ID: 918524209

View in Genome Browser
Species Human (GRCh38)
Location 1:185447287-185447309
Sequence ACATGCAAAGGGCTGTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918524200_918524209 7 Left 918524200 1:185447257-185447279 CCTAACTCCACCTGGTAGCATCT No data
Right 918524209 1:185447287-185447309 ACATGCAAAGGGCTGTCCTGGGG No data
918524202_918524209 0 Left 918524202 1:185447264-185447286 CCACCTGGTAGCATCTGAGGTCC No data
Right 918524209 1:185447287-185447309 ACATGCAAAGGGCTGTCCTGGGG No data
918524203_918524209 -3 Left 918524203 1:185447267-185447289 CCTGGTAGCATCTGAGGTCCACA No data
Right 918524209 1:185447287-185447309 ACATGCAAAGGGCTGTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918524209 Original CRISPR ACATGCAAAGGGCTGTCCTG GGG Intergenic
No off target data available for this crispr