ID: 918548840

View in Genome Browser
Species Human (GRCh38)
Location 1:185716694-185716716
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918548839_918548840 16 Left 918548839 1:185716655-185716677 CCTTACTAAAATTTTCACTTGAA No data
Right 918548840 1:185716694-185716716 CTGTATGTGCACATAATGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr