ID: 918515970

View in Genome Browser
Species Human (GRCh38)
Location 1:185363576-185363598
Sequence TGAAGTTGTTTATTAGTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918515970_918515971 -10 Left 918515970 1:185363576-185363598 CCTAGAACTAATAAACAACTTCA No data
Right 918515971 1:185363589-185363611 AACAACTTCAGTAACATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918515970 Original CRISPR TGAAGTTGTTTATTAGTTCT AGG (reversed) Intergenic