ID: 918517181

View in Genome Browser
Species Human (GRCh38)
Location 1:185375954-185375976
Sequence CAGGGAAAACAATCCGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918517181_918517190 27 Left 918517181 1:185375954-185375976 CCTTTCTCGGATTGTTTTCCCTG No data
Right 918517190 1:185376004-185376026 CTTCTCAAGCTTGGCATGATTGG No data
918517181_918517184 3 Left 918517181 1:185375954-185375976 CCTTTCTCGGATTGTTTTCCCTG No data
Right 918517184 1:185375980-185376002 CTCTTGCCACCACCTCATACAGG No data
918517181_918517189 18 Left 918517181 1:185375954-185375976 CCTTTCTCGGATTGTTTTCCCTG No data
Right 918517189 1:185375995-185376017 CATACAGGGCTTCTCAAGCTTGG No data
918517181_918517185 4 Left 918517181 1:185375954-185375976 CCTTTCTCGGATTGTTTTCCCTG No data
Right 918517185 1:185375981-185376003 TCTTGCCACCACCTCATACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918517181 Original CRISPR CAGGGAAAACAATCCGAGAA AGG (reversed) Intergenic
No off target data available for this crispr