ID: 918522954

View in Genome Browser
Species Human (GRCh38)
Location 1:185434965-185434987
Sequence GAGAGGGAAGAGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918522954_918522970 24 Left 918522954 1:185434965-185434987 CCCTCTTCCCTCTCTTCCCTCTC No data
Right 918522970 1:185435012-185435034 CTCTTCCTTGTCTTTCTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918522954 Original CRISPR GAGAGGGAAGAGAGGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr