ID: 918534949

View in Genome Browser
Species Human (GRCh38)
Location 1:185563980-185564002
Sequence CCTAGGACTGAGAAGTTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918534942_918534949 -5 Left 918534942 1:185563962-185563984 CCAACCATCCCTCCTTTGCCTAG No data
Right 918534949 1:185563980-185564002 CCTAGGACTGAGAAGTTTCCAGG No data
918534944_918534949 -9 Left 918534944 1:185563966-185563988 CCATCCCTCCTTTGCCTAGGACT No data
Right 918534949 1:185563980-185564002 CCTAGGACTGAGAAGTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918534949 Original CRISPR CCTAGGACTGAGAAGTTTCC AGG Intergenic
No off target data available for this crispr