ID: 918525178

View in Genome Browser
Species Human (GRCh38)
Location 1:185456873-185456895
Sequence CCTTCCAGGCAGAGGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918525178_918525186 23 Left 918525178 1:185456873-185456895 CCCTGCTCCCTCTGCCTGGAAGG No data
Right 918525186 1:185456919-185456941 CCTCCCTCCCTCATACCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918525178 Original CRISPR CCTTCCAGGCAGAGGGAGCA GGG (reversed) Intergenic
No off target data available for this crispr