ID: 918515970

View in Genome Browser
Species Human (GRCh38)
Location 1:185363576-185363598
Sequence TGAAGTTGTTTATTAGTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4176
Summary {0: 7, 1: 72, 2: 315, 3: 765, 4: 3017}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918515970_918515971 -10 Left 918515970 1:185363576-185363598 CCTAGAACTAATAAACAACTTCA 0: 7
1: 72
2: 315
3: 765
4: 3017
Right 918515971 1:185363589-185363611 AACAACTTCAGTAACATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918515970 Original CRISPR TGAAGTTGTTTATTAGTTCT AGG (reversed) Intergenic
Too many off-targets to display for this crispr