ID: 918552651

View in Genome Browser
Species Human (GRCh38)
Location 1:185761197-185761219
Sequence ACTCAAAGGCAAAAAGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 637
Summary {0: 1, 1: 0, 2: 4, 3: 61, 4: 571}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918552651 Original CRISPR ACTCAAAGGCAAAAAGGAGA TGG Intronic
900235992 1:1590938-1590960 AAGCAAAGACAGAAAGGAGATGG + Intergenic
901584839 1:10280743-10280765 GCACAAAAGCAAAAAGAAGAAGG - Intronic
901623379 1:10607223-10607245 ACCCAATGGTAAAAAGGAAAAGG - Intronic
901744918 1:11366008-11366030 ATTCAAAGTCCAAAGGGAGAAGG - Intergenic
902399651 1:16150963-16150985 ACTGAAAGGGAGAAGGGAGAGGG + Exonic
902820013 1:18938005-18938027 GCAAAAAGCCAAAAAGGAGATGG + Intronic
902860237 1:19239985-19240007 ACTGGAAGGCAAGAAGGAGGAGG + Exonic
902864616 1:19269905-19269927 ATTCAAAAGCTAAAAGGACAAGG + Intergenic
903404319 1:23083691-23083713 ACTCAAAGGAACAAAAGAGAGGG - Intergenic
904854509 1:33487546-33487568 ACTCAAAAGGAAAAAGGAAGTGG - Intronic
906088201 1:43154514-43154536 ACTCAAAGAGAAAGAGGAGGTGG + Intronic
906527943 1:46507223-46507245 TCTGGAAGGCAAAGAGGAGAGGG + Intronic
906974859 1:50559373-50559395 ACTGAAAGGAAAAAAGGAAAGGG - Intronic
907049373 1:51319319-51319341 AAGCAATGGGAAAAAGGAGAGGG + Intronic
907652085 1:56304775-56304797 ACTGAAAGCCAAGAAGGAGTTGG + Intergenic
907854692 1:58290973-58290995 ACAGAAGGGCATAAAGGAGAGGG + Intronic
908175341 1:61550278-61550300 AGTAAAAGTCAAAAAGCAGAGGG - Intergenic
908595962 1:65689198-65689220 AGTCAAAGGAGAAAAGGAGGAGG + Intergenic
909710028 1:78638580-78638602 GCTCAAAAGCAGAATGGAGAGGG - Intronic
909818913 1:80033673-80033695 AAACAAAGGCAAAAAAGAAAGGG + Intergenic
909946584 1:81670622-81670644 AATCAGAGGCAGTAAGGAGAGGG + Intronic
911046118 1:93630107-93630129 ACTCAAAGGATAAATGGTGATGG + Intronic
911642617 1:100305004-100305026 AATCAAAGGCAAAAAGGATTTGG - Intergenic
912048493 1:105491400-105491422 TTTCAAAGGCAAGAGGGAGATGG - Intergenic
912218394 1:107643226-107643248 ATTCAAAAGCAAAAAGGTGATGG + Intronic
912677685 1:111700365-111700387 AGTGAAAGGCAAAGAGGAGTAGG + Intronic
912937742 1:114018762-114018784 ACTCCAAACCAGAAAGGAGAAGG - Intergenic
913389248 1:118292028-118292050 ACTCACAGGGAAGAAGCAGAAGG - Intergenic
913443494 1:118924958-118924980 ACTCAAAGGAGGAAAAGAGAAGG + Intronic
913614039 1:120538513-120538535 CCTCAAATGTAAAAAGGAAATGG + Intergenic
914576229 1:148972380-148972402 CCTCAAATGTAAAAAGGAAATGG - Intronic
915279795 1:154814574-154814596 CCTAAAAGGCAAAAAGGTGAAGG + Intronic
915360154 1:155281367-155281389 CCTCAAAGAAAAAAAGAAGAAGG - Intronic
915789731 1:158655174-158655196 ACTTAAAGGCCAGAAGGAGTGGG - Intronic
915939105 1:160107297-160107319 ACTCAGAGAGATAAAGGAGAAGG - Intergenic
917141107 1:171836896-171836918 ACCTAAAGGGAAAAAGCAGAGGG - Intergenic
917440863 1:175067652-175067674 AATCAAAGTGAAAAAGAAGAAGG + Intergenic
917540656 1:175910572-175910594 ACTCAAGGGCATAAGGCAGAAGG + Intergenic
917923163 1:179767522-179767544 ATTCCAGGGAAAAAAGGAGAAGG - Intronic
918065181 1:181095759-181095781 ATTCATAGGGAAAAAGCAGAGGG - Intergenic
918268827 1:182874900-182874922 ACCAAAAGACAAAAAGAAGAAGG + Exonic
918552651 1:185761197-185761219 ACTCAAAGGCAAAAAGGAGATGG + Intronic
919487658 1:198163917-198163939 ACTCAAAGCCATAAAAGTGAAGG - Intronic
919563942 1:199160455-199160477 TCTAAAATGCAAAAAGGAGGTGG + Intergenic
919651925 1:200158580-200158602 ACTCAAAGGCTAAAACAGGAAGG + Intronic
920237928 1:204521539-204521561 ACAAAAAGGCTACAAGGAGAGGG - Intronic
920288909 1:204902731-204902753 AAACAAAGGAAAAAAGAAGAGGG + Intronic
920434391 1:205938734-205938756 CTTCATAGGCAAGAAGGAGAAGG - Intronic
921066918 1:211630072-211630094 ACTCAATGGAAAGAAGAAGATGG + Intergenic
921166637 1:212512870-212512892 ACTCAAAGGCAGAGAGAAGAGGG + Intergenic
921909653 1:220533453-220533475 ACCCAAAGGAAACAATGAGATGG - Intronic
922084617 1:222334133-222334155 ACTCAAAGGCATAGAGCAAATGG + Intergenic
923089442 1:230728475-230728497 GTTAAAAGGCAAGAAGGAGATGG + Intergenic
923721275 1:236469024-236469046 ACTAAAAGCAGAAAAGGAGAGGG - Intronic
924297596 1:242604137-242604159 ACCCAAAGGGAGAAAGGAAAGGG - Intergenic
924594059 1:245429967-245429989 ACTGAAGGGAAAAAAGAAGATGG + Intronic
924766889 1:247041290-247041312 ATTAAAAGGCAAAAAGCAGTGGG + Intronic
1063321476 10:5056259-5056281 CCTCAAAGGCAAAGAGGAACTGG + Intronic
1063956826 10:11275022-11275044 ACACAAGGGCAAAGTGGAGACGG - Intronic
1064163156 10:12963251-12963273 TCTCAGAAGCAAAGAGGAGATGG - Intronic
1064681804 10:17817435-17817457 ACTCAAAGGCAAAAAGATCAAGG - Intronic
1065082652 10:22142771-22142793 CCTCAAAGGCAAAGAGGAACTGG - Intergenic
1065446705 10:25809726-25809748 ACTCACAGGTTAAAAGCAGAAGG + Intergenic
1065821688 10:29531610-29531632 ACTCAAATACAACAAGTAGATGG + Intronic
1065842280 10:29712479-29712501 ACTGAAAGGCAGAGAGGAGCTGG - Intronic
1065920671 10:30389818-30389840 ACTCAAAGGCAAGAAAGGAAAGG + Intergenic
1066522182 10:36233275-36233297 ACTCAAAGGTGAAAAGTTGAAGG + Intergenic
1066593614 10:37023711-37023733 ACACAAAGACAAAAAGAATATGG - Intergenic
1067004628 10:42649151-42649173 ACTCAAAGGCAAAAATGTCTTGG - Intergenic
1068289503 10:54984344-54984366 TCTCCAAGGGAAAAAGGAGAAGG - Intronic
1068534407 10:58225106-58225128 ACTGAAGGGAAAAAAGGACAAGG - Intronic
1068680697 10:59816956-59816978 GTTCAAGGGCAAAAAGGAGGAGG + Intronic
1068929569 10:62575537-62575559 ACTAAAAGCCTAAAAGGGGATGG - Intronic
1069107138 10:64397100-64397122 ACTCAGGGGCATAAGGGAGAAGG + Intergenic
1069297986 10:66871138-66871160 ACTCATTGGCAGAAAGCAGAGGG + Intronic
1070080101 10:73177410-73177432 ACTAAAATGCAAAAATGAGCTGG + Intronic
1070589916 10:77794381-77794403 ACAGAAAGGCAAAATGGAGCAGG + Intronic
1071153944 10:82668130-82668152 AATAAAAGTTAAAAAGGAGAGGG - Intronic
1071235776 10:83646603-83646625 TCTAAAAAACAAAAAGGAGAGGG + Intergenic
1071309169 10:84327473-84327495 ACTCAAATGGAAAAAGCAGACGG - Intergenic
1071928540 10:90439154-90439176 ACACAAAGCCAGAAAGAAGAAGG - Intergenic
1071998703 10:91172625-91172647 CCTCAATGGCAAAAAGGTGTTGG + Intronic
1072392028 10:94997226-94997248 ACTCAAAGGCAAATAGGTCCTGG + Intergenic
1072692335 10:97580326-97580348 AGTCCAAGGCAGAAAGGAGAAGG + Intronic
1073917606 10:108424846-108424868 ACTCAAAGGCAGATAAGAGCAGG - Intergenic
1074392183 10:113067642-113067664 ATTCTAAGGCATAAAGGGGAAGG + Intronic
1074790547 10:116882214-116882236 ACTAAAATTTAAAAAGGAGAGGG - Exonic
1075526030 10:123187484-123187506 AAGCAAAGGGAAAAAGGGGAGGG + Intergenic
1075629715 10:123993809-123993831 ACTCAAAGGCAAAGTGGACAGGG + Intergenic
1077562207 11:3271108-3271130 ACCCACAGGCAGGAAGGAGAGGG - Intergenic
1077568101 11:3316928-3316950 ACCCACAGGCAGGAAGGAGAGGG - Intergenic
1077895488 11:6450454-6450476 TCTCAAAGGGGAAAAGGAGGAGG + Intronic
1078160433 11:8835475-8835497 TCCCACAGGCAAAAAGGAAAGGG + Intronic
1078298404 11:10100125-10100147 ACACATAGGCTAAAAGGGGATGG + Intronic
1078445487 11:11401662-11401684 ATTCAAAGTCATAAATGAGAAGG + Intronic
1079730982 11:23937610-23937632 CCTCAAAGGCAAAGAGGAACTGG + Intergenic
1079985346 11:27194236-27194258 ACTCAAAGGAAAGAAGGAAGGGG - Intergenic
1080836215 11:35943748-35943770 AAGCAAAGGCAGAAATGAGAGGG + Intergenic
1081421666 11:42878938-42878960 CCTCAAAGGCAAAGAGGAACTGG - Intergenic
1081743995 11:45460282-45460304 CCTCCAAGGCAAAATGGAGTAGG + Intergenic
1082038765 11:47667468-47667490 ACTCTAAACCAAAAAGGGGATGG - Intronic
1082254775 11:50021722-50021744 ACGTAAAGGGAAAAAGAAGATGG - Intergenic
1082651138 11:55795446-55795468 ATTAAAAGGAAAAAAGGAGAAGG - Intergenic
1083118546 11:60489364-60489386 TCTGAAAGGCCAACAGGAGAAGG + Intergenic
1083356129 11:62067588-62067610 ACACAGAGACACAAAGGAGAAGG - Intergenic
1083840692 11:65302466-65302488 GCACAAGGGGAAAAAGGAGAAGG + Intronic
1084007801 11:66332444-66332466 AGTCAGAGGCAAGAAGCAGAGGG - Exonic
1084772510 11:71352916-71352938 ACTCAAAGGATCAAAGGTGAAGG + Intergenic
1085430500 11:76444303-76444325 TGTCAAGGGCAAGAAGGAGAAGG - Intergenic
1085445221 11:76596948-76596970 ACTCATCAGTAAAAAGGAGATGG - Intergenic
1085482260 11:76832539-76832561 ACACAAATGCAGAAAGCAGAAGG - Intergenic
1085566462 11:77518959-77518981 ACTCAAATAGAAAAAGGAGAGGG - Intronic
1085907079 11:80776349-80776371 ACAGAAAGGCAAAAAGCAAAGGG - Intergenic
1086166003 11:83778877-83778899 AAACAAAGGCAACTAGGAGAAGG + Intronic
1086244061 11:84729978-84730000 TCTCAAAGGCAAAATTGTGAGGG - Intronic
1086932506 11:92707690-92707712 ACACAAAGGAAAGAAGGAAAAGG - Intronic
1087608219 11:100403275-100403297 AGTAAAAGGCATACAGGAGAAGG - Intergenic
1087772127 11:102222284-102222306 AATCAAACCCAAAAAGTAGAGGG + Intronic
1088233029 11:107692542-107692564 GCTCAATAGCAGAAAGGAGATGG + Intergenic
1088539648 11:110900571-110900593 ACAAAAAGGCAAAAATCAGAAGG + Intergenic
1091151096 11:133328607-133328629 ACACAAAGGCAAATAAGAAACGG + Intronic
1091195597 11:133728190-133728212 AATCACAGGCAACAAGGAGCAGG + Intergenic
1091459947 12:636545-636567 ACTCAATTCAAAAAAGGAGAAGG + Intronic
1091885967 12:4017302-4017324 ACTCAAGGGGAAAAGGGGGAAGG - Intergenic
1092862039 12:12726590-12726612 ACTAAAAGACAAAAAGAAAAAGG - Intronic
1092957864 12:13566122-13566144 ACTCACAGCCAGAAAGGACACGG + Intronic
1093012042 12:14117635-14117657 ACTCAAAAGCAAAATGGAACAGG + Intergenic
1093233210 12:16574374-16574396 ACTCAAAGTTCAAAAGCAGAAGG - Intronic
1093345483 12:18035249-18035271 CCTCAAAGGCAAAGAGGAACTGG - Intergenic
1095136933 12:38615936-38615958 ATAGAAAGGAAAAAAGGAGAGGG + Intergenic
1095694676 12:45131164-45131186 AAGCAAAGGCAAAATGGACAGGG + Intergenic
1096401660 12:51312386-51312408 TTTCAAAGGAAAAAATGAGAAGG - Intronic
1097403547 12:59160256-59160278 TGTCAAAGGCCAAAAGGATATGG - Intergenic
1098387329 12:69933340-69933362 ACTCAAAGGCCCAGAGAAGACGG - Intronic
1098508594 12:71284429-71284451 AATCAGAGGAAAAGAGGAGAGGG + Intronic
1099599447 12:84714153-84714175 ACTCATGGGCAAAGAGTAGAAGG + Intergenic
1099831367 12:87847327-87847349 TCGCAAAGGCAAAAAGGAGCGGG + Intergenic
1101761624 12:107663424-107663446 ACCCCAAACCAAAAAGGAGATGG - Intergenic
1104072766 12:125360760-125360782 AATTAAAGGAAAATAGGAGACGG + Intronic
1104544390 12:129698506-129698528 ACATAAAGGAAAAAAGGGGAGGG + Intronic
1105306227 13:19170817-19170839 ACTTACAGGCAGGAAGGAGATGG + Intergenic
1105631731 13:22176106-22176128 ACAGAAAGACAAAAAGGAAAGGG - Intergenic
1106343065 13:28849810-28849832 ACTCAGAGGTAGAGAGGAGAGGG - Intronic
1106683735 13:32034710-32034732 ACTCAGAGGCAAAAGGGAGCTGG - Intronic
1106999186 13:35523866-35523888 AATCAAAGGAAAAAAGCAGAGGG - Intronic
1107375030 13:39795126-39795148 AGTCAAAGGGAAAAAAGAGGTGG - Intergenic
1107603402 13:42036221-42036243 ACTCAAAAGCATAAGGGAAATGG + Intergenic
1108088814 13:46823962-46823984 ACACCAAGGCAGAAACGAGATGG + Intergenic
1108110949 13:47072105-47072127 AGTTAAAGACAAAAAGGACATGG + Intergenic
1108136640 13:47370258-47370280 ACTGAAAGGAAAAATGGGGAGGG + Intergenic
1108320084 13:49281314-49281336 TCTCTAAGCCAGAAAGGAGAGGG - Intronic
1108889851 13:55243810-55243832 ACACAAAGGCAAAAACCACATGG + Intergenic
1109167311 13:59052118-59052140 AATCAAAAACAAAAGGGAGAGGG - Intergenic
1109216000 13:59590656-59590678 ACTCAAAGAAAAAAAAGAGAAGG + Intergenic
1111992690 13:95132870-95132892 ACTCAGAGACAGAAAGTAGAAGG + Intronic
1112085216 13:96024325-96024347 ACTCAAAGACATAAAGGAGAAGG + Intronic
1112086769 13:96040374-96040396 AGACACAGGCAAAAAGGAGAAGG - Intronic
1112337648 13:98527956-98527978 ACTCAACGGCAGAAAGCAAAAGG + Intronic
1112409680 13:99152149-99152171 ACTCAAGGGCCCCAAGGAGAGGG + Intergenic
1112448774 13:99490783-99490805 ATTCAAAGGCAAAAAGGTATTGG + Intergenic
1112519369 13:100082241-100082263 CCTCAAAGGCAAAGAGGAACTGG - Intergenic
1112538621 13:100284760-100284782 CCTCAAAGGCAAAGAGGAACTGG - Intronic
1113203692 13:107893345-107893367 CCTCAAAGGCAAAGAGAAGCTGG + Intergenic
1113277395 13:108746328-108746350 ACTGAAATGCAAAAAGAACAAGG + Intronic
1114386022 14:22255809-22255831 TCTCATAGCCAAAAGGGAGAGGG + Intergenic
1114457452 14:22865440-22865462 GCTAAAAGTCCAAAAGGAGATGG + Intergenic
1114689832 14:24571039-24571061 CAGCTAAGGCAAAAAGGAGAAGG - Intergenic
1114924584 14:27379339-27379361 ACTCAATAGCAAAAAGAAAATGG + Intergenic
1115116064 14:29881539-29881561 AATAAAAAGCAAAATGGAGAAGG - Intronic
1115160554 14:30389154-30389176 GCTTAAAGGTAAAAGGGAGATGG + Intergenic
1115285219 14:31707974-31707996 CCTCAAAGGCAAAAAGAAACTGG + Intronic
1115490368 14:33952492-33952514 CCTCAGAGGCAGAGAGGAGAGGG - Intronic
1115699033 14:35930886-35930908 ACTCAAGGGTAAAAACCAGAGGG - Intronic
1116188150 14:41626033-41626055 ATACATAGGCAAAAAGTAGATGG + Intronic
1116817133 14:49594620-49594642 CCAGAAAGGCAAAAAGGAAAGGG + Intronic
1117287044 14:54295947-54295969 TCTGAAAGACAAGAAGGAGACGG - Intergenic
1117569972 14:57037968-57037990 ACTCATAGAAAAAAAGCAGAAGG + Intergenic
1117662022 14:58016874-58016896 ACTCAATGGTAAAAAGCTGAGGG + Intronic
1117733306 14:58745598-58745620 ACTCAAAGGAGAAAAGGGCAGGG - Intergenic
1119416436 14:74473221-74473243 ACTGAAAGGCAAAAATTAGCAGG + Intergenic
1119568755 14:75651223-75651245 AATAAAAGGGAAAAAGGGGAAGG + Exonic
1119818273 14:77590778-77590800 AAACAAAAGCAAAAAGGAAAGGG + Intronic
1120982273 14:90300840-90300862 AAACAAAGGCAGAAAGGGGATGG + Intronic
1121878400 14:97476533-97476555 ACTAAAAAGCAGAAAGAAGAAGG - Intergenic
1122053715 14:99078089-99078111 ACTGAAAGGCAGAGAGGTGAAGG - Intergenic
1122055795 14:99097467-99097489 ACTCAAAGGGTAAAAAGAGGTGG - Intergenic
1122057949 14:99117861-99117883 CCTCAAAGGCAGCAAGGGGACGG - Intergenic
1122225549 14:100275715-100275737 GCTCACAGGCAGAAGGGAGAGGG - Intronic
1122254884 14:100469252-100469274 ACGCAGAGGGAAAATGGAGAAGG + Intronic
1123068122 14:105628279-105628301 AGCCACAGGCAAACAGGAGAGGG - Intergenic
1124017034 15:25886275-25886297 AATCAAAGGCAACAAAGACAGGG + Intergenic
1125504984 15:40262543-40262565 AGGCAAAGGCCAAAAGGAGGAGG + Intronic
1126322556 15:47440992-47441014 TTTCAAAGGCAAAAGGAAGAAGG - Intronic
1127117881 15:55744893-55744915 ACTAAAAGGGAACAGGGAGAAGG - Intergenic
1127816794 15:62617750-62617772 AATCAAATGCATAGAGGAGAAGG + Intronic
1127985831 15:64069674-64069696 TCTCAAAAGCAAAAACAAGAAGG + Intronic
1128003828 15:64219458-64219480 TCTCAAAAGAAAAAAGGAGAGGG - Intronic
1128089661 15:64911055-64911077 CCTTTAAGGCAAAAAGGACATGG + Intronic
1128796402 15:70469790-70469812 GTGCAAAGGCACAAAGGAGAGGG + Intergenic
1129257989 15:74345044-74345066 ACTCAAAGGCAAAGCGGAACAGG + Exonic
1129404982 15:75310800-75310822 ACTCAAAGGCAAGAAAGGAAAGG - Intergenic
1129609197 15:77039413-77039435 ACTCAAAGACAGCAAGGAGCAGG + Intergenic
1130510488 15:84584995-84585017 ACTCAAAGGCAAGAAAGGAAAGG + Intergenic
1130584478 15:85170256-85170278 ACTCAAAGGCAAGAAAGGAAAGG - Intergenic
1130768783 15:86903167-86903189 ACTCAACAGCAGAAAGGAGAAGG - Intronic
1131557635 15:93413538-93413560 ACTTAAAGACAGAAAGGAAAGGG - Intergenic
1133803102 16:9100447-9100469 ACTCAAGGGCCAAAAGGAAGGGG - Intronic
1133960563 16:10489270-10489292 ACTCAAAGGCAAATAGGTCCCGG - Intergenic
1134054495 16:11161081-11161103 ACAAAAAAGCAAAAAGAAGAGGG - Intronic
1134796673 16:17044994-17045016 ACTCAGAAGCAAAGAGTAGAAGG - Intergenic
1134866104 16:17608586-17608608 ATTCAAAGACAAGAAGGAGAAGG + Intergenic
1135664993 16:24328254-24328276 ACTCAAATGCAGGATGGAGAGGG + Intronic
1135788936 16:25375758-25375780 ACTGAAGGGCATAAAGCAGAAGG + Intergenic
1136005551 16:27326656-27326678 TCTCTAAAGCAAAAAAGAGAAGG + Intronic
1136279508 16:29199705-29199727 ACTCAGAGGCAGAAAGGAGGCGG - Intergenic
1137608175 16:49800855-49800877 GCTCAAAGGCAAAACAGGGAAGG + Intronic
1138165822 16:54800839-54800861 ACTGAAAGGCAAAACAGGGAAGG + Intergenic
1138493133 16:57388518-57388540 ACTCAATGGCAAAGATCAGAGGG - Intergenic
1138562207 16:57808141-57808163 ACTCCAAGGCTAAAAGCAAACGG + Intronic
1138762220 16:59558673-59558695 ACTGAAAGTCAACAAAGAGAAGG - Intergenic
1139115319 16:63944166-63944188 TCGAAAAGGCAAAAAGAAGAAGG - Intergenic
1139211095 16:65077503-65077525 ACTCAAATGCAAAAATGCAATGG + Intronic
1139662531 16:68430832-68430854 ACTCAAAGGCCACATGGAGATGG - Intronic
1140282970 16:73572496-73572518 ACAGAAAGGCAGGAAGGAGAAGG + Intergenic
1140435999 16:74947483-74947505 ACACAAACCCAAAAAGGAGAAGG + Intronic
1141961419 16:87411826-87411848 ACTGAAGGGCAAGAAGGGGAAGG + Exonic
1143801075 17:9381463-9381485 TCTGAAAGGCACAAAGGAGTTGG + Intronic
1144501620 17:15792233-15792255 AATCAATGGCAAAGAAGAGAAGG - Intergenic
1144723474 17:17488425-17488447 ACTCAAAGGCAAACATCACAGGG - Intronic
1145073736 17:19833770-19833792 ACTCAAAGGAAAAAACAATATGG + Intronic
1145243139 17:21251322-21251344 ACTCAGAGACAGAAAGAAGAGGG - Intronic
1146445500 17:32929514-32929536 ACACAAAGGCCAAAAGGAGGTGG + Intronic
1147298882 17:39507700-39507722 ACTGAAAGTCAAAATGGAAATGG - Intronic
1147416422 17:40293735-40293757 ACTTAAAGGGAAAGAAGAGAAGG + Intronic
1148659786 17:49320246-49320268 ACTCACAAGGAAAAAGGAAATGG - Intronic
1149167390 17:53768849-53768871 ACTCAAATGCAAACAAAAGATGG - Intergenic
1149189186 17:54038118-54038140 ATTCACAGGCAAAAAGTAAAGGG - Intergenic
1149359608 17:55880380-55880402 ACTCATAGACAAAGAGTAGAAGG + Intergenic
1149579505 17:57739392-57739414 ACTAGAAGGAAACAAGGAGATGG - Intergenic
1150188391 17:63211363-63211385 AATCCAAGGCAAAAAGAAGTGGG - Intronic
1150579451 17:66458864-66458886 AAGCAAAGGCAAAAGGGGGAAGG + Intronic
1150681831 17:67290844-67290866 ACTCAAAGGCAAAGAGGCAGGGG - Intergenic
1151271102 17:72996598-72996620 AAGCAAAGACACAAAGGAGATGG - Intronic
1151891672 17:76954585-76954607 AATGAAAGAGAAAAAGGAGAGGG + Intergenic
1152498064 17:80688555-80688577 GCTCAAAGGGAGAAAGAAGAAGG + Intronic
1152636389 17:81432270-81432292 ACACACAGGCACACAGGAGACGG - Intronic
1153102942 18:1495101-1495123 ACCCACAGGCTCAAAGGAGAGGG - Intergenic
1154285371 18:13051057-13051079 ATTCAAAGGCAAAAAGAATCAGG - Intronic
1155481727 18:26296263-26296285 AATAAAAGGCAAAAAGGAGAGGG - Intronic
1155712901 18:28904852-28904874 ACTCTAAGGCAAAGAGCAGAAGG + Intergenic
1156233821 18:35182060-35182082 AATGAATGGTAAAAAGGAGAAGG + Intergenic
1156770020 18:40708835-40708857 ATTCTAAAGGAAAAAGGAGAGGG + Intergenic
1156931149 18:42645154-42645176 ACTCAAAGGCAGATAGGAGAGGG - Intergenic
1156948226 18:42861441-42861463 ACTAAAAGGCAAGAAAGAAAAGG - Intronic
1157130364 18:45001718-45001740 CCTGCAAAGCAAAAAGGAGAAGG - Intronic
1157365544 18:47061050-47061072 CCTCAAAGGCACAATGTAGATGG + Intronic
1157754566 18:50206351-50206373 GCTCAAAGTAAGAAAGGAGAAGG - Intergenic
1157817831 18:50743047-50743069 ATTTAAAAGCAAAAAGCAGAGGG - Intergenic
1158789159 18:60754762-60754784 ACTCAAAGGCAGACAGAAGAGGG - Intergenic
1158931761 18:62329984-62330006 ACTCAAAGGCTGAAAGTCGACGG - Intronic
1159469164 18:68827002-68827024 CCACAAAGGCTACAAGGAGATGG + Intronic
1159735179 18:72087470-72087492 ACTGTAAGTCAAAAAGGAGATGG + Intergenic
1160286989 18:77552163-77552185 ATTAAAAGGCAAATAAGAGATGG - Intergenic
1160365144 18:78318186-78318208 AATCAAGGACAAACAGGAGAGGG - Intergenic
1160580241 18:79879591-79879613 ACTCAAAGACAAAGATGAAAAGG + Intronic
1160591198 18:79945562-79945584 ACTAAGAGGCAAACAGAAGAAGG + Intronic
1161338158 19:3725758-3725780 CCTGAAAAGCAAAAAGCAGAAGG - Intronic
1161914144 19:7216320-7216342 TCTCAAAGACAAAAAGAAGATGG + Intronic
1162234925 19:9301299-9301321 ACACACAGGCAAGAAGGAGAAGG + Intronic
1162922237 19:13909945-13909967 GCTCAAAGGCAAAGGTGAGATGG + Exonic
1163166943 19:15505141-15505163 AGTCAAAGATAAAAAGAAGAGGG - Intergenic
1164176619 19:22781112-22781134 AACCAAGGGCAAAAAAGAGATGG - Intronic
1164243988 19:23415131-23415153 CCTGAAAGGCAAAAAGGGAAGGG - Intergenic
1164406382 19:27950602-27950624 ACTCAAAAGCAAAAAATAAATGG - Intergenic
1164849650 19:31471073-31471095 GGTCAAAGTCACAAAGGAGAGGG - Intergenic
1164874681 19:31675604-31675626 GCTCAAAGGCAAATAGGATGGGG + Intergenic
925663068 2:6223176-6223198 ACTGAAAGGGGAAAAAGAGAAGG - Intergenic
925926412 2:8674111-8674133 ACTCAAAAGCACAGTGGAGAGGG + Intergenic
926519062 2:13886570-13886592 AATGGAAGCCAAAAAGGAGATGG + Intergenic
927183914 2:20468472-20468494 CCTCAAAGGCAGAACTGAGAAGG + Intergenic
928079068 2:28292672-28292694 GCTCTAAGGCAAGAATGAGATGG + Intronic
928580884 2:32706563-32706585 TCTCAAAAACAAAAAGGCGAGGG - Intronic
928617387 2:33054025-33054047 CCTCAAAGGCAAAGAGGAACTGG + Intronic
928910330 2:36414632-36414654 ACTGAAAGGTAAGAAGGAGCTGG + Intronic
929652518 2:43695402-43695424 AGTGGAAGGCAAAAAAGAGATGG + Intronic
930038765 2:47104553-47104575 CCTCAAAGGCAAAGAGGAACTGG - Intronic
930220009 2:48736558-48736580 ACTCAAAAGAAAAAAGAAGAGGG - Intronic
930365825 2:50438171-50438193 ACTGGAAGTCAGAAAGGAGAAGG - Intronic
930670059 2:54139299-54139321 ACTTAACTGTAAAAAGGAGATGG - Intronic
931020420 2:58038446-58038468 ACTGTAAGGCAGAAAGGAGGAGG - Intronic
931175141 2:59846813-59846835 ATTCAAAGGACAAAAGGAAATGG - Intergenic
931303910 2:61008876-61008898 AATCTAAGTCAAAATGGAGAGGG - Exonic
931487055 2:62704875-62704897 GGTCAAAGGCAAAAAGGAGGAGG - Intronic
931771572 2:65502306-65502328 ATCCCAAGGCAAAAAGGAAAGGG - Intergenic
932194343 2:69770151-69770173 ATTCAAAGGCAAGATGTAGAAGG - Intronic
932213461 2:69950306-69950328 GGACAAAGGCAAAAAGGACACGG - Intergenic
934881385 2:97983503-97983525 ATTTAAAAACAAAAAGGAGATGG + Intronic
936093213 2:109514031-109514053 ACTCAAAGCTAGAACGGAGAAGG + Intergenic
936507193 2:113117115-113117137 TCCCAACGGCAAAAAGGAGGAGG + Intronic
936526174 2:113242983-113243005 ACTCAAGGCCAAAACAGAGATGG + Intronic
936845556 2:116826795-116826817 ATTCAGAGTCAAATAGGAGATGG - Intergenic
937340529 2:121087983-121088005 AATCAAAGGAAAAAAGAATATGG - Intergenic
937411602 2:121681751-121681773 ACTCAAAGGCAAATAGGTCCTGG + Intergenic
937508774 2:122569761-122569783 ACTCAAGGAGAAAAAGGAGAAGG - Intergenic
937509028 2:122572215-122572237 AATCAAGGAGAAAAAGGAGAAGG - Intergenic
938036681 2:128040505-128040527 ACTCAAAGGCAAATAGGTCTCGG - Intergenic
938732582 2:134158224-134158246 ACTCCCAGGCAAAAAGGGGCAGG - Intronic
939472986 2:142648479-142648501 ATTTAAAGATAAAAAGGAGAAGG - Intergenic
939725109 2:145709647-145709669 ACACAAAGGCTAAAAGGAAAAGG - Intergenic
939852086 2:147315337-147315359 CCTCAAAGGCAAAAAGAAACTGG - Intergenic
940037199 2:149323420-149323442 ACTCAAATACAAAAAGCAAAAGG + Intergenic
940204653 2:151189575-151189597 ACTGAAAGGGAAAAAGGCAATGG + Intergenic
941284253 2:163589272-163589294 ACTATAATACAAAAAGGAGAAGG - Intergenic
941635315 2:167929649-167929671 ACTCAAAGGCAAGGAGCAGGTGG + Intergenic
942078808 2:172381525-172381547 ACTCACAGGCAAGATGCAGATGG - Intergenic
942622137 2:177856540-177856562 ACTGAAAGGAAAATATGAGAAGG + Intronic
942915211 2:181296709-181296731 ACAGAAAGTTAAAAAGGAGAAGG + Intergenic
942986209 2:182145429-182145451 ACACAAATGCAAAAAGGGGCCGG + Intronic
943179463 2:184524714-184524736 GCTCCCAGGCAAAAAGGAGTAGG - Intergenic
943980659 2:194545595-194545617 ACTCAATAGCAAAAAAGAAAAGG + Intergenic
945523512 2:210859561-210859583 TCTCAAAAGAGAAAAGGAGAGGG + Intergenic
945817636 2:214625347-214625369 AATCAAAAGCCAGAAGGAGATGG - Intergenic
947269637 2:228319516-228319538 ACAAAAATGCAAAAAGGAAAAGG + Intergenic
1168751931 20:288679-288701 ACTGAAACACAGAAAGGAGATGG - Intronic
1169488302 20:6051901-6051923 CCTCATATGTAAAAAGGAGATGG + Intronic
1169666113 20:8038006-8038028 ACTCAAAGGAAAAGAGAAAAAGG + Intergenic
1169760657 20:9089385-9089407 ACTTAAAAGCACAAAGAAGAAGG + Intronic
1170183483 20:13560395-13560417 ACTAAATGGCATCAAGGAGAGGG + Intronic
1170402059 20:15997785-15997807 ACTCAATGGTAAAAAGCTGAAGG - Intronic
1170476766 20:16722772-16722794 ACTTAAAGGTAAGAAGGAGCTGG - Intergenic
1171301991 20:24070898-24070920 TTTCAAAGGCAAATTGGAGATGG - Intergenic
1172559248 20:35871411-35871433 ACACAAAGGCACGAATGAGATGG - Intronic
1173393984 20:42661011-42661033 ACTAAAATGCAAAAATTAGACGG - Intronic
1174141179 20:48415004-48415026 ACTCAAGGGCAGGAAAGAGAAGG + Intergenic
1174288737 20:49491519-49491541 ATTCAAAGGCAGGAAGGAGGAGG + Intergenic
1175564297 20:59960675-59960697 TTTCAAAGGAAAAAATGAGAAGG - Intronic
1176702908 21:10079245-10079267 ACTCAAAGGGAAAAATGACTTGG - Intergenic
1177289749 21:19096111-19096133 ACGCAAAGGTAACAAGGACAGGG - Intergenic
1178239757 21:30885683-30885705 ACTCTAGGGCAGAAAGCAGAAGG + Intergenic
1179911507 21:44451536-44451558 ACTCAAAGGCAAAAAGCTCATGG - Intergenic
1180142716 21:45902026-45902048 ACTCAAAGGCAGGCAGGAGGGGG + Intronic
1181364438 22:22364258-22364280 AATCAAAAGCAATAAGGTGAGGG - Intergenic
1181422585 22:22811959-22811981 ACTGCAAGGAAAACAGGAGAGGG - Intronic
1181974445 22:26718926-26718948 TCTCAAAGGAAAACAGGAAATGG - Intergenic
1182022447 22:27092034-27092056 ACATACAGGCAAAAAGGAGGGGG + Intergenic
1183121008 22:35730206-35730228 ACAGAAAGGCAGAAAGAAGAGGG - Intergenic
1183134251 22:35871662-35871684 ACTCAAAGCAAAAAAGGAATTGG + Intronic
1183273545 22:36877136-36877158 TCTCAAAAAAAAAAAGGAGAAGG - Intronic
1183305658 22:37081740-37081762 ACTGAAAGGCAGAAAAGACAGGG + Intronic
1183308256 22:37095510-37095532 ACTCAAAAGGAAAATGGGGAGGG + Intronic
1183322786 22:37175458-37175480 ACTACGAGGCAAAAAGCAGAGGG + Intergenic
1183391718 22:37549113-37549135 GATCAAAGGCAAAAACGAGTTGG - Intergenic
1184936500 22:47727465-47727487 TCTCAAGGTCAAAAGGGAGAGGG - Intergenic
949291448 3:2471413-2471435 AATAAAAGGCAAGAAGCAGAAGG - Intronic
949711920 3:6880775-6880797 TCTCAAACTGAAAAAGGAGATGG + Intronic
949781165 3:7690229-7690251 ACTTAAAGGCACAAAGACGAAGG - Intronic
950333177 3:12173446-12173468 ACTTGAAAACAAAAAGGAGATGG - Intronic
950694627 3:14689337-14689359 ACTCAAATTCAAAAAGAAAATGG - Intronic
950711437 3:14815777-14815799 ACTCTGTGGCAAAAAGGGGATGG + Intergenic
950779056 3:15375468-15375490 ACCCAAAGGGAAAAAGGGAAAGG - Intergenic
951171617 3:19548584-19548606 ACTCAAGGGCCAACTGGAGAAGG - Intergenic
951287108 3:20826344-20826366 TCTAAAGGGAAAAAAGGAGAAGG - Intergenic
951380019 3:21971785-21971807 ACTGAAAGCCAAAAAAGAGCAGG + Intronic
951416301 3:22426253-22426275 ACTCAAAGGAGAAAAGAGGAAGG + Intergenic
951800193 3:26587207-26587229 CCTCACAGGCACAAGGGAGAAGG - Intergenic
952044991 3:29307980-29308002 ACTCAAAAGCAAAAGTGTGAGGG - Intronic
952453260 3:33450604-33450626 CCTCAAAGGCAAAGAGGAACTGG - Intergenic
952518123 3:34126382-34126404 ACTAAAAAGAAAAAAGGAAAAGG - Intergenic
952741269 3:36737465-36737487 ACTCAAGGGCAAGGAGGACATGG - Exonic
953480770 3:43249957-43249979 ACTCAAAGGCAAGCAGGAGTGGG - Intergenic
954939538 3:54358801-54358823 ACTAAAAGTCAAAAGGTAGAGGG + Intronic
955648942 3:61172086-61172108 AGTCATGGGGAAAAAGGAGAGGG + Intronic
955928859 3:64035381-64035403 ACTCAAAGACACTAAGAAGACGG + Intergenic
958114600 3:89199733-89199755 ACTTACAGGAAAAAAGAAGAAGG - Intronic
958435990 3:94096389-94096411 ACCCAAAGGCTAAAAGGGAACGG - Intronic
959054688 3:101555569-101555591 ACTCTCAGGCAGATAGGAGAGGG + Intergenic
959220808 3:103516726-103516748 AATCAAAGGACAAAAAGAGAAGG + Intergenic
959395138 3:105827603-105827625 AGCCAAAGGCAGAAAGGGGAGGG + Intronic
959475348 3:106804596-106804618 ATTGAGAGGGAAAAAGGAGAGGG - Intergenic
959904365 3:111694141-111694163 AATCAAAGGGGAAAAGGAGAGGG - Intronic
961173952 3:124818870-124818892 ATTCAAGAGCAAGAAGGAGAGGG + Intronic
961332182 3:126148911-126148933 ACTCAAAGATAAAAAGGTGCAGG - Intronic
961754521 3:129120268-129120290 AGCCAAAGGCAACAAGGAGCAGG + Intronic
961832023 3:129627752-129627774 ACTCAAATCCAAGAAGGAAACGG + Intergenic
962069592 3:132019734-132019756 ACTCAAAAACAAAAAGCAGAGGG - Intronic
962151734 3:132900897-132900919 ACCCAAAGGCAAAATGTAGCTGG - Intergenic
963587358 3:147209250-147209272 AATCAAAGGGAGAAAGAAGAGGG - Intergenic
963725524 3:148916237-148916259 ACACAAAGGTTAAAAGTAGAAGG + Intergenic
963862494 3:150325388-150325410 GCTCAAAAGCGAAAAGTAGAGGG - Intergenic
964543145 3:157802389-157802411 ACTCAAAGGCTCAAAATAGAGGG - Intergenic
964698284 3:159534709-159534731 ACTGTAAGCCACAAAGGAGAGGG + Intronic
964774305 3:160258593-160258615 AATCAAAGCCAAAATTGAGATGG - Exonic
964916749 3:161849720-161849742 CCTCAAAGGCAAAGAGGAACTGG + Intergenic
965834533 3:172837119-172837141 ACTCAAAGGAAAAAAGAGGCTGG - Intergenic
966046185 3:175553019-175553041 ACTGAAAGGCAAAAAAGTAAAGG - Intronic
966268109 3:178071128-178071150 TTTCACAGGCAGAAAGGAGAAGG - Intergenic
966275474 3:178160676-178160698 ACTGAAATGCAAAAAGAAAAAGG + Intergenic
966483219 3:180435650-180435672 ACTCAATGGCAAAAGGCACATGG - Intergenic
966566029 3:181382576-181382598 ACTGAGGGGCAAAAAGCAGAAGG + Intergenic
967352536 3:188529841-188529863 ACCCAAAGGGACACAGGAGAAGG + Intronic
967445782 3:189564743-189564765 TCTAAACTGCAAAAAGGAGAGGG - Intergenic
968890593 4:3366605-3366627 TCTCAACAGCAGAAAGGAGACGG - Intronic
970030853 4:11673127-11673149 AAACTAAGGCAAAAAGGTGAAGG - Intergenic
970139258 4:12962724-12962746 ACTCAAAAGAGAAATGGAGAGGG - Intergenic
970339340 4:15088049-15088071 ACTCACTGGAAGAAAGGAGAAGG - Intergenic
970786807 4:19807131-19807153 CCACAAAGAAAAAAAGGAGAAGG + Intergenic
971280977 4:25242417-25242439 CCTCAAAGGCAAAGAGGAACTGG + Intronic
971474517 4:27059615-27059637 ACTCAAAGGCAAGGAGGGCAGGG + Intergenic
971775180 4:30954468-30954490 ACTGAATGTCAAAAAGCAGAGGG - Intronic
972333150 4:38081854-38081876 ACACAAAAGCAAAGAGGAAAAGG - Intronic
972442838 4:39113526-39113548 AATAAAAAGCAAAAAGGATAGGG + Intronic
974162883 4:58162890-58162912 ATTCAAAGGCTAAAAGGCAATGG - Intergenic
974174724 4:58308319-58308341 CCTCAAAGGCAAAGAGGAACTGG - Intergenic
974439484 4:61898279-61898301 ATTCAATGGGAAAAAGAAGAAGG - Intronic
974696689 4:65384594-65384616 ACCCAAAGGCAGACAGGATAGGG - Intronic
974940286 4:68460026-68460048 ACTCAAGGGAAAACTGGAGATGG + Intronic
975859677 4:78663504-78663526 AAAGAAAGGCAAAAGGGAGAGGG - Intergenic
976019759 4:80607384-80607406 TCTTAAAAGCAAAAAGTAGAGGG + Intronic
976440068 4:85063135-85063157 ATTCAAATGCAAATATGAGAGGG + Intergenic
977834715 4:101634316-101634338 CCTCAAAGGCAAAGAGGAACTGG + Intronic
978957478 4:114632091-114632113 ACTCGAAGGCCAAAAGCAAATGG - Intronic
980375099 4:131935616-131935638 ACTCAAAGGGAAAAATGACTTGG - Intergenic
980571544 4:134626764-134626786 ACTGAAGGGCATAAAGCAGAAGG + Intergenic
980661167 4:135860408-135860430 ACTCACAGGCAGACAGGTGAGGG - Intergenic
980718189 4:136656123-136656145 ACTCATAGCAAAAAAGTAGAAGG - Intergenic
982354310 4:154449984-154450006 ACTCAAAGCCACAAGGGACAGGG - Intronic
982490106 4:156019667-156019689 AGTCAAAGACAAAAGAGAGAAGG - Intergenic
982532226 4:156559080-156559102 ACCTAAAGCGAAAAAGGAGAGGG - Intergenic
982722534 4:158873949-158873971 ACACAAGAGGAAAAAGGAGAGGG - Intronic
982735165 4:158998538-158998560 ACACAAAGGCAGAAATGATATGG - Intronic
983413074 4:167423037-167423059 ACTGAAAGGCAGACTGGAGAGGG + Intergenic
983800580 4:171924568-171924590 ACTCAGAGTCAAAAAGAAAAGGG - Intronic
984920994 4:184764378-184764400 TCTCAAAAGGAAAAAGGAGGAGG - Intronic
985262983 4:188132004-188132026 ACTCAGAAGCAGAAAGTAGAAGG - Intergenic
985342566 4:188970981-188971003 ACTGAAAGTGAAAAAGAAGATGG + Intergenic
985751141 5:1676245-1676267 ACTAAAAGCCAAAAAAGAGAAGG + Intergenic
986236227 5:5913360-5913382 AATCTAAGGAAAAAACGAGAAGG - Intergenic
987337957 5:16913871-16913893 ACAAAAAGACAAGAAGGAGAGGG + Intronic
989210361 5:38853118-38853140 ACTCATAAGCAAAAAAGATAAGG - Intronic
989295070 5:39815959-39815981 AATCAAAGGCTCTAAGGAGAGGG + Intergenic
989305112 5:39946255-39946277 AATAGAAGGCAAAGAGGAGAAGG - Intergenic
989556090 5:42796857-42796879 ACTAATAGAGAAAAAGGAGATGG + Exonic
989999827 5:50879896-50879918 ACTGAAAGGCATAAGGCAGAAGG - Intergenic
990550115 5:56867126-56867148 ACTCAAAAGGAAAAAGGAGCTGG - Intronic
990626112 5:57613259-57613281 AATAAAAGGAAGAAAGGAGAGGG + Intergenic
991531213 5:67616937-67616959 ACACAAAAACAAAAAGGAGGGGG - Intergenic
992139137 5:73778443-73778465 TCACAAAGGCCAAATGGAGATGG + Intronic
992767111 5:80011444-80011466 ACTAAAAGGAAGAAGGGAGAAGG + Intronic
994311930 5:98283025-98283047 ACTCAAAGGCAAATAGTCCAGGG - Intergenic
994469483 5:100184669-100184691 ACTCAAATGTAATTAGGAGAAGG - Intergenic
995498072 5:112769977-112769999 GCTCAAAGGGGAAAAAGAGATGG - Intronic
995541282 5:113188553-113188575 ACACAAAAGCAGAAAGGGGAAGG + Intronic
995629837 5:114121120-114121142 TCCAAAAGGAAAAAAGGAGACGG - Intergenic
995683982 5:114750873-114750895 ACTCAAAGATTAAAAGGAGGGGG + Intergenic
995789548 5:115870604-115870626 GCTCAAAGGCAGAAAGAAGCAGG - Intronic
996542818 5:124647941-124647963 ACTCAAAGACAAAAAGAAAAAGG - Exonic
996641357 5:125758263-125758285 ACCCAAAAGTAACAAGGAGAAGG - Intergenic
997435838 5:133874620-133874642 TCTCAAAGGAAAAAAAAAGAAGG - Intergenic
997752651 5:136362728-136362750 ACAGAAAGACAAAAAGAAGATGG - Intronic
998098812 5:139414809-139414831 ACTCAAAGGCCAAAGGCAGCTGG + Intronic
998111668 5:139507292-139507314 CCTCAAAGGCAAAGAGAAGCAGG - Intergenic
999087675 5:148907477-148907499 TCTGAATGACAAAAAGGAGAGGG + Intergenic
1000249994 5:159485139-159485161 AAGCAAAGGAAAAGAGGAGAGGG + Intergenic
1000440625 5:161259028-161259050 ATTCAAAGGAGAAAAGGGGAAGG - Intergenic
1000590832 5:163155366-163155388 ACTTAAAGGTACAAAAGAGAGGG + Intergenic
1000933146 5:167277133-167277155 ACTCAATGCAAAAAAGGGGAGGG - Intergenic
1001082750 5:168679041-168679063 ATGCAAAGGCAAAAAGGCCATGG - Intronic
1001197161 5:169684174-169684196 ACTGAAAGGCAGAAGGAAGAAGG - Exonic
1002556971 5:180049821-180049843 ATTCAGAGGCAGAAAGGAGAGGG - Intronic
1002658069 5:180769333-180769355 ACCCAAAGGAAAGCAGGAGAGGG - Intergenic
1002677832 5:180933631-180933653 CATTAAAGGCAAAAATGAGAGGG + Intronic
1003055819 6:2819261-2819283 ACTCAAAGAGCAAAAGGAGATGG - Intergenic
1003308620 6:4949892-4949914 ACTCAAGAGCAAAAATGACAGGG - Intronic
1004789917 6:19013656-19013678 ACTGGAAGTCAAAAAGGAGGAGG + Intergenic
1004812452 6:19275189-19275211 CCTCAAAGGCAAAGAGGAACTGG - Intergenic
1004971523 6:20915861-20915883 ACTCAGTGGTAAAAAGGAGCAGG + Intronic
1005061842 6:21783804-21783826 AATCAATGCAAAAAAGGAGAAGG - Intergenic
1005943616 6:30579957-30579979 ACTCAAGGGCAAAAAGGGAAAGG + Exonic
1005944476 6:30585422-30585444 ACTCACAGGCACAGTGGAGAAGG - Intronic
1006414798 6:33897099-33897121 ACTCAAAGCCTAGAAGGACATGG + Intergenic
1006949489 6:37809589-37809611 GCTTAAAGGCAAAAAAGAAAAGG - Intergenic
1008445076 6:51579479-51579501 ACCCAAAAGCAAAAAAGAGGGGG + Intergenic
1008457664 6:51729447-51729469 ACTCAGAGGGAAAAACTAGAAGG - Intronic
1008747003 6:54684249-54684271 ACCAACAGGCAAAAATGAGAGGG - Intergenic
1008853186 6:56049617-56049639 ATTGAGGGGCAAAAAGGAGAGGG - Intergenic
1008939616 6:57032049-57032071 ACTGAAGGGCATAAAGTAGAAGG + Intergenic
1009619412 6:66053604-66053626 AATCAAATGCAAAAAGGCAAAGG + Intergenic
1009872984 6:69472096-69472118 CCTCAAAGGCAAAGAGGAACTGG - Intergenic
1010097427 6:72063164-72063186 ACTAAAAGGGACAAAGGAGCAGG + Intronic
1010424873 6:75718424-75718446 ACTGTAAGGACAAAAGGAGAGGG + Intergenic
1010509336 6:76698951-76698973 ACTCAATTATAAAAAGGAGAAGG + Intergenic
1010591304 6:77716149-77716171 AGTCAAAGGCAGAAAACAGATGG + Intronic
1010795214 6:80110591-80110613 ATTCAAAGGCAAAAAGGTATTGG + Intronic
1010813255 6:80324457-80324479 AGTGAAAGGCAGAAAAGAGATGG + Intronic
1010871329 6:81045548-81045570 AAACAAATGGAAAAAGGAGAAGG + Intergenic
1012840875 6:104327491-104327513 ACTGACAAGCAAAAAGGAGATGG - Intergenic
1013924588 6:115455025-115455047 ATTTAAATGCAAAAAGTAGATGG + Intergenic
1014202457 6:118621399-118621421 CCTCAAAGGCAAAGAGGAACTGG - Intronic
1014643604 6:123945663-123945685 GCTAAAACACAAAAAGGAGAAGG - Intronic
1014961562 6:127692598-127692620 ACATAAAGGCAAGAAAGAGATGG + Intergenic
1015070312 6:129085998-129086020 AATAAAAGGAAAAAATGAGACGG - Intronic
1015420220 6:132998977-132998999 AATCAAGGGCCAAAGGGAGAAGG - Intergenic
1015912907 6:138186458-138186480 AGTCAAAGACAAAAGGCAGAAGG + Intronic
1016058956 6:139608344-139608366 ACTCAAAGACAGGATGGAGATGG + Intergenic
1016395140 6:143616512-143616534 ACTGAATGGCAAGGAGGAGAAGG - Intronic
1016514331 6:144877577-144877599 ACTCAAGGACAAAGGGGAGATGG + Intergenic
1016518222 6:144921015-144921037 ACTCAGAGGGAAAATGGAGAAGG + Intergenic
1016948189 6:149553531-149553553 AATCCAAGGAAAAAAAGAGAGGG - Intergenic
1017352940 6:153464921-153464943 ACACAAAGGAAAAAAGAAGATGG + Intergenic
1018011737 6:159676924-159676946 ACACAAAGGCAAGCAGCAGAAGG + Exonic
1018038379 6:159900854-159900876 ATTCAGATGCAAAAAGGATAAGG + Intergenic
1019535263 7:1526062-1526084 TCTCAAAAGAAAAAAGAAGAAGG + Intergenic
1019717094 7:2544088-2544110 ACTCAAAAGCAAAAAAGAACAGG + Intronic
1020405477 7:7828696-7828718 CTTCAAAGGCAAAAAGGAGAAGG - Intronic
1021132846 7:16932152-16932174 ACTCAAATGAGGAAAGGAGAAGG - Intergenic
1021212517 7:17871968-17871990 ACTAAAAGGCACACAGGATATGG + Intronic
1021949365 7:25760009-25760031 GATCAATGGCAAACAGGAGATGG - Intergenic
1022096904 7:27146882-27146904 TCTGAAGGGCAGAAAGGAGAGGG + Intronic
1023396808 7:39759166-39759188 ACTCAAAGGCAAATAGGTCCCGG - Intergenic
1023714439 7:43029021-43029043 AAACACAGGCAAAAAGGAGAAGG + Intergenic
1024220795 7:47284922-47284944 ACTTAAAGGCAAAGAGAAAATGG - Intronic
1024330603 7:48151074-48151096 TCCCAAAGGCAAAAAGCATAAGG - Intergenic
1024405215 7:48971347-48971369 ACTTAAAGGCAAATAGTGGAAGG + Intergenic
1024747729 7:52427596-52427618 ATTCAAGGGCAAACAGGAGGTGG - Intergenic
1024752429 7:52483228-52483250 ATCCTAAGGCAGAAAGGAGAGGG + Intergenic
1024805916 7:53139581-53139603 TCTTAAAGGCAAAAAGGACAAGG - Intergenic
1025194310 7:56920688-56920710 GCTCAAAACCAAAAGGGAGAGGG - Intergenic
1025677641 7:63656257-63656279 GCTCAAAACCAAAAGGGAGAGGG + Intergenic
1025869822 7:65421261-65421283 ATTCAAAGATAAACAGGAGAAGG - Intergenic
1026113993 7:67480985-67481007 ACCCAAAGGCAAAAAAGAGTAGG - Intergenic
1026868884 7:73838915-73838937 ACCCTAAGGCAGAAAGGAGAGGG - Intronic
1027187111 7:75979324-75979346 ACTCAAAGCCAGGAAGGAAAGGG + Intronic
1027412754 7:77939202-77939224 ACAGAAAGGGAAAAAGGTGAGGG - Intronic
1027844617 7:83356833-83356855 CCTCAAATGCAGAAAGAAGAAGG + Intergenic
1027860980 7:83580751-83580773 CCTTCAAGGCAAATAGGAGAGGG - Intronic
1028184775 7:87769415-87769437 ATTCAAAACAAAAAAGGAGATGG - Intronic
1028718495 7:94002482-94002504 AAAAAAAGGAAAAAAGGAGAAGG + Intronic
1030857404 7:114578146-114578168 ACTTACAGGCAACAAGGATAGGG - Intronic
1031361124 7:120849987-120850009 ACAAAAAGGCAAAAGGGAGCAGG - Intronic
1031539072 7:122971232-122971254 AGTGGAAGGCAAAAAGGAGCAGG - Intergenic
1031947135 7:127854026-127854048 CCTGAAAGGCAGAAAGCAGATGG - Intronic
1032098294 7:128951298-128951320 CCTCAAAGGCAAAAATCAGCTGG + Intergenic
1032194494 7:129781236-129781258 ACTAGAAGCTAAAAAGGAGAAGG - Intergenic
1032484388 7:132273580-132273602 GCTTAGAGGCAAAGAGGAGAGGG + Intronic
1033519270 7:142144464-142144486 ACTCAGAGGAATAAAGGATAGGG + Intronic
1036724472 8:11207669-11207691 CATCATAGGCAAAAAGGAGAGGG + Intergenic
1037858860 8:22390626-22390648 ACACAAAGGGGAAGAGGAGAGGG - Intronic
1038102323 8:24391892-24391914 ACTCTAAAGCAATAAGGAAATGG + Intronic
1038152336 8:24953864-24953886 ACACAAAGGCAAGCAGGAGCAGG + Intronic
1039069225 8:33634587-33634609 GCAGAAAGGCAAAGAGGAGAGGG + Intergenic
1039259472 8:35754990-35755012 ACACAAAAGCAAGAAGGACAAGG - Intronic
1039276197 8:35935959-35935981 CCTCAAAGGCAAAAAGAAACTGG - Intergenic
1039510455 8:38087847-38087869 ACTCAAAGGCAAAAATGTCTCGG + Intergenic
1039720142 8:40154836-40154858 TCTCAAAGGAAAAAATAAGATGG + Exonic
1040743526 8:50611261-50611283 ACTCAGAGGCAAAGGGAAGAAGG - Intronic
1040803027 8:51364524-51364546 AATAAAAGTGAAAAAGGAGATGG + Intronic
1040811957 8:51463400-51463422 ACTCAAAGGCTCAAAGTAAAAGG + Intronic
1040921567 8:52626223-52626245 CCTCAAAGGAAAAAAGGAACGGG + Intronic
1041136023 8:54760164-54760186 ACTAAAAGGCAAAAAAGACGAGG - Intergenic
1041498377 8:58512361-58512383 ACTCAAAGCAAGAAACGAGAAGG - Intergenic
1042239645 8:66650103-66650125 ATTCAAAGGAGAAAATGAGAAGG + Intronic
1042259639 8:66844842-66844864 AGTCAAGGGCAAAGAAGAGATGG - Intronic
1043197855 8:77322238-77322260 ACACAAAGACAAAAAGGAGCAGG - Intergenic
1043430031 8:80185648-80185670 ACTCAAAGGCAGCCAGGAGAAGG - Intronic
1043523448 8:81071692-81071714 ACACAAAGGCAAAGATGACAAGG + Intronic
1043592418 8:81846434-81846456 ATTCAAAGGCAAAAAGGTATTGG - Intergenic
1043950162 8:86299780-86299802 ACTCAAAGGCAGAGAGAAGAAGG - Intronic
1044605943 8:94047518-94047540 ACTCAAAGGCAGGAAAGAGTGGG - Intergenic
1044744033 8:95355039-95355061 TCTCAAAGGCAAAATATAGAGGG + Intergenic
1045238437 8:100376812-100376834 ACTCAAAATCAAAAAGAAGAGGG + Intronic
1045420429 8:102009205-102009227 ACTCTAAGGCAAAAAGCTGGTGG + Intronic
1045760898 8:105606356-105606378 ACTCAAATGAAAAAAAGATATGG - Intronic
1046235508 8:111419413-111419435 ACAAAAAAGCAAAAAGGAGATGG - Intergenic
1048348807 8:133599226-133599248 ACGGAAAGGGAAAAAAGAGAGGG - Intergenic
1048759110 8:137771626-137771648 ACCCAAAGCAAATAAGGAGAAGG - Intergenic
1048980663 8:139702134-139702156 ACTCAGGGGAAAAAAGGAGCCGG + Intronic
1050737319 9:8779037-8779059 GCTCAAAGGGAAAAAGAAGGTGG + Intronic
1050935285 9:11387657-11387679 ACTCATAGGCAAAAGGGATTTGG + Intergenic
1051174426 9:14348242-14348264 CCTCAAAGCAAAAAAGGAAAAGG - Intronic
1051662131 9:19435588-19435610 ACTCAAATGCAAAAATCAGCTGG + Intronic
1053765964 9:41399198-41399220 ACTCAAAGGGAAAAATGACTTGG + Intergenic
1054320865 9:63662281-63662303 ACTCAAAGGGAAAAATGACTTGG - Intergenic
1054544577 9:66310355-66310377 ACTCAAAGGGAAAAATGACTTGG + Intergenic
1055962624 9:81834683-81834705 ACTCAAATGCTAAAATGAGAAGG + Intergenic
1056679734 9:88706577-88706599 ACTCAAAGGGACAAAGGCGCCGG + Intergenic
1058384378 9:104416527-104416549 ACTGAAATGCAAAGAGGATATGG - Intergenic
1058656395 9:107225422-107225444 ACTCAAAGATAAAAATGACAAGG + Intergenic
1058753553 9:108063349-108063371 ACCAAAAGGCCAAAAGCAGAGGG + Intergenic
1058914651 9:109554113-109554135 ACTCAAAGGCAGAAACGTCAGGG - Intergenic
1059366562 9:113790985-113791007 ACTCTAGGGCACAGAGGAGAGGG - Intergenic
1059518138 9:114914730-114914752 ACTAAAACCCAGAAAGGAGAAGG + Intronic
1059849534 9:118321849-118321871 ATTCAGAGTCATAAAGGAGAGGG - Intergenic
1059975308 9:119710024-119710046 AAAAAAAGGCAAAAAGGAGTTGG - Intergenic
1060279246 9:122204848-122204870 CCTCAAAGGCACAGAGAAGAAGG + Intronic
1062276294 9:135733098-135733120 ACTCAGAGCCGACAAGGAGAGGG - Intronic
1202787933 9_KI270719v1_random:49354-49376 ACTCAAAGGGAAAAATGACTTGG - Intergenic
1185957888 X:4512243-4512265 AGGGAAAGGGAAAAAGGAGAAGG + Intergenic
1186035782 X:5421965-5421987 ACTAAAAGGCAAAATGGCGGAGG - Intergenic
1186080124 X:5922052-5922074 AATCAGAGGGAAAAGGGAGAAGG + Intronic
1186545007 X:10440295-10440317 AGTCAATGTCAAAAAGGAGGAGG - Intergenic
1187040781 X:15593469-15593491 AACCAAAGGGAAATAGGAGAAGG - Intronic
1187362981 X:18645203-18645225 ACTAAAAGGAAAAAAGGAGGTGG - Intronic
1187998252 X:24952517-24952539 GCTCAAATGAAAAAAGCAGAAGG + Intronic
1188063783 X:25632965-25632987 ACTGAAAGCAAAGAAGGAGAGGG + Intergenic
1188397008 X:29697358-29697380 GATCAAAGGAAAAAAGGACAAGG + Intronic
1188459382 X:30405814-30405836 ACTCAAAGTCAAATAAGATAGGG + Intergenic
1189169864 X:38898505-38898527 AGTCAAAGGCAGAAAGAGGAAGG + Intergenic
1189975474 X:46457600-46457622 TCTGAAAGGCAAACAGTAGAAGG - Intronic
1189983987 X:46537424-46537446 TCTGAAAGGCAAACAGTAGAAGG + Intronic
1189990883 X:46593708-46593730 ACTCAAAGGAAGACAGGAAAAGG - Intronic
1190591167 X:52003029-52003051 ACTCATAGGAAAAGAGTAGAAGG - Intergenic
1192395214 X:70773840-70773862 ACCTAAAGCAAAAAAGGAGACGG + Intronic
1192583679 X:72304584-72304606 ACCAAGCGGCAAAAAGGAGAGGG - Intronic
1192775988 X:74245544-74245566 TACCAAGGGCAAAAAGGAGAAGG + Intergenic
1193843829 X:86443607-86443629 ACTCAATGGCAAAAAGTTGAAGG - Intronic
1194538792 X:95144152-95144174 ACTCAAGAGCAAAAAAGAAAAGG - Intergenic
1194757571 X:97755363-97755385 ATTCAGAGTCAATAAGGAGAAGG + Intergenic
1195212272 X:102661135-102661157 ACTCAATGTGAAAGAGGAGAAGG - Intergenic
1195314380 X:103664177-103664199 CCTCTAAGGCAATAGGGAGATGG - Intergenic
1195398045 X:104432379-104432401 ACTCAAAGGCAAGATTGAGAGGG - Intergenic
1195821742 X:108952885-108952907 ACTAAAAGGCTAAAAGGTTAGGG + Intergenic
1196809708 X:119619514-119619536 ACTCAAAGGTTAGAAGGAAAAGG + Intronic
1197512378 X:127385953-127385975 ACTCACAGGCAAAAAAATGAAGG + Intergenic
1197949633 X:131880563-131880585 GCTCAAAGGCGAAGAGAAGAAGG + Intergenic
1198039365 X:132834784-132834806 ACTGAAAGGCAAAAAGGGTTTGG + Intronic
1198740578 X:139837917-139837939 AAACAAAAACAAAAAGGAGAAGG + Intronic
1199056950 X:143307711-143307733 ACCAAAAGGCAAAGAGGTGAAGG - Intergenic
1199366954 X:146998563-146998585 ACTTAAAGGAAAAAAGGTAAGGG + Intergenic
1199832209 X:151558246-151558268 CCTCAAAGGCAAAGAGGAACTGG + Intergenic
1201311873 Y:12604751-12604773 CCTCAAAGGCAAAAAGAAACTGG + Intergenic
1201640077 Y:16168904-16168926 CCTCAAAGGCAAAGAGGAACTGG + Intergenic
1201662736 Y:16416421-16416443 CCTCAAAGGCAAAGAGGAACTGG - Intergenic
1202064783 Y:20926969-20926991 AATCAAATGCAAAAATGAGCAGG + Intergenic
1202271852 Y:23080959-23080981 CCTCAAAGGCAAAGAGGAACTGG + Intergenic
1202294174 Y:23339723-23339745 CCTCAAAGGCAAAGAGGAACTGG - Intergenic
1202424849 Y:24714703-24714725 CCTCAAAGGCAAAGAGGAACTGG + Intergenic
1202445940 Y:24955382-24955404 CCTCAAAGGCAAAGAGGAACTGG - Intergenic