ID: 918515971

View in Genome Browser
Species Human (GRCh38)
Location 1:185363589-185363611
Sequence AACAACTTCAGTAACATTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918515963_918515971 15 Left 918515963 1:185363551-185363573 CCCCCATAGTTTCTGCCCAAAGG No data
Right 918515971 1:185363589-185363611 AACAACTTCAGTAACATTTCAGG No data
918515966_918515971 13 Left 918515966 1:185363553-185363575 CCCATAGTTTCTGCCCAAAGGCT No data
Right 918515971 1:185363589-185363611 AACAACTTCAGTAACATTTCAGG No data
918515969_918515971 -1 Left 918515969 1:185363567-185363589 CCAAAGGCTCCTAGAACTAATAA No data
Right 918515971 1:185363589-185363611 AACAACTTCAGTAACATTTCAGG No data
918515965_918515971 14 Left 918515965 1:185363552-185363574 CCCCATAGTTTCTGCCCAAAGGC No data
Right 918515971 1:185363589-185363611 AACAACTTCAGTAACATTTCAGG No data
918515968_918515971 0 Left 918515968 1:185363566-185363588 CCCAAAGGCTCCTAGAACTAATA No data
Right 918515971 1:185363589-185363611 AACAACTTCAGTAACATTTCAGG No data
918515970_918515971 -10 Left 918515970 1:185363576-185363598 CCTAGAACTAATAAACAACTTCA No data
Right 918515971 1:185363589-185363611 AACAACTTCAGTAACATTTCAGG No data
918515962_918515971 24 Left 918515962 1:185363542-185363564 CCTAGAAAACCCCCATAGTTTCT No data
Right 918515971 1:185363589-185363611 AACAACTTCAGTAACATTTCAGG No data
918515967_918515971 12 Left 918515967 1:185363554-185363576 CCATAGTTTCTGCCCAAAGGCTC No data
Right 918515971 1:185363589-185363611 AACAACTTCAGTAACATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918515971 Original CRISPR AACAACTTCAGTAACATTTC AGG Intergenic