ID: 918552105

View in Genome Browser
Species Human (GRCh38)
Location 1:185755375-185755397
Sequence CAACCTCCTGAATCAGCCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 378}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918552105_918552111 23 Left 918552105 1:185755375-185755397 CCTAAGGCTGATTCAGGAGGTTG 0: 1
1: 0
2: 0
3: 29
4: 378
Right 918552111 1:185755421-185755443 AGACCAAGAAACATCACAATCGG 0: 1
1: 0
2: 0
3: 14
4: 249
918552105_918552109 -6 Left 918552105 1:185755375-185755397 CCTAAGGCTGATTCAGGAGGTTG 0: 1
1: 0
2: 0
3: 29
4: 378
Right 918552109 1:185755392-185755414 AGGTTGTCCAGGATGGCTCAGGG No data
918552105_918552108 -7 Left 918552105 1:185755375-185755397 CCTAAGGCTGATTCAGGAGGTTG 0: 1
1: 0
2: 0
3: 29
4: 378
Right 918552108 1:185755391-185755413 GAGGTTGTCCAGGATGGCTCAGG 0: 1
1: 0
2: 1
3: 31
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918552105 Original CRISPR CAACCTCCTGAATCAGCCTT AGG (reversed) Intronic
900890896 1:5448989-5449011 CTACCTCCTGGGTCAGCCCTGGG - Intergenic
900910891 1:5596340-5596362 CATTCTCCTGCATCAGCCTCTGG - Intergenic
901495884 1:9621560-9621582 CATTCTCCTGACTCAGCCTCTGG - Intergenic
904643840 1:31950977-31950999 CATTCTCCTGACTCAGCCTCTGG + Intergenic
904719378 1:32495774-32495796 AATCCTCCTGCCTCAGCCTTTGG - Exonic
905573858 1:39027677-39027699 CAGTCTCCTGCCTCAGCCTTAGG + Intronic
905588776 1:39143891-39143913 CAGCCTCCTGCCTCAGCCTCTGG + Intronic
905766710 1:40607547-40607569 CCACCTGCTGCATGAGCCTTGGG + Intergenic
905805615 1:40874980-40875002 CATCCTCCTGCCTCAGCCTCTGG + Intergenic
905881435 1:41466764-41466786 TAACTTCCTGAGGCAGCCTTGGG + Intergenic
908160372 1:61402141-61402163 CATTCTCCTGCCTCAGCCTTTGG + Intronic
908283567 1:62569028-62569050 CAACTTCCTGGTTCAGTCTTGGG - Intronic
910041829 1:82861419-82861441 CATTCTCCTGACTCAGCCTCCGG - Intergenic
912827811 1:112922667-112922689 CATTCTCCTGCCTCAGCCTTCGG - Intronic
912840378 1:113034016-113034038 CAATCTCCTGCCTCAGCCTCCGG + Intergenic
914822221 1:151113361-151113383 CATTCTCCTGACTCAGCCTCCGG - Intronic
915887501 1:159738843-159738865 CATTCTCCTGCCTCAGCCTTCGG + Intergenic
916015681 1:160748061-160748083 CAACCTCCTGGAAAAGCCTTTGG - Intronic
916232923 1:162558161-162558183 GATCCTCCTGTTTCAGCCTTGGG + Intergenic
917087301 1:171316827-171316849 CAAGTTCATGAATCTGCCTTAGG + Intronic
917119229 1:171631275-171631297 TAACCTGCTGCATCAGGCTTTGG - Intergenic
917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG + Intronic
917991256 1:180381601-180381623 CATGCTCCTGAATCACCATTGGG + Intronic
918552105 1:185755375-185755397 CAACCTCCTGAATCAGCCTTAGG - Intronic
919239868 1:194900249-194900271 CAACCTCCTGACTAAACTTTAGG - Intergenic
919665149 1:200284322-200284344 AATCCTCCTGCCTCAGCCTTTGG - Intergenic
919729648 1:200904984-200905006 AAACCTCCTGCCTCAGCCTCTGG + Intronic
919942007 1:202294460-202294482 CAACCTCATGAATGAGCCCAGGG - Intronic
921122552 1:212149517-212149539 CATTCTCCTGCATCAGCCTCTGG - Intergenic
921323734 1:213970114-213970136 TTTCCCCCTGAATCAGCCTTAGG + Intergenic
921728600 1:218552165-218552187 CATTCTCCTGACTCAGCCTCTGG + Intergenic
922210484 1:223482837-223482859 CAACCTTCTGAATCCTCTTTTGG + Intergenic
922237191 1:223731118-223731140 CTCCCTCCTTAATCATCCTTTGG - Intronic
922254860 1:223885077-223885099 CATTCTCCTGCCTCAGCCTTCGG - Intergenic
922277060 1:224088897-224088919 AAACCTCCTGCCTCAGCCTCTGG - Intergenic
923471002 1:234291049-234291071 CAACCACAGTAATCAGCCTTTGG - Intronic
924604514 1:245521229-245521251 CATTCTCCTGCCTCAGCCTTCGG - Intronic
924658042 1:245991485-245991507 CAACCTCCTGAAACACCCTGAGG - Intronic
924730570 1:246707763-246707785 CAAGCTCTTCAATCAACCTTTGG - Intergenic
1063586775 10:7359206-7359228 GAACGTCCTGAATGATCCTTGGG - Intronic
1063598310 10:7457551-7457573 CAGACTCATGAATCAGCTTTGGG + Intergenic
1067475190 10:46560223-46560245 TATCCTCCTGCCTCAGCCTTGGG - Intergenic
1068343376 10:55738299-55738321 CATTCTCCTGACTCAGCCTCCGG - Intergenic
1068972823 10:62977286-62977308 CATTCTCCTGACTCAGCCTCCGG - Intergenic
1069123267 10:64596477-64596499 CTACTTCCAGATTCAGCCTTTGG + Intergenic
1069242463 10:66160437-66160459 CCTGCTCCTGAATCAGCATTGGG - Intronic
1071321269 10:84461181-84461203 CAACCTTCTAAATCATCCTTGGG - Intronic
1071335159 10:84594450-84594472 CATTCTCCTGCCTCAGCCTTCGG + Intergenic
1072394042 10:95020164-95020186 CTACTTCCTGATTTAGCCTTGGG + Intergenic
1072829833 10:98645867-98645889 CATTCTCCTGACTCAGCCTCCGG - Intronic
1073810575 10:107148240-107148262 CAATCTCCTAAATCAGGCCTTGG + Intronic
1074667573 10:115747477-115747499 CAGCCTCCTGAATAAGCATTTGG - Intronic
1075341638 10:121650883-121650905 AATCCTCCTGCCTCAGCCTTTGG - Intergenic
1075916328 10:126170547-126170569 GATCCTCCTGACTCAGCCTAGGG - Intronic
1077040326 11:518285-518307 CATTCTCCTGCCTCAGCCTTAGG + Intergenic
1077589068 11:3477804-3477826 TAACCTCCAGGACCAGCCTTAGG - Intergenic
1078235037 11:9476863-9476885 CATTCTCCTGCCTCAGCCTTCGG + Intronic
1079637636 11:22764452-22764474 CATTCTCCTGACTCAGCCTCCGG - Intronic
1081993490 11:47349863-47349885 CAGCCTCCTGAAGCCGCCTGTGG - Exonic
1083062512 11:59889008-59889030 CAACTTCCTGGTTCAGTCTTGGG + Intergenic
1083223778 11:61270912-61270934 CGACCTCCTGGGTCAGCCTCAGG + Intronic
1083816769 11:65137104-65137126 CATTCTCCTGCATCAGCCTCCGG - Intergenic
1083950040 11:65949096-65949118 GATCCTCCTGACTCAGCCTCTGG - Intronic
1084244762 11:67849427-67849449 TAACCTCCAGGACCAGCCTTAGG - Intergenic
1084643489 11:70440220-70440242 CATCCTCCTGCCTCAGCCTCCGG + Intergenic
1084649117 11:70478245-70478267 GATCCTCCTGCATCAGCCTCTGG + Intronic
1084827923 11:71745129-71745151 TAACCTCCAGGACCAGCCTTAGG + Intergenic
1086043634 11:82507777-82507799 AAATGTCCTGGATCAGCCTTTGG - Intergenic
1086948480 11:92867339-92867361 CAACCTTCTTAATCTGCTTTAGG + Intronic
1087179007 11:95123556-95123578 CTACCTCCTGAATCAATGTTTGG - Intronic
1088109599 11:106246740-106246762 CAACGTCCTGAAGCTGCCTAGGG - Intergenic
1088235729 11:107720854-107720876 GACCCTCCTGCCTCAGCCTTCGG - Intergenic
1088398730 11:109399313-109399335 CATCCTCCTGCCTCAGCCTCCGG - Intergenic
1089014073 11:115152720-115152742 CATCCTCCTGCCTCAGCCTCCGG + Intergenic
1091716770 12:2783337-2783359 CATCCTCCTGCCTCAGCCTACGG - Intergenic
1091884598 12:4007018-4007040 AAACCCACTGAGTCAGCCTTGGG + Intergenic
1092167248 12:6349830-6349852 CATTCTCCTGCATCAGCCTCCGG + Intronic
1092343031 12:7692613-7692635 AATTCTCCTGAATCAGCCTCTGG + Intronic
1092376052 12:7956296-7956318 CATTCTCCTGCCTCAGCCTTCGG + Intergenic
1092415330 12:8286572-8286594 TAACCTCCAGGACCAGCCTTAGG - Intergenic
1092740739 12:11626870-11626892 CATTCTCCTGACTCAGCCTCCGG - Intergenic
1092770092 12:11888805-11888827 CATCCTCCTGCCTCAGCCTCCGG + Intronic
1093951826 12:25170860-25170882 TAACCTGCTGAATGAGCATTGGG + Intronic
1093976438 12:25426976-25426998 CATTCTCCTGTCTCAGCCTTCGG - Intronic
1094682474 12:32678769-32678791 CATTCTCCTGCCTCAGCCTTCGG - Intergenic
1096099364 12:48959960-48959982 CATTCTCCTGACTCAGCCTCAGG - Intergenic
1096661208 12:53125271-53125293 CATTCTCCTGCCTCAGCCTTTGG + Intergenic
1097231030 12:57511219-57511241 GATCCTCCTGCGTCAGCCTTCGG + Intronic
1097788522 12:63788556-63788578 AAACCTCATGAATCAACCTCTGG + Intronic
1098611258 12:72461077-72461099 CATTCTCCTGAATTAGCATTAGG - Intronic
1099333422 12:81321938-81321960 AATCCTCCTGTCTCAGCCTTAGG + Intronic
1099547271 12:84000247-84000269 CATCCTCCTGCCTCAGCCTCTGG - Intergenic
1099991737 12:89729570-89729592 CATTCTCCTGCCTCAGCCTTCGG - Intergenic
1101021059 12:100554068-100554090 CAACAAGCTGAATCAGCTTTAGG + Intronic
1101101000 12:101392479-101392501 CTACATCCTGTATCACCCTTAGG - Intergenic
1101418629 12:104530746-104530768 CAGCCTCCTGACTCACCTTTGGG + Intronic
1101608882 12:106272053-106272075 CTTCCTCTTGAATGAGCCTTTGG - Intronic
1102622337 12:114206179-114206201 CAACCTTCTCATTCAGTCTTGGG + Intergenic
1103437531 12:120938238-120938260 CATCCTCCTGCCTCAGCCTCTGG + Intergenic
1103878252 12:124146029-124146051 AAACCTCCAGATGCAGCCTTAGG + Intronic
1104004164 12:124880470-124880492 GATCCTCCTGAGTCAGCCTCTGG - Intronic
1105751193 13:23422762-23422784 CATTCTCCTGCCTCAGCCTTTGG + Intronic
1106070562 13:26407177-26407199 CAGCATCCTGAGTAAGCCTTGGG + Intergenic
1107695502 13:42995428-42995450 CATTCTCCTGCCTCAGCCTTCGG - Intergenic
1107755741 13:43620502-43620524 CCAGCTCCTGAATGAGCATTGGG - Intronic
1108372291 13:49782185-49782207 CAACCTTCTGATTTGGCCTTTGG - Intronic
1108417858 13:50218407-50218429 AATCCTCCTGCCTCAGCCTTAGG + Intronic
1108721217 13:53134780-53134802 CAAAATCCTGAAACAGCCTTAGG + Intergenic
1108869338 13:54963228-54963250 CATCCTCCTGCCTCAGCCTCCGG - Intergenic
1109346170 13:61117236-61117258 CATCCTCCTGCCTCAGCCTCTGG + Intergenic
1109571717 13:64200818-64200840 GATCCTCCTGCCTCAGCCTTTGG - Intergenic
1111332172 13:86773907-86773929 CATTCTCCTGTCTCAGCCTTCGG - Intergenic
1112610329 13:100948945-100948967 CAAACTCCTGGAGGAGCCTTGGG - Intergenic
1114670576 14:24408797-24408819 CAACCTCCAGTATCAGCCCTGGG + Exonic
1117038751 14:51751397-51751419 CGACCTCCGGGACCAGCCTTGGG + Intergenic
1117847207 14:59923833-59923855 CATACTCCTGCCTCAGCCTTCGG - Intronic
1118580736 14:67294776-67294798 CATTCTCCTGCCTCAGCCTTCGG + Intronic
1118869012 14:69726280-69726302 CAATTTCCTGAAACAGGCTTTGG - Intergenic
1119028273 14:71171007-71171029 GATCCTCCTGCCTCAGCCTTCGG + Intergenic
1119234207 14:73006025-73006047 CATTCTCCTGCCTCAGCCTTTGG + Intronic
1119303780 14:73591139-73591161 GATCCTCCTGTCTCAGCCTTCGG - Intergenic
1120009358 14:79395701-79395723 CATTCTCCTGACTCAGCCTCCGG - Intronic
1121186692 14:91978602-91978624 CATCCTCCTGCCTCAGCCTCAGG + Intronic
1121559355 14:94863034-94863056 CATCCTCCTGCCTCAGCCTCTGG - Intergenic
1123722263 15:23069725-23069747 AATCCTCCTGCATCAGCCTTTGG - Intergenic
1124348778 15:28940428-28940450 CATTCTCCTGTCTCAGCCTTCGG - Intronic
1125687806 15:41573777-41573799 GAACCGCCTGAAACAGCCTCCGG + Exonic
1125810371 15:42535250-42535272 AAACCTCATGAACCAACCTTGGG + Intronic
1126836795 15:52675798-52675820 CATTCTCCTGCCTCAGCCTTCGG - Intronic
1127165415 15:56240724-56240746 CTACTTCCTGAATCATCCTTTGG - Intronic
1128483311 15:68059108-68059130 CATTCTCCTGCCTCAGCCTTCGG + Intronic
1128732915 15:70033252-70033274 CCACTTCCTGGATCAGCCTCTGG + Intergenic
1129187935 15:73921983-73922005 CATCCTCCTGCCTCAGCCTCTGG - Intergenic
1130507916 15:84563740-84563762 CATTCTCCTGCATCAGCCTCTGG + Intergenic
1131771277 15:95740567-95740589 CAACCTCCAGAACAAGCCCTTGG - Intergenic
1132126865 15:99235140-99235162 CATCCTCCTGCTTCAGCCTCCGG - Intronic
1132832260 16:1934195-1934217 CATCCTCCTGCCTCAGCCTCCGG + Intergenic
1133142769 16:3760195-3760217 CATCCTCCTGCCTCAGCCTCAGG + Intronic
1133929967 16:10224150-10224172 CATCCTCCTGCCTCAGCCTCCGG + Intergenic
1134050110 16:11131460-11131482 CGGCCTCCTGAAGCAGCCTCTGG - Intronic
1135466602 16:22691793-22691815 GATTCTCCTGAGTCAGCCTTTGG + Intergenic
1135615414 16:23907379-23907401 CATCCTCCTGCCTCAGCCTCTGG + Intronic
1136032764 16:27515584-27515606 CTACCTCCTGAATAAACGTTTGG + Intronic
1136605855 16:31333155-31333177 AATCCTCCTGCATCAGCCTCCGG - Intergenic
1140772013 16:78213883-78213905 CAGCCTCCTGAAACCGCCCTGGG - Intronic
1140938204 16:79695685-79695707 CATTCTCCTGACTCAGCCTCCGG - Intergenic
1141588387 16:85050453-85050475 CATTCTCCTGCCTCAGCCTTGGG + Intronic
1141902326 16:86999619-86999641 CATCCTCCTGACTCAGCCTCTGG - Intergenic
1143592296 17:7892896-7892918 CACCCTCCTGCCTCAGCCTCAGG + Intronic
1145226928 17:21137400-21137422 CATCCTCCTGCCTCAGCCTCCGG + Intronic
1147699129 17:42380805-42380827 GATCCTCCTGCCTCAGCCTTCGG - Intronic
1147818824 17:43229606-43229628 CACCCTCCTGCCTCAGCCTCTGG - Intergenic
1147830364 17:43294747-43294769 CATCCTCCTGCCTCAGCCTCCGG + Intergenic
1147832107 17:43304308-43304330 CACCCTCCTGCCTCAGCCTCTGG - Intergenic
1150492010 17:65580828-65580850 GATCCTCCTGCCTCAGCCTTTGG + Intronic
1151074204 17:71252501-71252523 CTATCTTCTGAATCAGTCTTGGG + Intergenic
1152665093 17:81563462-81563484 GATCCTCCTGCATCAGCTTTCGG - Intronic
1153306910 18:3639858-3639880 CATTCTCCTGCCTCAGCCTTCGG + Intronic
1153354003 18:4115589-4115611 CATCCTCCTGCCTCAGCCTCCGG + Intronic
1153700071 18:7683863-7683885 CAACAACCTGAATGAGCCTGGGG - Intronic
1153872310 18:9332725-9332747 CAACCTCCTGAAAATGTCTTGGG - Intergenic
1155534502 18:26803019-26803041 CAACTTCCAGAAAGAGCCTTAGG - Intergenic
1157730881 18:50003098-50003120 CTACCTCATGACTCTGCCTTCGG - Intronic
1157960435 18:52147871-52147893 AAACCTCATGAATCAGCCTCTGG + Intergenic
1159135809 18:64335605-64335627 CAGCCTCCTGAATCAGCCCCTGG + Intergenic
1161710056 19:5842701-5842723 CATCCTCCTGCCTCAGCCTCTGG + Intergenic
1162743666 19:12787213-12787235 GATCCTCCTGCCTCAGCCTTCGG + Intronic
1162760710 19:12886709-12886731 GATCCTCCTGCATCAGCCTACGG + Intronic
1163525778 19:17820550-17820572 CATCCTCCTGCCTCAGCCTCTGG - Intronic
1163879808 19:19908735-19908757 CATCCTCCTGCCTCAGCCTCTGG - Intronic
1164239713 19:23374452-23374474 CATTCTCCTGACTCAGCCTCCGG - Intronic
1164608934 19:29619073-29619095 AGACCTACTGAATCAGCCTCTGG + Intergenic
1164659577 19:29951032-29951054 CCACCTCCTGCCTCAGCCTTCGG - Intronic
1165306183 19:35004383-35004405 CAACCTTCTGAATCAGAACTGGG - Intronic
1165960867 19:39533197-39533219 CATCCTCCTGCCTCAGCCTCTGG + Intergenic
1166211553 19:41309728-41309750 GATCCTCCTGCCTCAGCCTTTGG - Intronic
1166420716 19:42633917-42633939 CTCCCTGCTGCATCAGCCTTGGG - Intronic
1166458076 19:42961032-42961054 CATTCTCCTGTCTCAGCCTTTGG + Intronic
1166761434 19:45226856-45226878 CATTCTCCTGCCTCAGCCTTCGG + Intronic
1167178864 19:47885869-47885891 CAAACACCTGAATTTGCCTTGGG + Intronic
1167419965 19:49397134-49397156 CAACCTCCTTCATCAGGCTTGGG + Intronic
1167884797 19:52492050-52492072 CATTCTCCTGCCTCAGCCTTTGG - Intronic
925375655 2:3382816-3382838 CATCCTCCTGCCTCAGCCTCTGG - Intronic
925743768 2:7028115-7028137 TAACCTCCTGACTCCTCCTTGGG - Intronic
927028518 2:19095681-19095703 CATTCTCCTGCCTCAGCCTTCGG - Intergenic
927592986 2:24372819-24372841 CATCCTCCTCCCTCAGCCTTCGG - Intergenic
927769928 2:25851031-25851053 CTGCCTCCTGCCTCAGCCTTCGG - Intronic
928064907 2:28153651-28153673 GGACCACCTGCATCAGCCTTGGG + Intronic
928343729 2:30470200-30470222 ATACCTCAAGAATCAGCCTTGGG + Intronic
928684402 2:33733321-33733343 CATTCTCCTGCCTCAGCCTTCGG + Intergenic
931628649 2:64279920-64279942 CTGCCTCCTGACTCTGCCTTTGG - Intergenic
933213382 2:79597364-79597386 CATTCTCCTGACTCAGCCTCCGG - Intronic
935241736 2:101184400-101184422 CATTCTCCTGCCTCAGCCTTCGG - Intronic
937412020 2:121685018-121685040 TAACCTCCAGGACCAGCCTTGGG - Intergenic
938989005 2:136608872-136608894 CAGCCTCCAGAAGCAGCCTAAGG - Intergenic
939292313 2:140212130-140212152 CAACCTCCTGTCTCATCCTGTGG + Intergenic
939979761 2:148765928-148765950 CATTCTCCTGGATCAGCCTCAGG - Intronic
940704922 2:157092899-157092921 AATCCTCCTGACTCAGCCTTTGG - Intergenic
941530881 2:166669434-166669456 CAACAATCTGCATCAGCCTTGGG - Intergenic
942040023 2:172051571-172051593 CAACTTCCTGATTAGGCCTTGGG + Intronic
942677092 2:178438782-178438804 CATTCTCCTGACTCAGCCTCCGG + Intronic
943363408 2:186947174-186947196 CAGCCTTCTGCATCTGCCTTGGG - Intergenic
943654437 2:190492533-190492555 TAACCTCCTGAATTATCATTGGG + Intronic
943654527 2:190493753-190493775 TAACCTCCTGAATTATCATTGGG + Intronic
944046202 2:195414395-195414417 CAAGCTGCTGAAAGAGCCTTTGG + Intergenic
945023977 2:205602577-205602599 CACCTTCCTGATTCAGTCTTGGG + Intronic
945131771 2:206581480-206581502 TAACCTGCTGAATGAGCATTGGG - Intronic
946479292 2:220038492-220038514 CAAATTCCTGTATCATCCTTAGG - Intergenic
947550759 2:231044400-231044422 CATCCTCCTGCCTCAGCCTCTGG - Intronic
948430713 2:237916847-237916869 CAATCTCCTGCCTCAGCCTCCGG + Intergenic
948927655 2:241109621-241109643 CACCCTGCTGACTCAGCCTGGGG - Intronic
1168865532 20:1082706-1082728 CACGCACCTGAATCAGCCCTTGG + Intergenic
1169074072 20:2750818-2750840 CAACCTCCCCACTCAGCCCTCGG - Intronic
1169120748 20:3094209-3094231 CATCCTCCTGCCTCAGCCTCAGG - Intergenic
1169257792 20:4111860-4111882 CAAGTTCCAGAATCAGCTTTGGG - Intergenic
1169972478 20:11283235-11283257 CATCCTCCTGTCTCAGCCTCTGG - Intergenic
1174392003 20:50223510-50223532 CAACCTCCTGTCCCAGTCTTGGG + Intergenic
1174501934 20:50991589-50991611 CATCCTCCTGCCTCAGCCTCCGG + Intergenic
1174509368 20:51039434-51039456 CATCCTCCTGCCTCAGCCTCCGG - Intergenic
1175203790 20:57295529-57295551 CCACCTCCTGAATAAGCCTGTGG + Intergenic
1177396949 21:20548902-20548924 CATTCTCCTGCCTCAGCCTTTGG - Intergenic
1177401322 21:20608993-20609015 CATCCTCCTGAATCACCAGTGGG + Intergenic
1177538617 21:22462805-22462827 GATCCTCCTGCCTCAGCCTTGGG + Intergenic
1177730615 21:25023921-25023943 CATTCTCCTGACTCAGCCTCTGG + Intergenic
1177786973 21:25681874-25681896 CATTCTCCTGCCTCAGCCTTGGG - Intronic
1177860170 21:26443083-26443105 GAAGCTCCTGAATCAACCTTCGG + Intergenic
1178313669 21:31551635-31551657 GATCCTCCTGCCTCAGCCTTTGG - Intronic
1179821812 21:43941439-43941461 GATCCTCCTGCCTCAGCCTTAGG - Intronic
1180627077 22:17200774-17200796 GAACCTCCTGCCTCAGCCTCTGG - Intronic
1182220242 22:28752971-28752993 CATTCTCCTGCCTCAGCCTTCGG - Intronic
1182223923 22:28781143-28781165 CAATCTCCTGAAGCTTCCTTCGG - Exonic
1183535107 22:38396972-38396994 TATCTTCCTGAATCAGCCTATGG - Intronic
1183736469 22:39647515-39647537 CATCCTCCTGCCTCAGCCTTCGG + Intronic
1184014481 22:41775697-41775719 CATCCTCCTGTCTCAGCCTCCGG + Intronic
1184098040 22:42327168-42327190 CAGCCTCCAGACTCAGCCCTGGG - Intronic
1184665559 22:45987152-45987174 CAAGCTCCTGGATTTGCCTTTGG - Intergenic
1184700543 22:46169338-46169360 CAATCTCCTGCTTCAGCCTCCGG + Intronic
1185282922 22:49983383-49983405 CAAGCTCCTGACTCAGCCTCAGG - Intergenic
950279830 3:11697204-11697226 CATCCTCCTGCCTCAGCCTCTGG + Intronic
950481846 3:13249025-13249047 CTACCTCCTGACTCAGACTGTGG + Intergenic
953504877 3:43475702-43475724 CAGTCTCCTGCATCAGCCTCCGG + Intronic
954549851 3:51472193-51472215 CACCCTCCTGCATTAACCTTCGG + Intronic
954819408 3:53312599-53312621 CATCCTCCTGCCTCAGCCTCCGG + Intronic
955534390 3:59907661-59907683 CAACCTCAGGATTCAGCCTGGGG - Intronic
961074311 3:123967508-123967530 CAGCCTTCTCAAACAGCCTTAGG + Intergenic
961892876 3:130145186-130145208 TAACCTCCAGGACCAGCCTTAGG - Intergenic
962567925 3:136682317-136682339 GAACCTCCTGTTTCAGCCTTCGG - Intronic
963024458 3:140905025-140905047 CAACCTCCTGGCTGAGCCTCAGG - Intergenic
963748771 3:149152582-149152604 CCACCTGCTGACTCAGGCTTTGG + Intronic
963798287 3:149653328-149653350 CAATCTCATGAATCAGGCTGGGG - Intronic
963839647 3:150092608-150092630 AATCCTCCTGACTCAGCCTCTGG + Intergenic
964532055 3:157679475-157679497 AAACCTCCTGCCTCAGCCTCGGG + Intergenic
965573840 3:170197912-170197934 CATTCTCCTGCCTCAGCCTTCGG - Intergenic
965775000 3:172219627-172219649 CACCCTCCTGCCTCAGCCTTTGG + Intronic
966288560 3:178326929-178326951 CAAGCTTCTGGAACAGCCTTGGG - Intergenic
967065138 3:185908595-185908617 CATTCTCCTGCCTCAGCCTTTGG + Intergenic
967127844 3:186441761-186441783 GATCCTCCTGCCTCAGCCTTTGG + Intergenic
967490676 3:190087436-190087458 CATTCTCCTGCCTCAGCCTTCGG - Intronic
969377714 4:6773869-6773891 GAGCCTCCTGCCTCAGCCTTGGG - Intergenic
969430158 4:7149220-7149242 AATCCTCCTGACTCAGCCTCAGG - Intergenic
969709351 4:8833879-8833901 CATTCTCCTGACTCAGCCTCCGG + Intergenic
970975395 4:22037555-22037577 CATCTTCCTGATTCAGTCTTGGG + Intergenic
970995097 4:22258187-22258209 CATTCTCCTGCCTCAGCCTTCGG - Intergenic
971073614 4:23123689-23123711 AAACCTACTGAATCAGTCTCTGG - Intergenic
971887892 4:32476261-32476283 CATTCTCCTGCCTCAGCCTTGGG - Intergenic
972118211 4:35665300-35665322 CATTCTCCTGACTCAGCCTCCGG - Intergenic
973194826 4:47427621-47427643 AAACCTCCTGCATCAGTGTTTGG - Intergenic
973618250 4:52702115-52702137 CATCCTCCTGCCTCAGCCTCCGG - Intergenic
974395799 4:61333700-61333722 CATCCTCCTGCCTCAGCCTCTGG + Intronic
974548573 4:63344327-63344349 CAACCTGCTGAATCAGACAAAGG + Intergenic
974609739 4:64200629-64200651 GAATCTCCTGACTCAGCCTCTGG - Intergenic
975039986 4:69734922-69734944 CATCCTCCTGCCTCAGCCTCCGG + Intronic
975847561 4:78541013-78541035 CAACATCCTGAGTGAGCCTGAGG + Intronic
977040059 4:92004528-92004550 CAACCTCCTGAATGACTCCTGGG + Intergenic
978562411 4:110047277-110047299 CAGCCTCTTGAATCAGACCTTGG + Exonic
978719483 4:111890457-111890479 AATCCTCCTGCCTCAGCCTTTGG - Intergenic
978929905 4:114297432-114297454 GAACCTCCTGCATAAGCCTCTGG + Intergenic
979118990 4:116868829-116868851 CAACCTTCTGATTGAGCCATTGG + Intergenic
979556138 4:122049649-122049671 GCACCTTCTGAATCAGTCTTGGG - Intergenic
979573721 4:122261288-122261310 CAACCTTCTGAATCATATTTAGG + Intronic
980677423 4:136105556-136105578 CAATCTCCTGCCTCAGCCTCCGG + Intergenic
980754851 4:137145202-137145224 CATCCTCCTGTCTCAGCCTTGGG + Intergenic
980936791 4:139233336-139233358 CATCCTCCTGCCTCAGCCTCCGG - Intergenic
981911617 4:149987957-149987979 CAATCTCCTGAATCTGTCTTTGG - Intergenic
982511004 4:156283334-156283356 CATTCTCCTGACTCAGCCTCCGG - Intergenic
983052175 4:163061442-163061464 CATTCTCCTGCATCAGCCTCCGG + Intergenic
983844511 4:172500313-172500335 CATCCTCCTGTCTCAGCCTTTGG - Intronic
984095149 4:175425277-175425299 CCACCTCCTGAAAGAGCCTTAGG + Intergenic
984246761 4:177284063-177284085 GATCCTCCTGACTCAGCCTCTGG + Intergenic
984340394 4:178449881-178449903 CATTCTCCTGCCTCAGCCTTTGG + Intergenic
984808358 4:183772100-183772122 CATTCTCCTGAATCAGCCTCCGG + Intergenic
984909357 4:184657885-184657907 CATTCTCCTGCCTCAGCCTTGGG - Intronic
986283540 5:6343467-6343489 AAGCCTCGTGAATCAGCATTTGG - Intergenic
987499975 5:18697427-18697449 CATTCTCCTGCCTCAGCCTTCGG + Intergenic
987577969 5:19754896-19754918 CCTGCTCCTGAATCAGCCCTGGG + Intronic
987840024 5:23211542-23211564 CATTCTCCTGCCTCAGCCTTCGG + Intergenic
989018361 5:36968461-36968483 CATTCTCCTGCCTCAGCCTTCGG - Intronic
989382794 5:40825809-40825831 GATCCTCCTGCCTCAGCCTTCGG + Exonic
989385343 5:40849872-40849894 GATCCTCCTGCCTCAGCCTTTGG - Intronic
991189011 5:63847027-63847049 CATCCTCCTGCCTCAGCCTCCGG + Intergenic
992267283 5:75031851-75031873 GAGCCTCCTGAAGCAGCCCTAGG - Intergenic
993057063 5:82993606-82993628 CAAGCTCCTGAAACAGACTCTGG + Intergenic
993144505 5:84077282-84077304 GAATCTCCTGAATGAGTCTTTGG + Intronic
993250098 5:85510873-85510895 CATCCTCCTGAATTAGCATTGGG - Intergenic
993794691 5:92251973-92251995 CCTGCTCCTGAATGAGCCTTGGG + Intergenic
994440977 5:99802205-99802227 CATCCTCCTGCCTCAGCCTCTGG + Intergenic
994759384 5:103834314-103834336 CAAACTCCTGAATCAGAGTGGGG - Intergenic
995014048 5:107290072-107290094 CAACCTTGTGCTTCAGCCTTGGG - Intergenic
996581582 5:125037516-125037538 CAGCCTCCAGCATAAGCCTTGGG + Intergenic
997996465 5:138590723-138590745 AACCCTCCTGCCTCAGCCTTCGG + Intergenic
999838390 5:155399013-155399035 CATCATCCTGACTCAGCCTCTGG + Intergenic
1000280935 5:159781464-159781486 AGGCCTCCTGAATCAGTCTTTGG - Intergenic
1000894760 5:166842321-166842343 CATTCTCCTGCCTCAGCCTTCGG - Intergenic
1004686818 6:17954193-17954215 CATTCTCCTGCCTCAGCCTTCGG - Intronic
1005716063 6:28549704-28549726 CAGCTTCCTGAAGCAGCCCTGGG - Intergenic
1005903869 6:30243394-30243416 CATTCTCCTGACTCAGCCTCCGG - Intergenic
1005986371 6:30878292-30878314 CATCCTCCTGCCTCAGCTTTTGG + Intronic
1006333583 6:33409506-33409528 CACCAGCCTGAACCAGCCTTTGG + Intronic
1007293965 6:40807074-40807096 GATCCTCCTGTCTCAGCCTTCGG - Intergenic
1008338616 6:50336892-50336914 CATTCTCCTGACTCAGCCTCCGG - Intergenic
1008623671 6:53297084-53297106 CAGCCTCCCCAATCACCCTTGGG - Intronic
1009315493 6:62213766-62213788 CATCCTCCTGCCTCAGCCTCCGG - Intronic
1009704158 6:67223333-67223355 CAACTTCCTGGTTCAGTCTTTGG - Intergenic
1010372713 6:75130282-75130304 CAACCTCCTTAATCTGACTTAGG - Intronic
1010876014 6:81106626-81106648 CATTCTCCTGACTCAGCCTCCGG + Intergenic
1011202403 6:84851565-84851587 CATTCTCCTGCCTCAGCCTTCGG - Intergenic
1011789478 6:90883049-90883071 CCAGCTCCTGAATGAGCATTGGG - Intergenic
1011987419 6:93466278-93466300 CATTCTCCTGCCTCAGCCTTCGG - Intergenic
1014500715 6:122185711-122185733 CATCCTCCTGCCTCAGCCTCCGG - Intergenic
1016418067 6:143854156-143854178 CTTCCTCCTGATTTAGCCTTGGG + Intronic
1016651477 6:146466267-146466289 CACTCTCCTGCCTCAGCCTTCGG + Intergenic
1017161459 6:151369558-151369580 AATCCTCCTGCCTCAGCCTTGGG + Intronic
1018276940 6:162142933-162142955 CAACCTAATTAATTAGCCTTTGG + Intronic
1020253285 7:6486028-6486050 CATTCTCCTGCCTCAGCCTTAGG - Intergenic
1020323099 7:6954687-6954709 TAACCTCCAGGACCAGCCTTAGG - Intergenic
1021040454 7:15855796-15855818 CAAACTCTTTAATGAGCCTTGGG + Intergenic
1021221552 7:17980240-17980262 GAACCTCCTGCCTCAGCCTCTGG - Intergenic
1021523062 7:21555734-21555756 CTGCCTCCTGAATAAGTCTTGGG + Intronic
1022324961 7:29322835-29322857 CTACCTCCTGAAGCAACTTTTGG + Intronic
1022979840 7:35594075-35594097 TAACCTCCAGAATCAGCTGTTGG - Intergenic
1026661584 7:72307653-72307675 CAACCTCCTGGCTGAGCCTCTGG + Intronic
1026738193 7:72962120-72962142 CATTCTCCTGACTCAGCCTCCGG - Intronic
1027105541 7:75402948-75402970 CATTCTCCTGACTCAGCCTCCGG + Intronic
1027367509 7:77473727-77473749 AAACCTACTCAATCAGCATTGGG + Intergenic
1028187896 7:87810444-87810466 AAATCTCCTGAATTAGGCTTTGG + Intronic
1030037032 7:105416725-105416747 CATTCTCCTGCATCAGCCTCCGG + Intergenic
1031603361 7:123740699-123740721 GAACCTCCTGCCTCAGCCTCTGG + Intronic
1031725960 7:125239253-125239275 AAACCTCATGAATCAACTTTTGG - Intergenic
1032397036 7:131597842-131597864 CATTCTCCTGCCTCAGCCTTCGG - Intergenic
1033559481 7:142517896-142517918 CACTCTCCTGCCTCAGCCTTTGG + Intergenic
1035018789 7:155788393-155788415 CATCCTCCTGCCTCAGCCTCCGG - Intergenic
1036372966 8:8176295-8176317 TAACCTCCAGGAACAGCCTTAGG + Intergenic
1036486908 8:9187853-9187875 GATCCTCCTGATTCAGCCTCTGG + Intergenic
1036519418 8:9476431-9476453 AAACGTCCTGAAGCACCCTTGGG + Intergenic
1036877939 8:12489346-12489368 TAACCTCCAGGAACAGCCTTAGG - Intergenic
1037190810 8:16122948-16122970 CATCCTCCTGCCTCAGCCTCCGG + Intronic
1037422008 8:18712562-18712584 CCACTTCCTGATTCAGTCTTGGG - Intronic
1037534976 8:19815806-19815828 CATCCTCCTGTCTCAGCCTGTGG - Intergenic
1038475603 8:27864641-27864663 CAACCTACTGGATAAACCTTGGG - Intergenic
1040736851 8:50518739-50518761 CATCCTCCTGATTTAGTCTTGGG - Intronic
1041453010 8:58027373-58027395 GAACTTCCTCAATCAGCCCTGGG - Intronic
1041775955 8:61523021-61523043 AAACTTCCAGCATCAGCCTTAGG + Intronic
1041812105 8:61922972-61922994 CATCCTCCTGACTCAGCCTCTGG - Intergenic
1043036910 8:75210184-75210206 CATTCTCCTGCCTCAGCCTTCGG - Intergenic
1043089610 8:75881658-75881680 CATCCTCCTGCCTCAGCCTCTGG + Intergenic
1044372262 8:91425760-91425782 CATTCTCCTGGCTCAGCCTTCGG - Intergenic
1044774475 8:95674116-95674138 CATTCTCCTGCATCAGCCTCCGG + Intergenic
1047034476 8:120921913-120921935 AAACCTCATGAATCAACCTCTGG + Intergenic
1047053753 8:121141585-121141607 CATTCTCCTGACTCAGCCTCTGG - Intergenic
1047434786 8:124827225-124827247 CAACCTCCAGAATAAACCATGGG - Intergenic
1049465543 8:142749747-142749769 CAGCCTCCGCCATCAGCCTTGGG + Intergenic
1051655961 9:19381794-19381816 CATCCTCCTGTCTCAGCCTCTGG + Intergenic
1053350362 9:37409981-37410003 AATCCTCCTGTATCAGCCTCTGG + Intergenic
1055031157 9:71772271-71772293 TACCCTCCTGAATCAGTCATTGG + Intronic
1058053514 9:100428170-100428192 CAACCTCCTGAATCGGAATAGGG - Intronic
1058716934 9:107730806-107730828 CAGCCTGAAGAATCAGCCTTGGG - Intergenic
1059262400 9:112990819-112990841 CAACTTCCTGGTTCAGTCTTGGG + Intergenic
1059485921 9:114626773-114626795 CAAGCTCCTCATTCTGCCTTTGG + Intronic
1059716108 9:116914960-116914982 CAACCTCCAGATGCTGCCTTAGG + Intronic
1060246749 9:121952817-121952839 CAAGCTCCGGATTCAGCCTCAGG + Intronic
1060815812 9:126634564-126634586 CCACCTCCTGCATTAGCCTCTGG + Intronic
1060897641 9:127227812-127227834 GATCCTCCTGACTCAGCCTCTGG - Intronic
1060949284 9:127590917-127590939 TAACCTCCTGCCTCAGCCTCCGG + Intergenic
1061102516 9:128503118-128503140 GATCCTCCTGCATCAGCCTGTGG + Intergenic
1061535885 9:131249910-131249932 CATCCTCCTGCCTCAGCCTCTGG - Intergenic
1061536172 9:131251714-131251736 AATCCTCCTGACTCAGCCTCCGG + Intergenic
1061551588 9:131337839-131337861 GATCCTCCTGCCTCAGCCTTCGG - Intergenic
1061577113 9:131514120-131514142 CAACCTTCAGAACCAGCCCTGGG + Intronic
1186175393 X:6921046-6921068 CCACCTCCTGAATAAGTCCTTGG + Intergenic
1186343357 X:8666088-8666110 GATCCTCCTGCCTCAGCCTTGGG - Intronic
1186787493 X:12967238-12967260 CATCCTCCTGCCTCAGCCTCCGG - Intergenic
1187427495 X:19191613-19191635 CATCCTCCTGTCTTAGCCTTCGG + Intergenic
1187470323 X:19563798-19563820 CAACCTTCAGACACAGCCTTTGG - Intronic
1187503377 X:19858520-19858542 CATCCTCCTGCCTCAGCCTTTGG - Intronic
1190176520 X:48155272-48155294 CATCCTCCTGCCTCAGCCTCGGG - Intergenic
1190312193 X:49124445-49124467 CATCCTCCTGCCTCAGCCTGCGG - Intergenic
1190506515 X:51132105-51132127 CAAACTCCTGAATGATCTTTGGG - Intergenic
1190661253 X:52656029-52656051 GATCCTCCTGCTTCAGCCTTGGG + Intronic
1192396690 X:70789092-70789114 AATCCTCCTGCATCAGCCTCTGG - Intronic
1193162576 X:78243955-78243977 CATGCTCCTGAATAACCCTTGGG + Intergenic
1193311770 X:80018477-80018499 CAACCTTTTGAATCTGCTTTAGG + Intronic
1193785783 X:85758153-85758175 CCAGCTCCTGAATGAGCATTGGG - Intergenic
1194253472 X:91606593-91606615 CATCCTCCTGAATCACCAGTGGG + Intergenic
1198537423 X:137600481-137600503 CATCCTCCTGCCTCAGCCTCCGG + Intergenic
1199718506 X:150525067-150525089 CAACCTCTGGTAACAGCCTTGGG - Intergenic
1199836952 X:151600472-151600494 CACCATACTGAATCAACCTTGGG - Intronic
1200379869 X:155824299-155824321 CATTCTCCTGCCTCAGCCTTCGG - Intergenic
1200572250 Y:4846178-4846200 CATCCTCCTGAATCACCAGTGGG + Intergenic