ID: 918534949 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:185563980-185564002 |
| Sequence | CCTAGGACTGAGAAGTTTCC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 918534942_918534949 | -5 | Left | 918534942 | 1:185563962-185563984 | CCAACCATCCCTCCTTTGCCTAG | No data | ||
| Right | 918534949 | 1:185563980-185564002 | CCTAGGACTGAGAAGTTTCCAGG | No data | ||||
| 918534944_918534949 | -9 | Left | 918534944 | 1:185563966-185563988 | CCATCCCTCCTTTGCCTAGGACT | No data | ||
| Right | 918534949 | 1:185563980-185564002 | CCTAGGACTGAGAAGTTTCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 918534949 | Original CRISPR | CCTAGGACTGAGAAGTTTCC AGG | Intergenic | ||
| No off target data available for this crispr | |||||