ID: 918543664

View in Genome Browser
Species Human (GRCh38)
Location 1:185658662-185658684
Sequence CAAACGTGCCAAGCTTCTTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918543656_918543664 27 Left 918543656 1:185658612-185658634 CCACCCTCATTCTGTCTACCATG No data
Right 918543664 1:185658662-185658684 CAAACGTGCCAAGCTTCTTTCGG No data
918543658_918543664 23 Left 918543658 1:185658616-185658638 CCTCATTCTGTCTACCATGTTCT No data
Right 918543664 1:185658662-185658684 CAAACGTGCCAAGCTTCTTTCGG No data
918543659_918543664 9 Left 918543659 1:185658630-185658652 CCATGTTCTAACCCATGAACCTC No data
Right 918543664 1:185658662-185658684 CAAACGTGCCAAGCTTCTTTCGG No data
918543657_918543664 24 Left 918543657 1:185658615-185658637 CCCTCATTCTGTCTACCATGTTC No data
Right 918543664 1:185658662-185658684 CAAACGTGCCAAGCTTCTTTCGG No data
918543660_918543664 -2 Left 918543660 1:185658641-185658663 CCCATGAACCTCTCTGTTCCTCA No data
Right 918543664 1:185658662-185658684 CAAACGTGCCAAGCTTCTTTCGG No data
918543662_918543664 -10 Left 918543662 1:185658649-185658671 CCTCTCTGTTCCTCAAACGTGCC No data
Right 918543664 1:185658662-185658684 CAAACGTGCCAAGCTTCTTTCGG No data
918543661_918543664 -3 Left 918543661 1:185658642-185658664 CCATGAACCTCTCTGTTCCTCAA No data
Right 918543664 1:185658662-185658684 CAAACGTGCCAAGCTTCTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918543664 Original CRISPR CAAACGTGCCAAGCTTCTTT CGG Intergenic
No off target data available for this crispr