ID: 918543656

View in Genome Browser
Species Human (GRCh38)
Location 1:185658612-185658634
Sequence CATGGTAGACAGAATGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918543656_918543664 27 Left 918543656 1:185658612-185658634 CCACCCTCATTCTGTCTACCATG No data
Right 918543664 1:185658662-185658684 CAAACGTGCCAAGCTTCTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918543656 Original CRISPR CATGGTAGACAGAATGAGGG TGG (reversed) Intergenic
No off target data available for this crispr