TTATTAGTTAGAGGCACCTTTGG - Intronic
972470619 4:39400374-39400396 TTATTAGTGCCAGGATTCTTTGG + Intergenic
972825626 4:42756005-42756027 TTATTAGCTTAAGGAGCTTTTGG + Intergenic
972827113 4:42771875-42771897 TTATCAGTTCTAGGAGATTTGGG - Intergenic
972896110 4:43621678-43621700 TTATCAGATCTAAGAGCCTTTGG - Intergenic
973034292 4:45386661-45386683 TGGTGAATTCTAGGAGCCTTTGG + Intergenic
973129449 4:46632396-46632418 TTATCAGCTCTAGAAGGCTTTGG + Intergenic
973143738 4:46799238-46799260 TTATCCGATCTAGGAGGCTTTGG + Intronic
974155512 4:58066979-58067001 TTATCAGATCAAGGAGCTTTTGG - Intergenic
974297152 4:60015410-60015432 TTATTATATCAAGGAGCTTTGGG + Intergenic
974411657 4:61549211-61549233 TTATCAGATCAAGGAGCTTTTGG + Intronic
974460868 4:62186187-62186209 TTATCAGGTCTAGGAGATTTTGG + Intergenic
974482724 4:62467252-62467274 TTATCAGTTCGGGGAGTCTTTGG - Intergenic
974544235 4:63279421-63279443 TAATCAGATCTAGGAGCTTTTGG - Intergenic
974942369 4:68484825-68484847 TTATCAGTTCTAGGAGCCTTTGG + Intronic
975977874 4:80119829-80119851 TTATCAGTTCAAGAAGCTTTTGG - Intronic
976003057 4:80395285-80395307 TTATTAGTTCTAGTAATTTTTGG + Intronic
976374907 4:84334924-84334946 TTACTAGTTCTAGAAGCCCTTGG + Intergenic
976960946 4:90972247-90972269 TTATTAGTTCTAATAGTTTTGGG - Intronic
977002038 4:91517076-91517098 TTATCAGTTCAAGGAACTTTTGG + Intronic
977149945 4:93498653-93498675 TTATTAGTTTTAGGAGTTTTTGG + Intronic
977385281 4:96331466-96331488 TTATCAGATCTAGGTGTCTTTGG - Intergenic
977505579 4:97899086-97899108 TTATTAGCTGAAGGAGCTTTTGG - Intronic
977735092 4:100405091-100405113 TTATCAGAGCTAGGAGCCTTTGG + Intronic
977954090 4:103007239-103007261 TTTTTATATCTAGGAGCTTTTGG - Intronic
977997355 4:103510979-103511001 GTATCAGTTATAGGAACCTTGGG + Intergenic
978047308 4:104146310-104146332 TTATCAGGTGTAGGAGTCTTTGG - Intergenic
978050868 4:104198344-104198366 TTACCAGTTCTGGGAGCTTTTGG + Intergenic
978271454 4:106894829-106894851 TTATCAGATCAAGGAGCTTTTGG - Intergenic
978288825 4:107112531-107112553 TTATTAGTCCTAGTAGTTTTTGG - Intronic
978771538 4:112461643-112461665 TTATTAGATCTAGGAGCATTTGG - Intergenic
979662767 4:123277353-123277375 TTATCAGATCCAGGAGCTTTTGG + Intronic
979758355 4:124369846-124369868 TTATCAGATATAGAAGCCTTTGG + Intergenic
980282931 4:130743709-130743731 TTATCATTTCTAGTAGCCTTTGG + Intergenic
980288751 4:130816236-130816258 TTATCAGTACCAGGAGTCTTTGG + Intergenic
980343891 4:131586577-131586599 TTATTAGTACTAAGAGTTTTAGG + Intergenic
980454896 4:133026296-133026318 TTATAGGGTCTAAGAGCCTTTGG - Intergenic
980456492 4:133050547-133050569 TTATCAGATCTAGGAGCATTTGG - Intergenic
980516974 4:133876870-133876892 TTATCAGATCAAGGAGCTTTTGG + Intergenic
980540065 4:134181635-134181657 TTATCATATCTAGGAGCTTTGGG - Intergenic
980562388 4:134494375-134494397 TTATTAGTTCTAAGAGGTTTTGG - Intergenic
980694890 4:136341943-136341965 TTATCAGATCTAGGAGCTTTTGG - Intergenic
981402185 4:144326392-144326414 TTATCAGTTCTACGAGCCTCTGG - Intergenic
981460146 4:145004216-145004238 TTATCAGATCAAGGAGCTTTGGG + Intronic
981466483 4:145078136-145078158 TCATCAGATCTAGGAGTCTTTGG - Intronic
981655338 4:147106136-147106158 TTATCAGCTGAAGGAGCCTTTGG - Intergenic
981954251 4:150450268-150450290 TATTTAGTTATAGGAGCCCTAGG - Intronic
982348960 4:154393779-154393801 TAATTAATTCTGGGAGTCTTTGG - Intronic
982451400 4:155556543-155556565 TGATCAGTTCTAGGAACTTTTGG - Intergenic
982505390 4:156210904-156210926 TTATTAGTTCTAAGAGCGTTTGG - Intergenic
982589701 4:157291821-157291843 TTATCAGTTCTATGAGCTTTTGG - Intronic
982779177 4:159472548-159472570 GTATTAGGTCTAGGAGATTTAGG - Intergenic
983072410 4:163284430-163284452 TTAACAGTTCTAGGAACTTTTGG + Intergenic
983130255 4:164010395-164010417 TTATTAGTTTTAAGAGTTTTTGG - Intronic
983548073 4:168984171-168984193 TTATCAGATCTAGGAGCCTTTGG - Intronic
983589066 4:169387874-169387896 TTATTGGTTCCAGGACCCTGTGG + Intergenic
983778201 4:171634902-171634924 TTATCAGATCTAGGAGCCCTTGG - Intergenic
983876723 4:172885438-172885460 TTATCAGTTCCAGGAACTTTTGG + Intronic
984023436 4:174514780-174514802 TTATCAGTTCTAGGAAACTTTGG - Intronic
984057340 4:174946373-174946395 GTATTAGATCTAGGAGCTTTGGG + Intronic
984307056 4:178006925-178006947 TTATTGGTTCCAGTAGCCTATGG - Intergenic
985158194 4:187015127-187015149 TTATCAGTTCTAGTAGCATTTGG - Intergenic
985186440 4:187321620-187321642 TTATCAGATCTAGGGGCTTTTGG - Intergenic
985214073 4:187630479-187630501 TTATTAGTTCTAACAGTTTTTGG - Intergenic
985375367 4:189331600-189331622 TTATCAGTTCCAGGAGCCTTTGG - Intergenic
985417125 4:189747076-189747098 TTATTAGATCTATGAGCTTTTGG - Intergenic
986229326 5:5847621-5847643 TTATCAGATCTAGGAGCTTTTGG + Intergenic
986539813 5:8832686-8832708 TTATCAGATCTAAGAGTCTTTGG - Intergenic
986984995 5:13490871-13490893 TTATCAGATCTAGGAGCTTTTGG + Intergenic
987030079 5:13968189-13968211 TTATCAGTGCTAGGAGCTTTTGG + Intergenic
987159643 5:15128435-15128457 TTATCAGATCTAGGAGCTTTTGG + Intergenic
987517164 5:18925755-18925777 TTATTAGTTCTAACAGTTTTTGG + Intergenic
987644608 5:20652346-20652368 TTATCAAATCTAGGAGCTTTTGG - Intergenic
987661013 5:20876051-20876073 TTATCAGATCTAAGAGCTTTTGG - Intergenic
987820963 5:22966063-22966085 TTATCAGCTCTAGGAACCTTTGG + Intergenic
987893565 5:23915728-23915750 ATATCAGTTCTAAGAGCTTTTGG - Intergenic
987951785 5:24686241-24686263 TTATTAGTTCTAGTAGTTTCTGG - Intergenic
987974488 5:24995248-24995270 TTATCATATATAGGAGCCTTTGG - Intergenic
988012175 5:25502607-25502629 TTACTAGTTCTAGGAAGTTTTGG + Intergenic
988056326 5:26102147-26102169 TTATCAGATCTAGGAACTTTTGG - Intergenic
988104904 5:26732131-26732153 TTATCAGTTCTAGTAGCCTTTGG + Intergenic
988185066 5:27849620-27849642 TTATTATTTCTAGGAGTCTTTGG + Intergenic
988306112 5:29496627-29496649 TTATCAGCTCAAGGAGCTTTTGG + Intergenic
988350003 5:30090688-30090710 TTATGAGTTGTAGGATCCATTGG - Intergenic
988645460 5:33090631-33090653 TTGTTAGATCTAGGAGCTTTGGG + Intergenic
988762626 5:34329639-34329661 TTATCAGATCTAAGAGCTTTTGG + Intergenic
988976147 5:36517732-36517754 TTATCAGATCTAGGAGCTTTTGG - Intergenic
988979892 5:36556749-36556771 TTATCAGATCTAGGAGCTGTTGG - Intergenic
989086423 5:37681305-37681327 TTATTAGGTTAAGGAGCTTTTGG + Intronic
989244529 5:39239426-39239448 TTATCAGATCTAGGAGCTTTTGG - Intronic
989347820 5:40449806-40449828 TTATCAGTTCAAGGAGTTTTTGG + Intergenic
989358156 5:40567802-40567824 TTATTATATCTAGGAGTCCTAGG - Intergenic
989360068 5:40591873-40591895 TTATCAGATCTAGAAGGCTTTGG + Intergenic
989484389 5:41972210-41972232 TTGTCAGTTCTAAGAGCCTTTGG - Intergenic
989495192 5:42103440-42103462 TTATCAGCTCTAGGAGCCTTTGG + Intergenic
989561836 5:42861016-42861038 TTATCAGTTCTGGGAGTTTTGGG + Intronic
989692924 5:44166943-44166965 TTATTAGATCTGGGATTCTTTGG + Intergenic
989715972 5:44463874-44463896 ATATTAGATCTAGGAGTTTTGGG + Intergenic
989778462 5:45236684-45236706 TTATTAGATCTAAGAGCTATTGG + Intergenic
989824972 5:45842454-45842476 TTATCAGATCTAGGAGCCTTTGG + Intergenic
989845465 5:46135123-46135145 TTATCAGCTCTAGGAGATTTTGG - Intergenic
990860459 5:60320670-60320692 TTATCAGATCTAGGAGGTTTTGG - Intronic
991177006 5:63700578-63700600 TTATCAGATCTGGGAACCTTTGG - Intergenic
991226648 5:64281181-64281203 TTATCAGATCTAGGAGCTTTTGG + Intronic
991504764 5:67312874-67312896 TTATCAGTTGAATGAGCCTTTGG - Intergenic
992284434 5:75219253-75219275 TTATCAGCTCAAGGAGCTTTTGG - Intronic
992305580 5:75433866-75433888 TTATTGGTTCTAGGAGCCTTTGG + Intronic
992965958 5:82000581-82000603 TTATTAGATCTAGGAGCTTTTGG - Intronic
993073016 5:83189549-83189571 TTATTAGTTCTAAGAAATTTGGG + Intronic
993233944 5:85278590-85278612 TTATTAGGTCTAGGAGCCTTTGG - Intergenic
993253730 5:85560301-85560323 TTATTAGTTCAAGAAGTTTTTGG - Intergenic
993263231 5:85688600-85688622 TTATTGGTCCTGTGAGCCTTTGG + Intergenic
993429697 5:87816458-87816480 TTATCAGATCTAGGAGCCTTTGG + Intergenic
993608651 5:90027438-90027460 TAATCAGATCTAGGAGCTTTTGG - Intergenic
993633990 5:90322081-90322103 TTATCAGATCTAGGAGCTTTTGG + Intergenic
993754851 5:91715976-91715998 TTTATAGTTCTAGGAGCTTTTGG + Intergenic
993797429 5:92284633-92284655 TTATCAGATCAAGGAGCCTTTGG - Intergenic
993801555 5:92349492-92349514 TTATCAGATCAAGGAGCTTTTGG + Intergenic
993923654 5:93838922-93838944 TTATCAGATCAAGGAGCTTTTGG + Intronic
993944793 5:94105254-94105276 TTATCAGATCTAGGAACCATTGG - Intronic
993952895 5:94198331-94198353 TTATCAGTTCTAAGAGCCTTTGG + Intronic
993986696 5:94606025-94606047 TTATCAGCTGAAGGAGCCTTTGG - Intronic
994129352 5:96207178-96207200 TTATCAGATTTAGGAGCTTTTGG + Intergenic
994257766 5:97620123-97620145 TTATAAGTTCTGGGAGCCTTTGG + Intergenic
994266185 5:97719665-97719687 TTATCAGTTTTAGGAGATTTTGG + Intergenic
994315953 5:98333342-98333364 TTATTAGTTCAAGAAGTTTTGGG + Intergenic
994348440 5:98716352-98716374 TTATCAGTTTCAGGAGCTTTTGG + Intergenic
994696742 5:103080839-103080861 TTATTAGTTCAAACAGCTTTTGG + Intergenic
994864548 5:105249915-105249937 TTATTAGTTCTAATAGTTTTTGG - Intergenic
994907965 5:105865526-105865548 TTATCAGATCCAGGAGCTTTGGG - Intergenic
995099828 5:108286405-108286427 TTGTCAGTTCAAGGAGCTTTTGG - Intronic
995439921 5:112179925-112179947 TTACTAGCTCTAGAAGCTTTTGG - Intronic
995581172 5:113604577-113604599 TAATTAGTTCAAGTAGCTTTTGG - Intergenic
995693454 5:114853494-114853516 TTTTCAGTTCTAGGAGCTTATGG + Intergenic
995961053 5:117840339-117840361 TTATTAGCTGAAGGAGCTTTTGG - Intergenic
995995074 5:118288211-118288233 TTATCAGATCAAGGAGCTTTGGG + Intergenic
996053534 5:118959211-118959233 TTATTAGATCTAGGAGCTTTTGG - Intronic
996071972 5:119141364-119141386 TTATCAGATCTAGGAGCTTTTGG - Intronic
996076495 5:119200945-119200967 TTATCAGATCTAGGAGCTTTTGG + Intronic
996237953 5:121156658-121156680 TTATCAGCTCAAGGAGCTTTTGG + Intergenic
996274664 5:121650042-121650064 TTATCAGTTCTAGGAGCCTTTGG - Intergenic
996295261 5:121907055-121907077 TTATCAGATCTAGGAGCTTTTGG - Intergenic
996454786 5:123668322-123668344 TTATTAGCTTAAGGAGCTTTTGG - Intergenic
996458363 5:123711453-123711475 TCATTTGTTCTAGTAGCCATAGG - Intergenic
996503955 5:124247874-124247896 TTATCAAATCTAGGAGTCTTTGG - Intergenic
996599287 5:125243267-125243289 TTATCGGGTCAAGGAGCCTTTGG + Intergenic
996623825 5:125544424-125544446 TTATTAGTTCTAAGAGGTTTGGG + Intergenic
997021838 5:130011729-130011751 TTATCAGATCTAGGAGCCTTTGG - Intronic
997181866 5:131837734-131837756 TTATTAGCTTAAGGAGCTTTTGG + Intronic
997773999 5:136582552-136582574 TTATAAGATCTAGGAGCTTTTGG + Intergenic
998635136 5:143945509-143945531 TTATCAGTTCTAGGAGCCTTTGG + Intergenic
998673457 5:144380104-144380126 TTATCATTTATAGGACCCTTTGG - Intronic
999070889 5:148742558-148742580 TTATCAGAGCTAGGAGCTTTTGG - Intergenic
999346614 5:150827731-150827753 TTATCAGTTCTAGGAGCATTTGG + Intergenic
999541625 5:152580983-152581005 TTATCAGTTCTAGGAGCTCTTGG + Intergenic
999834780 5:155357667-155357689 TTATTAGTTCTAGGAGCCTTTGG - Intergenic
1000134459 5:158333210-158333232 TTATCAGATCTAGGAACCTTTGG + Intergenic
1000493127 5:161940647-161940669 TTATCAGTACTAGGAACCTTTGG + Intergenic
1000526492 5:162364961-162364983 TTATCAGTTCCAGGAGCCTTTGG - Intergenic
1001886628 5:175297341-175297363 TTATAAGATCAAGGAGCTTTTGG - Intergenic
1002582722 5:180219458-180219480 TTATCAGATCCAGGAGCCTTTGG + Intergenic
1002821098 6:725438-725460 TTATTAGCTGAAGGAGCTTTTGG + Intergenic
1003370431 6:5520224-5520246 TTATTATTTCTAGGTTCCTGAGG + Intronic
1003582377 6:7352147-7352169 TTGTCAGTTCTAGGAGCTTTTGG - Intronic
1003797903 6:9626380-9626402 TTATTAGTTCTAACAGTTTTTGG + Intronic
1004614136 6:17273635-17273657 TTATCACATCTAGGAGCTTTTGG - Intergenic
1004757366 6:18626744-18626766 TTATTAGTTCTAACAGTTTTTGG - Intergenic
1004766258 6:18730818-18730840 TTAACAGAACTAGGAGCCTTTGG - Intergenic
1005438129 6:25836776-25836798 TTAGCAGGTCTAGGACCCTTTGG + Intronic
1005465365 6:26107642-26107664 TTATTGGTTTTAGCAGTCTTTGG + Exonic
1005653363 6:27906329-27906351 TTATCAGTTCCAGGAGACTTTGG - Intergenic
1005775035 6:29121744-29121766 TTATCAGATCAAGGAGCTTTTGG - Intergenic
1005781087 6:29192970-29192992 TTATCAGATCAAGGAGCTTTTGG - Intergenic
1006962847 6:37951251-37951273 TTATCAGATCTAGGAGCTTTTGG + Intronic
1007438530 6:41836707-41836729 TTATAAGATCTAGGATCTTTTGG - Intronic
1007861371 6:44912685-44912707 TCATTGGTTCTAGGTGCTTTAGG - Intronic
1008021188 6:46579621-46579643 TTATCAGTTTTAGGAGATTTGGG - Intronic
1008029843 6:46682600-46682622 TTATTAATTCTTGTAGCTTTTGG - Intergenic
1008183209 6:48359417-48359439 TTATCAGTTTAAGGAGCTTTTGG - Intergenic
1008736554 6:54551446-54551468 TTATCAGATCTAGGAGCTTTTGG - Intergenic
1008801610 6:55375500-55375522 TTATTAGCTTAAGAAGCCTTTGG + Intronic
1009033176 6:58084933-58084955 TTATCAGTTCTAGGAGCCTTTGG - Intergenic
1009208784 6:60836704-60836726 TTATCAGTTCTAGGAGTCTTTGG - Intergenic
1009265710 6:61552033-61552055 TTATCAGCTCAAGGAGCTTTGGG + Intergenic
1009265735 6:61552389-61552411 TTATCAGCTCAAGGAGCTTTTGG + Intergenic
1009511828 6:64561439-64561461 TTATCAGTTCAATGAGCTTTTGG - Intronic
1009526634 6:64755055-64755077 TTATCAAATCTAGGAGTCTTCGG - Intronic
1009547261 6:65035448-65035470 TTATCAGATCTAGGAGCTTTTGG - Intronic
1009584253 6:65576693-65576715 TTATTAGTTCTAACAGTTTTTGG - Intronic
1009729714 6:67584833-67584855 TTATCAGTTCTAAGAGGCTTTGG + Intergenic
1009871231 6:69454213-69454235 TTATCAGATCAAGGAGCTTTTGG + Intergenic
1009915681 6:69992831-69992853 TTCTGAGATCTAGGAGCATTTGG + Intronic
1009997438 6:70912023-70912045 TTGTCAGATCTAGGAGCTTTTGG + Intronic
1010166915 6:72925782-72925804 TTAGTAGTTCTAGGAATCTGAGG + Intronic
1010322702 6:74531149-74531171 TTTTCAGATCTAGGAGCTTTGGG - Intergenic
1010432895 6:75798869-75798891 TTATCAGTTCTTGGAGTCTTTGG - Intronic
1010495413 6:76529258-76529280 TTATCAGATCAAGGAGCTTTTGG + Intergenic
1010544112 6:77128657-77128679 TTATCAGTTCCAGGAGACTTTGG - Intergenic
1010607771 6:77912685-77912707 TTATTAGATCTAAGAGTTTTTGG + Intronic
1010647116 6:78403063-78403085 TTATCAGATCTAGGAGCTTTTGG + Intergenic
1010654742 6:78499025-78499047 TTGTCAGATCTAGGAACCTTTGG + Intergenic
1011072910 6:83405383-83405405 TTATCAGTTCAAGGAGTTTTGGG + Intronic
1011619786 6:89231912-89231934 TTATCAGTTTTAGAAGCCTTTGG + Intergenic
1011944528 6:92884361-92884383 TTATTAGTTTAAGGAGTTTTTGG - Intergenic
1012573393 6:100760030-100760052 TTATTAGTTTAAGGAGTTTTGGG + Intronic
1012885101 6:104836790-104836812 TTATTAGTTCTGGGGGACTTTGG - Intronic
1012923092 6:105239830-105239852 TTATCAGTTGTAGGAGCTTCTGG - Intergenic
1013461948 6:110383046-110383068 TTATCAGTTCAAGAAGCTTTTGG - Intergenic
1013686132 6:112585477-112585499 TTCTTAGATCTAGGAGGTTTTGG + Intergenic
1013848389 6:114483038-114483060 TTATCAGATCAAGGAGCTTTGGG - Intergenic
1014179434 6:118368692-118368714 TTATGAGTTCTAGGGGACTTTGG - Intergenic
1014306609 6:119750641-119750663 TTGTTAGGTCTAGGAGATTTTGG + Intergenic
1014348330 6:120305101-120305123 TTATTTGTTTTAGGAGATTTGGG + Intergenic
1014385175 6:120791885-120791907 TTTTTAGTTCTAGGACCTTGAGG + Intergenic
1014389629 6:120845291-120845313 TTATTACTTGTATGAACCTTGGG + Intergenic
1014481713 6:121947175-121947197 TTACCAGTTCTAGGAGCTTTTGG + Intergenic
1014567090 6:122962611-122962633 TTATCAGATCTAGGAGCTTTTGG - Intergenic
1014591976 6:123284777-123284799 TTATCAGTTCTAGGGGCTTTTGG - Intronic
1014934409 6:127369944-127369966 TTATTAGTTCTAACAGTTTTTGG + Intergenic
1015161839 6:130161081-130161103 TGATTAGTTCTAGAGGCCTGTGG + Intronic
1015494012 6:133861303-133861325 TTATTAGCTGAAGGAGCTTTTGG + Intergenic
1016498755 6:144693769-144693791 TTATTAGCTTAAGGAGCTTTTGG + Intronic
1016988560 6:149913073-149913095 TTCTGAGTTCTAGTAGCCCTGGG + Intergenic
1017007868 6:150040965-150040987 TTCTGAGTTCTAGCAGCCCTGGG + Intergenic
1017762361 6:157579764-157579786 TTATCAGATCAAGGAGCTTTTGG + Intronic
1017845089 6:158250594-158250616 TTCTTAATTCTGAGAGCCTTGGG + Intronic
1018074168 6:160195800-160195822 TTATTAGTTCTAAGACGTTTTGG - Intronic
1018570119 6:165200893-165200915 TTATTAGTCCCAGGAGCTTTTGG - Intergenic
1018574281 6:165243061-165243083 TTATTATTTCTAGGAGTTCTTGG - Intergenic
1018599330 6:165522886-165522908 TTATCAGTTCTAGGAGCCTTTGG - Intronic
1018661892 6:166095752-166095774 TTATCAGCTGTAGGAGCTTTTGG + Intergenic
1019000944 6:168751230-168751252 TTATCAGTTCTAGAAGCTTTTGG + Intergenic
1019086621 6:169484289-169484311 TTATCAGATCAAGGAGCTTTTGG - Intronic
1019697451 7:2453694-2453716 TTATTAGTTCTAATAGCTTTGGG + Intergenic
1020425852 7:8065280-8065302 TTATCAGATCAAGGAGCTTTTGG + Intronic
1020449999 7:8310174-8310196 TTGTCAGATCTAGGAGTCTTTGG + Intergenic
1020543285 7:9489930-9489952 TTAACAGTTTTAGGAGCCTTTGG + Intergenic
1020545150 7:9518810-9518832 TTATCAGATCAAGGAGCTTTGGG - Intergenic
1020651622 7:10883109-10883131 TTATCAGATCTAGGATCCTTCGG + Intergenic
1020706450 7:11550101-11550123 TTATCAGGTCTGGGAGCCTTTGG - Intronic
1020735629 7:11945892-11945914 TTATTAGCTTAAGGAGCTTTAGG + Intergenic
1020747883 7:12100832-12100854 TTATCAGATCTAGGAGCCTGTGG + Intergenic
1020987147 7:15150182-15150204 TTTTCAGTTGTAGGAGCCTTTGG + Intergenic
1021183622 7:17537119-17537141 TTACCAGTTATAGGAGCTTTTGG - Intergenic
1021259291 7:18433531-18433553 TTATCAGATCTAGGAGCTTTTGG - Intronic
1021351383 7:19598361-19598383 TTTTCTGTTCCAGGAGCCTTTGG + Intergenic
1021529243 7:21624435-21624457 TTATTAGTTCTAACAGTTTTAGG + Intronic
1022168123 7:27793170-27793192 TTATTTGTTTTTGGAGCCTTTGG - Exonic
1023075576 7:36478885-36478907 TCATCAGATCTAGGAGCTTTTGG + Intergenic
1023114712 7:36851381-36851403 GGATTGGTTCCAGGAGCCTTTGG - Intergenic
1023211704 7:37812680-37812702 TTTATAGAACTAGGAGCCTTTGG - Intronic
1024106377 7:46091737-46091759 TTATCAGATCTAGGATCTTTTGG + Intergenic
1024332123 7:48165955-48165977 TTATTAGTAGAAGTAGCCTTTGG - Intergenic
1024351625 7:48371665-48371687 TTATTAGCTTTAGGAACTTTTGG + Intronic
1024406415 7:48986936-48986958 TTGTCAGATCTAGGAGCTTTTGG + Intergenic
1024666691 7:51554012-51554034 TTATCAGTTTAAGGAGACTTTGG + Intergenic
1024703697 7:51933909-51933931 TTATTAGTTCTAATAGTTTTGGG + Intergenic
1024853479 7:53748451-53748473 TTATTAGATCTAGCAGCTTTTGG - Intergenic
1025966791 7:66280495-66280517 TTATCAGATCTAGAAGCTTTTGG + Intronic
1025972483 7:66340504-66340526 TTATCAGTTCTAGCAGTTTTTGG - Intronic
1026226446 7:68446259-68446281 TTATTAGTTCTCCCTGCCTTTGG + Intergenic
1027356981 7:77367101-77367123 TTATCAGTTGAAGGAGCTTTTGG + Intronic
1027508163 7:79044685-79044707 TTATCAGATCTAGGAGCTTTTGG - Intronic
1028343411 7:89750705-89750727 TTATAAGGTCTAGGAGCTTTCGG - Intergenic
1028353114 7:89873925-89873947 TTATTAGATCAAGGAGATTTGGG + Intergenic
1028397284 7:90384741-90384763 TAATAAGTTCTCAGAGCCTTTGG - Intronic
1028767254 7:94573604-94573626 TTATTAGTGAAAGGAGCTTTTGG + Intergenic
1028776061 7:94677966-94677988 TTATTAAATCTAGGAGTCTTTGG + Intergenic
1030398735 7:109021085-109021107 TTATTAGTTCTAGCAGTTTTGGG + Intergenic
1030614220 7:111721281-111721303 TCATAAGTTCTAGGAGCCTTTGG - Intergenic
1030910003 7:115235571-115235593 TTATTGGTTCCAGGAGTTTTTGG + Intergenic
1031052782 7:116961720-116961742 TTATTAGCTTAAGGAGCTTTTGG + Intronic
1031215721 7:118887889-118887911 TTATCAATTCTAGGAGTTTTTGG - Intergenic
1031302130 7:120073975-120073997 TTATCAGTTCTAAGAGTTTTTGG - Intergenic
1031547073 7:123064065-123064087 TTATTAGATCTAGGAGGTTTTGG + Intergenic
1031699885 7:124911518-124911540 TGATTTGTTCTATGAGCTTTAGG + Intronic
1031736243 7:125365632-125365654 TTATCAGATCTAGGTGCTTTTGG + Intergenic
1032146306 7:129384654-129384676 AACTTAGTACTAGGAGCCTTAGG - Intronic
1032307380 7:130748508-130748530 TTCTTAGTTCTATGAACTTTTGG - Intergenic
1032647672 7:133843544-133843566 TTATCAGATCAAGGAGCTTTTGG + Intronic
1032778407 7:135140439-135140461 TTAGCAGATCTAGGAGCCTTTGG + Intronic
1032965929 7:137097497-137097519 TTATCAGATGTAGGAGCCTTTGG - Intergenic
1033831310 7:145256979-145257001 TTATAAATTCCAGGAGCCTTTGG + Intergenic
1034094824 7:148397635-148397657 TAATTGGCTCTAGCAGCCTTGGG - Intronic
1034173958 7:149085960-149085982 TTATCAGATCAAGGAGCGTTTGG + Intronic
1034756445 7:153625674-153625696 TTATCAATTCTAGGAGCCTTTGG + Intergenic
1035645840 8:1218999-1219021 TTATCAGTTTTAGGAGCCTTTGG + Intergenic
1036278497 8:7378461-7378483 TAATTTGTTATAGGAGCCGTAGG - Intronic
1036343026 8:7933425-7933447 TAATTTGTTATAGGAGCCGTAGG + Intronic
1036498317 8:9290498-9290520 TTATCAGTTCTAGGAGCTTTTGG + Intergenic
1036633926 8:10534830-10534852 TTATCAGCTCTAGGAGACTTTGG - Intronic
1036737901 8:11335184-11335206 TTATTAGTTCTAGGAGATTATGG - Intergenic
1037347235 8:17913606-17913628 TTATTAGTTCTAGTATTCCTTGG - Intergenic
1037685391 8:21134838-21134860 TTATCAGTTCAAGGAGATTTTGG + Intergenic
1038371539 8:26997632-26997654 TTATTAGTTCTATTAACTTTTGG + Intergenic
1038519945 8:28222735-28222757 TTATCAGTTCTAGGAGCTTTGGG + Intergenic
1038829982 8:31046279-31046301 TTATTTATTTTAGGAGACTTTGG + Intronic
1038867015 8:31449960-31449982 TTATCAGTTCCACAAGCCTTTGG - Intergenic
1038990638 8:32863868-32863890 TTATCAGTTCTAGGAGCCTTTGG - Intergenic
1039367250 8:36942745-36942767 TTTTCAGTTCTAGGAGCCTTTGG - Intergenic
1039631486 8:39116613-39116635 TTATCAGATCTAGGAGCCTTTGG + Intronic
1039658053 8:39432152-39432174 TTATCTGTTCTAGGAGCCCTTGG + Intergenic
1039763553 8:40604097-40604119 TTATCAGATCTAGGAGCTTTTGG + Intronic
1039801621 8:40961886-40961908 TTATAAGTTCTAGCAGTTTTTGG - Intergenic
1040812146 8:51465662-51465684 TTATCAGTTCTAGGAGGCTTTGG - Intronic
1041302562 8:56428444-56428466 TTATCAGATCAAGGAGCTTTTGG + Intergenic
1041366311 8:57109138-57109160 TTATCAGTTTAAGGAGCTTTCGG - Intergenic
1041427146 8:57735019-57735041 TTCCCAGTTCTAGGAGCCTTTGG + Intergenic
1042110456 8:65376032-65376054 TTGGAATTTCTAGGAGCCTTAGG - Intergenic
1042156533 8:65850161-65850183 TCATTTGTTATAGCAGCCTTAGG + Intergenic
1042401156 8:68348843-68348865 TTATCAGTTGAAGGAGCTTTGGG + Intronic
1042621393 8:70709567-70709589 TTATCAGTTCTAGGAGCCTTTGG - Intronic
1042764426 8:72304963-72304985 TTATTACATCTAGCAGCTTTTGG + Intergenic
1042818048 8:72899491-72899513 TTATCAGTTTTGGGAGCTTTTGG - Intronic
1042976333 8:74474169-74474191 TTATCAGCTTTAGGAGCTTTTGG + Intronic
1043025317 8:75060055-75060077 TTATCAGTTTAAGGAGCTTTTGG - Intergenic
1043626215 8:82262283-82262305 TTATTAGTTCCAGGAGTTTTTGG + Intergenic
1043764496 8:84112965-84112987 CTGTCAGTTCTAGGAGCCTTTGG + Intergenic
1044177704 8:89150184-89150206 TTACCAGTTCTAGGAGGCTTTGG + Intergenic
1044315455 8:90745455-90745477 TTATCAGCTTAAGGAGCCTTTGG + Intronic
1045095711 8:98795655-98795677 TTATCAGTTCCAGGAGCCTTTGG - Intronic
1045410976 8:101918601-101918623 TTATCAGTTGCAGGAGCCTTTGG - Intronic
1045636562 8:104198477-104198499 TGATTATTTCTAGGAGGCTGTGG + Intronic
1045671370 8:104557393-104557415 TTATCAGTTCTAGGAGCTTTCGG - Intronic
1045734531 8:105279636-105279658 TTATTTGTTCCAGTAGCCATTGG + Intronic
1045829512 8:106441793-106441815 TTATCAGTTCAAGAAGTCTTTGG + Intronic
1045882846 8:107061559-107061581 TTATTAGTTTAAGGAGATTTGGG + Intergenic
1045909168 8:107385507-107385529 TTATCAGATCTAAGATCCTTTGG + Intronic
1046134892 8:110012851-110012873 TTATTAGCTTAAGAAGCCTTTGG + Intergenic
1046282785 8:112055605-112055627 TTATCAGATCTAGAAGTCTTTGG + Intergenic
1046488217 8:114913663-114913685 TTATCAGATCCAGGAGCTTTGGG - Intergenic
1046959757 8:120098226-120098248 TTATCAGATCTAGGAGCTTTTGG + Intronic
1046977901 8:120303115-120303137 TTATTAGCTGAAGGAGCTTTTGG + Intronic
1047130407 8:122013691-122013713 TTATCAGATCTAGGAGTTTTTGG + Intergenic
1047357170 8:124133589-124133611 TTATTAAATCTAGGAGCTTTTGG - Intergenic
1047580530 8:126209977-126209999 TTATCAATTCTAGGAGACTTTGG + Intergenic
1047834756 8:128676523-128676545 TTATCAGTTCTAGTAGTCTTTGG - Intergenic
1048086167 8:131182530-131182552 TTTTCAGTTCTATGAGCCTTTGG + Intergenic
1048646294 8:136424334-136424356 TTATTAGTTCTGAGAGATTTTGG + Intergenic
1048658234 8:136567374-136567396 TTATCAGTTCTAAGTGCCTTTGG - Intergenic
1049115567 8:140684124-140684146 TTATCAGATCTAGGAGCTTTTGG - Intronic
1049281449 8:141750203-141750225 TTATTAGTTCTAGTAGGTTTGGG - Intergenic
1049952511 9:659264-659286 TTCTTGGCTCTTGGAGCCTTAGG + Intronic
1050070506 9:1807635-1807657 TTATTAGTTTTAGTAGCTCTTGG + Intergenic
1050133295 9:2435555-2435577 TTATCAGTTCTAGGAGCTTTTGG + Intergenic
1050238512 9:3609414-3609436 TTATCAGATCTGGGAGCTTTTGG + Intergenic
1050295560 9:4201447-4201469 TTATCAGTTCTAGGAGCCTTTGG - Intronic
1050309990 9:4342971-4342993 TTATCAGATCTAGGAGCTTTTGG + Intronic
1050314709 9:4389467-4389489 TTTTTAGTTCCAGCAGCCTTTGG - Intergenic
1050549452 9:6736694-6736716 TTTTCAGATCTAGGAGCTTTGGG - Intronic
1050878372 9:10669836-10669858 TTATGAGATCAAGGAGCTTTTGG + Intergenic
1051096581 9:13473184-13473206 TTATCAGATCTAGGAGCTTTTGG + Intergenic
1051573453 9:18586203-18586225 TTATTGGTTTAAGGAGCTTTTGG - Intronic
1051861607 9:21631358-21631380 CTATTAGATCTAGGAGCTTTTGG - Intergenic
1052007387 9:23364671-23364693 TTATTAGTTTGAGGAGTTTTTGG - Intergenic
1052103902 9:24487700-24487722 ATGTTAGTTCTAGGAGCCGCTGG - Intergenic
1052253904 9:26430954-26430976 TTACCAGTTCTAGGAGATTTTGG - Intergenic
1052267185 9:26588515-26588537 TTATTAGTTCTAACAGTTTTTGG + Intergenic
1052277927 9:26699466-26699488 TTATGAGTTCTGGGAGTCTTTGG - Intergenic
1052281574 9:26739170-26739192 CTATCAGTTATAGGAGCCTTTGG - Intergenic
1052694447 9:31858125-31858147 TTATCAGATCTAGAAGCTTTTGG - Intergenic
1054831719 9:69632647-69632669 TTATTAGTTCAACTACCCTTGGG + Intronic
1054932264 9:70647807-70647829 TTATCAGTTCTTGGAGCCTTTGG - Intronic
1055131676 9:72782574-72782596 TTATCAGATCTAGGAACCTTTGG - Intronic
1055168698 9:73228028-73228050 TTATCAGTTTAAGGAGCTTTGGG - Intergenic
1055207268 9:73747570-73747592 TTATCACTTCTAGGAGCCTTTGG + Intergenic
1055365343 9:75538459-75538481 TTATCAAACCTAGGAGCCTTTGG + Intergenic
1055372983 9:75620228-75620250 TTATTAGCTCAAGGAGATTTTGG + Intergenic
1055387924 9:75784208-75784230 TAATCAGTTCTAGGAGCCTTTGG + Intergenic
1055531594 9:77189975-77189997 TTATTAGTTCTAGGAACCTTTGG + Intronic
1055829813 9:80364932-80364954 TTATTAGCTGAAGGAGCTTTTGG - Intergenic
1056477697 9:86968712-86968734 TTACCAGTTCTTGGAGCCTACGG - Intergenic
1056604120 9:88071573-88071595 TTTTTAGATCTAGGGGCTTTTGG - Intergenic
1056691530 9:88812351-88812373 AGATTATTTCTAGGGGCCTTTGG + Intergenic
1057136688 9:92694782-92694804 TTATCAGTTCTAGGGCCCTTTGG + Intergenic
1057241281 9:93412696-93412718 TTATTAGTTCTAGCACTTTTTGG + Intergenic
1057339514 9:94187220-94187242 TTATTAGTTCTGGTAGTATTTGG + Intergenic
1057756196 9:97838576-97838598 TTATCAGCTCTAGGAGCCTTTGG + Intergenic
1058196199 9:101979386-101979408 TTATAAGCCCTAGGAGCCTTTGG - Intergenic
1058198918 9:102013734-102013756 TTCTCAGTTCTAGGAGCTTTGGG - Intergenic
1058228256 9:102393663-102393685 TTATTATTTAGAAGAGCCTTGGG - Intergenic
1058244434 9:102605031-102605053 TTATTAATTTTAGAAGCTTTTGG - Intergenic
1058311561 9:103510119-103510141 TTTTTAGTTCTGGGGGACTTGGG - Intergenic
1058346295 9:103967221-103967243 TTATTAGCTGAAGGAGCTTTTGG + Intergenic
1058831176 9:108818197-108818219 TTAGGAGATCTAGGAGCTTTTGG - Intergenic
1058839005 9:108887457-108887479 TTATTAGTTCTAGAAGCTCTTGG - Intronic
1059345227 9:113623777-113623799 TTAATAGTTCAAGGAGCCCAAGG + Intergenic
1059510735 9:114843468-114843490 TTATCCGTTCCAGGAGGCTTTGG - Intergenic
1059778661 9:117503357-117503379 TTAACAGATCTAGGAGCTTTTGG + Intergenic
1060026954 9:120181211-120181233 TTATCAGTTCAAGGAGTTTTTGG - Intergenic
1060964750 9:127706297-127706319 TTGTGAGTTGTAGGACCCTTGGG - Intronic
1061440338 9:130598826-130598848 TTTTTAGATGTGGGAGCCTTTGG - Intronic
1062256777 9:135627248-135627270 TTGTTAGTTCTAGGAGATATTGG - Intronic
1202801784 9_KI270720v1_random:6209-6231 TTACCAGTTCTAGTAGCTTTTGG - Intergenic
1203636018 Un_KI270750v1:112572-112594 TTATTAGATCTATGAGCTTTTGG + Intergenic
1186018260 X:5224227-5224249 TTATCCAGTCTAGGAGCCTTTGG - Intergenic
1186372647 X:8963152-8963174 TTATCAGATCTAGGAGCTTTTGG - Intergenic
1186583802 X:10850045-10850067 TGATTAGCTCCAGGAGCCATGGG + Intergenic
1186639435 X:11439767-11439789 GTATTATTTCTAGAAGCCTTAGG + Intronic
1186934895 X:14438026-14438048 TTAATAGTTCTAGCAGATTTTGG + Intergenic
1186937403 X:14465327-14465349 TTATCAGTTCTAAGAGTTTTTGG + Intergenic
1187214952 X:17267238-17267260 TTCTTAGTTCTAGTTGGCTTTGG + Intergenic
1187600107 X:20819702-20819724 TTATCAGATCTACGAGCCTTTGG - Intergenic
1187615172 X:20985702-20985724 TTATCAGATCTAGGAGCTTTTGG - Intergenic
1187756163 X:22529190-22529212 TTATCAGTTCAAGGAGCTTTTGG - Intergenic
1187801857 X:23072555-23072577 TTATCAGTTCTAGGAGCCTTTGG - Intergenic
1187807964 X:23142329-23142351 TTCTTAGTCCTAGAAGTCTTGGG - Intergenic
1188035258 X:25310640-25310662 TTATCAGATTGAGGAGCCTTTGG + Intergenic
1188123886 X:26344162-26344184 TTATCAGATCTAGGAGCCTTTGG + Intergenic
1188155371 X:26735510-26735532 TTATCAGATCTAGGAGCCTTTGG + Intergenic
1188172714 X:26947825-26947847 TTATCAGATCAAGGAGCTTTTGG + Intergenic
1188297996 X:28473308-28473330 TTATCAGATCTAGGAGATTTAGG - Intergenic
1188426688 X:30055936-30055958 TTATCAGTTCTAATAGCTTTTGG + Intergenic
1188725144 X:33573736-33573758 TTATCAGGTCTAGGAGCCTTTGG + Intergenic
1188794019 X:34440608-34440630 TTATCAGATCTAGGAGTTTTTGG + Intergenic
1188861804 X:35266909-35266931 TTATTAGTTCTAATAGGTTTTGG + Intergenic
1188869382 X:35355303-35355325 TTATCACTTCCAGGAGCCTTTGG - Intergenic
1188880469 X:35485964-35485986 TTATCAGTTCTAGGAGCCTTTGG - Intergenic
1189209364 X:39271012-39271034 TTATCAGATATAGGAGCTTTTGG - Intergenic
1189584027 X:42438952-42438974 TTATCAGATCCAGGAGCTTTTGG - Intergenic
1189644607 X:43114383-43114405 TTATTGTTCCTAGGAACCTTAGG - Intergenic
1189653476 X:43215348-43215370 TTATCAGTTCTAGGAGCCTTTGG - Intergenic
1189861621 X:45277877-45277899 TTATCAGATATAGGAGCCTGTGG + Intergenic
1189898114 X:45677262-45677284 TTATCAGATCTAGGAGCTTTTGG - Intergenic
1189963465 X:46347975-46347997 TTATTATTTCTAGGAGTTTCTGG - Intergenic
1190922802 X:54872053-54872075 TTATTTGTTTTAGGAGTTTTAGG + Intergenic
1190944105 X:55073907-55073929 TTATAAGATCAAGGAGCTTTTGG + Intergenic
1190945368 X:55087909-55087931 TTATAAGATCAAGGAGCTTTTGG + Intergenic
1190963863 X:55278957-55278979 TTATCAGATCAAGGAGCTTTCGG + Intronic
1191017226 X:55821931-55821953 TTATCAGTTCTACAAGCTTTTGG + Intergenic
1191072341 X:56414189-56414211 TTATCAGGTCTAGGAGCCTTTGG + Intergenic
1191169494 X:57428016-57428038 TTATCAAATCTAGGAGTCTTTGG - Intronic
1191190777 X:57664884-57664906 TTATTAGTTTAAGAAGCTTTTGG - Intergenic
1191685830 X:63889439-63889461 TTATCAGATTTAGGAGCTTTTGG - Intergenic
1191747462 X:64505110-64505132 TTATTAGGTGAAGGAGCTTTTGG - Intergenic
1191860242 X:65660362-65660384 TTATCAGATCTAGGAGCCTTTGG + Intronic
1191891230 X:65944050-65944072 TTATCAGATCTTGGAGCTTTTGG + Intergenic
1191927820 X:66333859-66333881 TTATCAGATCTAGGAGCCTTTGG + Intergenic
1192257662 X:69477890-69477912 ATATTAGTTCTAGGAGGTTTGGG - Intergenic
1192311406 X:70017966-70017988 TTATCAGATCAAGGAGCTTTTGG - Intronic
1192637511 X:72833321-72833343 TTATCAGTTCTAAGAGTTTTCGG - Intronic
1192644203 X:72887493-72887515 TTATCAGTTCTAAGAGTTTTCGG + Intronic
1192696832 X:73425532-73425554 TTATTAGCTGGAGGAGCTTTTGG - Intergenic
1192941920 X:75921345-75921367 TTATCAGATCTAGGAGCCTTTGG - Intergenic
1192967021 X:76188474-76188496 TTATCAGTTCTGGGAGCTTTTGG + Intergenic
1193024747 X:76834087-76834109 TTATAAGTTCTAGGTGCTTTTGG + Intergenic
1193090350 X:77487296-77487318 TTATCAGATCAAGGAGCTTTTGG - Intergenic
1193236985 X:79119297-79119319 TTATGAAGTCTAGGAGCCTTTGG + Intergenic
1193291078 X:79773403-79773425 TTATTAGATTTAGGAGCCTTTGG + Intergenic
1193310962 X:80010326-80010348 TTATCAGATCAAGGAGCTTTTGG + Intergenic
1193314537 X:80048642-80048664 TTATCAGATCTAGGAGCTTTTGG + Intergenic
1193405906 X:81101905-81101927 TTATCAGATCTAGGAGCTTTTGG + Intergenic
1193440178 X:81530940-81530962 TTATCAGATCTAGGAGTCTTTGG + Intergenic
1193457370 X:81747412-81747434 TTATCAGCTCAAGGAGACTTTGG - Intergenic
1193499385 X:82255830-82255852 TTAACAGATCTAGGAGCTTTTGG + Intergenic
1193512903 X:82427938-82427960 TTATCAGCTCTAGGAGTCTTTGG + Intergenic
1193558918 X:82993395-82993417 TTATTAGTTCAAGCAGTGTTTGG + Intergenic
1193563758 X:83052437-83052459 TTATTAGCTCAAGGAGTTTTGGG + Intergenic
1193567046 X:83089258-83089280 TTATTAGATCCAGGAGCACTTGG + Intergenic
1193577988 X:83227337-83227359 TTATTAGATATAGGAGCTTTTGG + Intergenic
1193598341 X:83476515-83476537 TTATCAGATCTAGGAGCTTTTGG - Intergenic
1193634849 X:83936711-83936733 TTCTTAGTTCTAGGGGCCTTTGG + Intergenic
1193636728 X:83959598-83959620 CTATCAGTTCTAGGAGAATTTGG - Intergenic
1193744525 X:85259767-85259789 TTATCAGTTCTAATAGCCTTTGG + Intronic
1193790598 X:85811586-85811608 TTATTAGATCAAGGAGCTTTTGG - Intergenic
1193858471 X:86635644-86635666 TTATTAGCTTAAGGAGCTTTTGG - Intronic
1193881820 X:86932472-86932494 GTATTGGTTCTAAAAGCCTTTGG + Intergenic
1193920540 X:87420005-87420027 TTATCAGTTCAAGGAGCCTTTGG - Intergenic
1193947766 X:87759757-87759779 TTATCAGTTCTAAGAGCGTTTGG + Intergenic
1193976195 X:88122043-88122065 TTATCAAATCAAGGAGCCTTTGG - Intergenic
1193995134 X:88356960-88356982 TTATTAGTTTTAACAGCTTTGGG - Intergenic
1194034926 X:88858722-88858744 TTTTCAGATCTAGGAGCTTTAGG + Intergenic
1194176657 X:90658107-90658129 TTATTAGTTCTAAAAGATTTTGG + Intergenic
1194425754 X:93735672-93735694 TTATCAGTTCTAGGGGTCTTTGG + Intergenic
1194511941 X:94807516-94807538 TTATTAGCTAAAGGAGCTTTTGG + Intergenic
1194554054 X:95336350-95336372 TTATCAGTTCTAGGAGATTTTGG - Intergenic
1194574483 X:95594994-95595016 TTATTAGTTGAAGGACACTTGGG - Intergenic
1194811524 X:98393007-98393029 TTATCAGATCGAGGTGCCTTTGG + Intergenic
1194847945 X:98835191-98835213 TTATCAGATCTAGGAGACTTTGG + Intergenic
1194873071 X:99156966-99156988 TCATCAGTTCTATAAGCCTTTGG - Intergenic
1194904736 X:99560663-99560685 TTATAATTTCTAGGAGCCTTTGG - Intergenic
1194962724 X:100254302-100254324 TTATTAGCTGGAGGAGCTTTTGG - Intergenic
1195013697 X:100757543-100757565 TTATCAGATCTAGGAGTTTTTGG - Intergenic
1195024142 X:100858808-100858830 TTATCAGATCTAGGAGCTTTTGG + Intronic
1195207783 X:102620794-102620816 TTATCAGCTCAAGGAGCTTTTGG + Intergenic
1195448508 X:104981457-104981479 TTATCGGATCTAGGAGTCTTTGG + Intronic
1195479910 X:105332631-105332653 TTATTAGTTCTAATAGTTTTTGG - Intronic
1195534482 X:105995732-105995754 TTATCAAGTCTAGGAGCCTTTGG - Intergenic
1195610346 X:106859572-106859594 TTACTAAATCTAGGAGCTTTTGG + Intronic
1195612394 X:106882870-106882892 TTATCAGTTCTAAGAGTTTTTGG - Intronic
1195685887 X:107585319-107585341 TTATTAGTTTAAGGAGTTTTTGG + Intronic
1196219840 X:113100329-113100351 TTATCAGTTCCAGAAGACTTTGG + Intergenic
1196233984 X:113257774-113257796 TTATCAGTTCAAGGAGCTTTTGG + Intergenic
1196244707 X:113387281-113387303 TTATCAGATCAAGGAGCTTTTGG + Intergenic
1196566664 X:117214035-117214057 TTATTTGTTCCAGGAGCCTTTGG - Intergenic
1196608150 X:117679294-117679316 TTATCAGCTCCAGGAGCCTTTGG - Intergenic
1196926438 X:120637886-120637908 TTATCAGATCAAGGAGCTTTTGG - Intergenic
1197177188 X:123498723-123498745 TTATCAGATCTAGGAGCTTTGGG + Intergenic
1197422341 X:126253890-126253912 TTATCAAATCTAGGAGCATTTGG + Intergenic
1197473118 X:126887306-126887328 TTATCAGTTCCAGCAGCATTTGG - Intergenic
1197474545 X:126904733-126904755 TTATCAGCTCTAGGAGCTTTTGG - Intergenic
1197548627 X:127860188-127860210 TTATCAGGTCTAAGAGCTTTCGG + Intergenic
1197740380 X:129887708-129887730 TTATTAGTTCTAGTAGATTTTGG - Intergenic
1198733100 X:139755102-139755124 TTATCAGGTCAAGGAGCTTTTGG - Intronic
1198842106 X:140868343-140868365 TCATCAGATCTAGGAGCCTTTGG - Intergenic
1198891153 X:141398244-141398266 TTATTAGATCAAGGAGCTTTTGG + Intergenic
1199244557 X:145587827-145587849 TTATCATATCTAGAAGCCTTTGG - Intergenic
1199245914 X:145603992-145604014 TTATCAGATCAAGGAGCTTTTGG - Intergenic
1199249405 X:145642466-145642488 TTATTAGTTATAGCAGTTTTTGG - Intergenic
1199272073 X:145895872-145895894 TTATCAGATCTAGGAGCTTTTGG + Intergenic
1199284474 X:146040600-146040622 TTAAAAGATCCAGGAGCCTTTGG - Intergenic
1199354309 X:146843226-146843248 TTATCAGACCTAGGAGCCTTTGG + Intergenic
1199379878 X:147157939-147157961 TTATTAGTGGAAGGAGCTTTTGG - Intergenic
1199407683 X:147481779-147481801 TCATTAAATCTAGGAGTCTTTGG + Intergenic
1199636239 X:149814749-149814771 TTATCAGATCTAGGAGCTTCTGG - Intergenic
1199913327 X:152311818-152311840 TTATCAGCTCTAGGAGTCTGTGG - Intronic
1199994718 X:153014819-153014841 TTGTCAGATCTAGGAGCCTTTGG - Intergenic
1200317756 X:155151697-155151719 TTATCAGTTCTAGGAGTTTTTGG + Intergenic
1200326352 X:155244263-155244285 TTATTAGTTCTAACAGTTTTTGG + Intergenic
1200406461 Y:2816819-2816841 TTATCAGATCTAGGAGCCTTTGG + Intergenic
1200523282 Y:4238976-4238998 TTATTAGTTCTAAAAGATTTTGG + Intergenic
1200607653 Y:5286768-5286790 TTATCAGATCTAGGAGCTTTGGG + Intronic
1201991136 Y:20027682-20027704 TTGTCAGTTCTAGAAGCCTCTGG - Intergenic
1202018609 Y:20439125-20439147 TTGTCAGCTCTAAGAGCCTTTGG - Intergenic