ID: 918519057

View in Genome Browser
Species Human (GRCh38)
Location 1:185394849-185394871
Sequence CTGTAAACACAGATAGTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918519057_918519059 -5 Left 918519057 1:185394849-185394871 CCCAGAACTATCTGTGTTTACAG No data
Right 918519059 1:185394867-185394889 TACAGAGAAAAATTGTATAATGG No data
918519057_918519060 -4 Left 918519057 1:185394849-185394871 CCCAGAACTATCTGTGTTTACAG No data
Right 918519060 1:185394868-185394890 ACAGAGAAAAATTGTATAATGGG No data
918519057_918519062 3 Left 918519057 1:185394849-185394871 CCCAGAACTATCTGTGTTTACAG No data
Right 918519062 1:185394875-185394897 AAAATTGTATAATGGGGATATGG No data
918519057_918519061 -3 Left 918519057 1:185394849-185394871 CCCAGAACTATCTGTGTTTACAG No data
Right 918519061 1:185394869-185394891 CAGAGAAAAATTGTATAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918519057 Original CRISPR CTGTAAACACAGATAGTTCT GGG (reversed) Intergenic
No off target data available for this crispr