ID: 918528766

View in Genome Browser
Species Human (GRCh38)
Location 1:185494395-185494417
Sequence ATAACGTAAATAGCTAAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918528765_918528766 -3 Left 918528765 1:185494375-185494397 CCTTGAGAAGTCTAGAAGTAATA No data
Right 918528766 1:185494395-185494417 ATAACGTAAATAGCTAAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918528766 Original CRISPR ATAACGTAAATAGCTAAATA TGG Intergenic
No off target data available for this crispr