ID: 918536567

View in Genome Browser
Species Human (GRCh38)
Location 1:185581582-185581604
Sequence GTACAGTTGTGTGCAGCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918536564_918536567 30 Left 918536564 1:185581529-185581551 CCTCTTTTCTGTATTTTTTTTTT No data
Right 918536567 1:185581582-185581604 GTACAGTTGTGTGCAGCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918536567 Original CRISPR GTACAGTTGTGTGCAGCAAC AGG Intergenic
No off target data available for this crispr