ID: 918531022

View in Genome Browser
Species Human (GRCh38)
Location 1:185523255-185523277
Sequence CCACTACCACAAGAAGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918531019_918531022 12 Left 918531019 1:185523220-185523242 CCATTTATAAAACCATCAGATCT 0: 2484
1: 6562
2: 6618
3: 4875
4: 2730
Right 918531022 1:185523255-185523277 CCACTACCACAAGAAGAGCATGG No data
918531020_918531022 0 Left 918531020 1:185523232-185523254 CCATCAGATCTTGTGAGACTTAT 0: 1337
1: 2885
2: 5481
3: 5461
4: 4813
Right 918531022 1:185523255-185523277 CCACTACCACAAGAAGAGCATGG No data
918531018_918531022 13 Left 918531018 1:185523219-185523241 CCCATTTATAAAACCATCAGATC 0: 526
1: 2269
2: 3026
3: 2266
4: 1554
Right 918531022 1:185523255-185523277 CCACTACCACAAGAAGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918531022 Original CRISPR CCACTACCACAAGAAGAGCA TGG Intergenic
No off target data available for this crispr