ID: 918554942

View in Genome Browser
Species Human (GRCh38)
Location 1:185787494-185787516
Sequence CTGTTGTCTGAGAGCTAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918554938_918554942 26 Left 918554938 1:185787445-185787467 CCAGTTGACTGAAGCTCATGGCA 0: 1
1: 0
2: 0
3: 7
4: 95
Right 918554942 1:185787494-185787516 CTGTTGTCTGAGAGCTAACAGGG 0: 1
1: 0
2: 0
3: 10
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918554942 Original CRISPR CTGTTGTCTGAGAGCTAACA GGG Intronic
907217822 1:52880865-52880887 CTCTTCTCTGAGATCTCACAGGG - Intronic
911857120 1:102892978-102893000 TTTTTGTCTGAGATTTAACAGGG - Intronic
912221898 1:107687819-107687841 CTTTATTCTGAGAGGTAACATGG + Intronic
912269989 1:108199590-108199612 CTGAAGTCTGACAGCTAAAACGG + Intronic
917766309 1:178221607-178221629 GTGTAGTCTGAGAGCAGACATGG + Intronic
918081805 1:181213614-181213636 CTGTGGTCTGAGAGGGAAGAAGG + Intergenic
918554942 1:185787494-185787516 CTGTTGTCTGAGAGCTAACAGGG + Intronic
920579698 1:207095117-207095139 CTGTGGTCTCAGAGCTGACTGGG + Intronic
921486090 1:215717158-215717180 TTGTTGTCTAAGAGCCAATAAGG - Intronic
1063055037 10:2495563-2495585 GTGTCCTCTGAGAGCTGACATGG - Intergenic
1063505993 10:6600214-6600236 CAGTGGGCTGAGAGCCAACAGGG - Intergenic
1064104185 10:12487460-12487482 CTGTCCTCTAACAGCTAACATGG + Intronic
1065018196 10:21480720-21480742 CTCTTGTCTGAGAGCCCACTAGG - Intergenic
1069307530 10:66989563-66989585 CTTTTGTTTGTTAGCTAACATGG - Intronic
1074550852 10:114440876-114440898 CTGTCTTCTGTGAGCTAATAGGG - Intronic
1075554931 10:123423514-123423536 ATGTTGTCTCTGAGCTACCACGG + Intergenic
1076582084 10:131518495-131518517 GTGTTGTCTGTGATCTTACATGG + Intergenic
1078516691 11:12028582-12028604 ATTTTGTCTGAGATCTGACATGG - Intergenic
1078591541 11:12644902-12644924 GTGTTGTTTGAAAGCGAACATGG + Intergenic
1078675518 11:13409096-13409118 ATGTGGTCGGAGAGGTAACAAGG - Intronic
1081600429 11:44488781-44488803 CTCTTGTCTGTGAGCTCTCAGGG - Intergenic
1082792704 11:57358067-57358089 CAGATGTCTGAGAGCTTCCAAGG + Intronic
1083175181 11:60945276-60945298 CTGTTGGCTGTGAGCTCAGATGG - Intronic
1083950660 11:65953786-65953808 CTGTAGACTGAGACCTGACACGG - Intronic
1086257080 11:84890316-84890338 CTGATGTCTGAGAGGTAACTTGG - Intronic
1090188332 11:124752254-124752276 CTGGTATCTCAGAGCAAACAGGG + Intergenic
1090480883 11:127067185-127067207 CAGGTGTCTGAGAGGTCACAGGG + Intergenic
1090663123 11:128895698-128895720 CAGTGGTCTGAGAGCTCAGAGGG - Intronic
1091737499 12:2935133-2935155 CCATTGTGTGAGATCTAACATGG + Intronic
1098165813 12:67696380-67696402 CTGTTTTCTGAGAAATAAGAAGG + Intergenic
1099415312 12:82377901-82377923 CTGATGTCTAAGAGTTTACAAGG - Intronic
1101282322 12:103271087-103271109 CTGTTGCCTGATACATAACAAGG - Intronic
1101420568 12:104547389-104547411 GTGTCGTCTCAGAGCTAAGATGG + Intronic
1104205449 12:126634414-126634436 CTGATGTCAGAGAGGTAACTGGG - Intergenic
1107456151 13:40556639-40556661 CTGTTCTCAGAGAGCTACCAAGG + Exonic
1108267143 13:48723211-48723233 CTGTTGTCTGGGAGCTCAGCAGG - Intergenic
1108559024 13:51625063-51625085 CTGTTGTGTGACAGCTAACTAGG + Intronic
1108561278 13:51646520-51646542 CTGTTGTCAGGAAGCTCACAGGG - Intronic
1109060993 13:57620197-57620219 CTCTTGTCTGAGAACCAGCAAGG + Intergenic
1110290829 13:73805099-73805121 AAGTTGTCTGAGAGTTAAAAGGG - Intronic
1115024059 14:28719234-28719256 CTGTTGGCTGAAAGCTCACCTGG - Intergenic
1115605348 14:34995443-34995465 CTCCTGTCTGACTGCTAACAGGG - Intronic
1116735121 14:48679660-48679682 CTGTTGTCTGGGAGCTCATCTGG - Intergenic
1119854622 14:77890276-77890298 CTGTTGTCTGGGAGCTTAACTGG + Intronic
1121994428 14:98591233-98591255 CAGTTGCCTGAGAGCTGACATGG + Intergenic
1122862517 14:104588899-104588921 CTGCTGCCTGAGGGCTAACTAGG + Exonic
1123203494 14:106691230-106691252 CTGTTGTCTGAGTGATACCCTGG + Intergenic
1127495989 15:59512696-59512718 CTGTTATGTGAGAGCCAGCATGG - Intronic
1128518169 15:68356878-68356900 CTGTTGGCTGAGAGCTCAGGTGG - Intronic
1129611630 15:77064284-77064306 CTGTAGTCTGACAGCTAATGGGG - Intronic
1129933968 15:79433749-79433771 CTGGTGTCTGAGAAATGACAAGG - Intronic
1135818677 16:25659353-25659375 CTGTGGTCTGTGGGGTAACATGG + Intergenic
1138754511 16:59467102-59467124 CTGTTGTATGAAAGGAAACAAGG - Intergenic
1138952324 16:61928400-61928422 CTCATGTCTTAGAGCTGACAAGG - Intronic
1140903411 16:79391058-79391080 CTGTTATCTGTGGGCTAACGAGG + Intergenic
1141764008 16:86046865-86046887 CTGTTGTGTGAGGGCTGATATGG + Intergenic
1145241266 17:21242149-21242171 CTCTTGTGTCAGTGCTAACAAGG - Exonic
1146379880 17:32320782-32320804 CTGTTCTCCCAGAGCTTACAGGG - Intronic
1149157577 17:53650359-53650381 CTGTTTTCCCAGAGCTTACAGGG + Intergenic
1155831472 18:30520474-30520496 ATGTTTTCTGATATCTAACATGG + Intergenic
1160626054 18:80206157-80206179 CTGTTTCCTGAGAGAAAACAAGG + Intronic
1165305107 19:34998940-34998962 CTGAAGTCAGAGAGCTGACAGGG + Intronic
1167665263 19:50819817-50819839 CTGGCTTCTGAGAGCTAACCAGG - Intronic
926573394 2:14554162-14554184 CTGTTGTCTATGAGCCAAGACGG + Intergenic
927588071 2:24328096-24328118 CAGATGGCTGAGAGCTAGCAAGG - Exonic
928454941 2:31411885-31411907 CTGTTGTCTGAGGCCTCAGAAGG + Intronic
929069108 2:38010984-38011006 CTGCTGTCTTACATCTAACAAGG - Intronic
930627615 2:53716197-53716219 CTGGGGTCAGAGAGGTAACATGG + Intronic
933969826 2:87461260-87461282 CTGTTGCCTGAGGGCTGACTTGG - Intergenic
936323955 2:111489237-111489259 CTGTTGCCTGAGGGCTGACTTGG + Intergenic
938847778 2:135229144-135229166 CTGTTGTCTGTGAACTAAATTGG - Intronic
942262918 2:174188472-174188494 TTGTTGTCTAACAGCTGACACGG + Intronic
944628985 2:201603025-201603047 CTGTTGTCTGACAGTTCAAAAGG - Intronic
945808315 2:214517275-214517297 CAGTTGTCTAAGAGCTAAAAAGG + Intronic
948261908 2:236610543-236610565 TTGTTGTATGAGAGATCACAGGG - Intergenic
948262074 2:236612032-236612054 CTGGTCCCTGAGAGCTAAGATGG - Intergenic
948517616 2:238514010-238514032 CTGTTGCCTGAGAGCACACGGGG + Intergenic
1169519527 20:6356150-6356172 CTGTGGTCACAGAGCTCACAGGG + Intergenic
1175885293 20:62286826-62286848 CTGTTGTCCCAGAGCAGACAGGG + Intronic
1184853394 22:47133690-47133712 CTGTTTCCTGACAGCCAACAAGG - Intronic
1184902244 22:47453741-47453763 CTGTTGTCTGGGACCCCACATGG - Intergenic
949962129 3:9321159-9321181 CTGTTGGCTGAGGGCTAGCTGGG - Intronic
950891911 3:16411708-16411730 TTGTTGTTTGAGACCTCACATGG - Intronic
951132966 3:19069636-19069658 CTGTTGGCTGAGACCTAAGCTGG + Intergenic
951828323 3:26894309-26894331 CTCTTGTCTGTGAGCTATAAGGG - Intergenic
952629843 3:35453262-35453284 CTGTTGTCTGAGAGAGCACCTGG + Intergenic
957598901 3:82306367-82306389 CTGCTGTCTGAGTACTAACATGG - Intergenic
960670470 3:120150938-120150960 CTGTTGTCTGGGACCTTACCTGG + Intergenic
961862973 3:129932482-129932504 GTGTGGTCTGAGAGGTAAGAAGG - Intergenic
962891006 3:139673045-139673067 CTGCTGTCTGAGAGGAAAGAAGG - Intronic
968249082 3:197189245-197189267 CAGATATCTGAGAGCTGACATGG + Intronic
969532533 4:7737765-7737787 CTGGTGTCTGGGAGCTGACTGGG + Intronic
971995410 4:33957711-33957733 CTGTTGTCTGAGAACTAGTGTGG + Intergenic
972436933 4:39044419-39044441 CTGTTGTCTCAGAGCTTAAAGGG - Intergenic
974971972 4:68842083-68842105 CTGTTGCCTAAGAGGTAAGATGG + Intergenic
975525782 4:75349325-75349347 CTCTTGCCTGAGAGTTACCAAGG - Intergenic
977575074 4:98666211-98666233 CTGATGTCTGTGAGGCAACATGG - Intergenic
977812233 4:101370200-101370222 GTGTGGTCTGAGAGAAAACATGG - Intergenic
978052222 4:104215695-104215717 TGGTTGTATGAGAGCTAAAAAGG - Intergenic
978158280 4:105514606-105514628 CTGTTGTCTGAGAGAGTACTTGG + Intergenic
980771185 4:137375337-137375359 CTGTTTTCTGAGGGCTATCTAGG + Intergenic
981279458 4:142940643-142940665 GTGTTGTCAGTGAGCTGACATGG - Intergenic
982455581 4:155605592-155605614 GTGTTGTCTTAGAATTAACAGGG - Intergenic
987857032 5:23433714-23433736 CTGCTGGCAGAGAGCCAACAAGG - Intergenic
988486385 5:31671399-31671421 TTGTTGTCTGAGAGCTTTGAAGG + Intronic
988741606 5:34079262-34079284 CTGTTTTCTGAGAAATAAAAAGG - Intronic
989171292 5:38472266-38472288 CTGTTGTCAAAGAGGTAAGAAGG + Intergenic
990186249 5:53212955-53212977 CTGCTGTCTGAGAGCTTCCTCGG - Intergenic
990393260 5:55349852-55349874 CTTTTCTCTGAGAGCTAGTATGG + Intronic
990528439 5:56651197-56651219 CTGATGTCTGAGGGCAAAGATGG - Intergenic
993222510 5:85118465-85118487 CTGTTGTCTAAGAGCTTGAATGG + Intergenic
995653735 5:114401455-114401477 CTGTTAACTGAGAAATAACAAGG + Intronic
996803016 5:127424617-127424639 CTAGTGTCTGAGAGCTACCTTGG + Intronic
997185992 5:131882719-131882741 TTGTGGTCAGAGAGCTAACCAGG - Intronic
999486453 5:152001819-152001841 ATGTTGCCTGAGATCTAATATGG + Intergenic
1001233264 5:170008266-170008288 CTGTTGTCTGAGAGTGGACGTGG + Intronic
1003237067 6:4304311-4304333 CTGTGGTCTGAGAGGTCAGAAGG + Intergenic
1005429488 6:25740089-25740111 CTGTTGCCTCATAGCTAAAAGGG - Intergenic
1010830972 6:80528471-80528493 CTTTTTTCTGAGTGCAAACAAGG - Intergenic
1011101196 6:83724440-83724462 CTGCTGCCAGAGAGCTGACAGGG - Intergenic
1011369076 6:86612953-86612975 CTCTTGTCTGAGATCAGACAAGG - Intergenic
1011998736 6:93626436-93626458 CTGAAGTCTGGGAGCCAACATGG + Intergenic
1012298603 6:97555723-97555745 CTTTTTTCTAAGATCTAACAAGG - Intergenic
1012347091 6:98203278-98203300 CTATTGCCTGAAATCTAACATGG - Intergenic
1015555834 6:134460409-134460431 CTATTGTCTGAGAGTTTATAAGG + Intergenic
1018228642 6:161654967-161654989 CTCTGGTCTGAGAGCTGACAGGG + Intronic
1018453062 6:163926826-163926848 CTGTTGGCTGGGAGGAAACATGG + Intergenic
1020761504 7:12272601-12272623 CTGTTGTTTAAGAGCTCATACGG + Intergenic
1023043868 7:36195093-36195115 CTGTTGTCTGGGACCTTACCAGG - Intronic
1024002774 7:45201990-45202012 GAGTTGTCTGAGAGGTAAGATGG + Intergenic
1026364010 7:69629379-69629401 CCGTTGGCTGAGAGCTAGCAAGG - Intronic
1027925243 7:84452394-84452416 CTATTGTTTGAGAGTTGACATGG + Intronic
1030759013 7:113327895-113327917 CTGTCTTCTGAGAGCTATCGAGG + Intergenic
1031746900 7:125510364-125510386 TTGTTGTCTGGGAGCTTGCATGG - Intergenic
1039705978 8:40007951-40007973 CTCCTGTCTGACAGCCAACAAGG - Intronic
1040082894 8:43307138-43307160 CTGTTGTGTGAGAGCAACTATGG + Intergenic
1041409190 8:57534625-57534647 CTGTTGTCTGGGAGATCAGAAGG - Intergenic
1042177076 8:66047494-66047516 CGGTTTTCTGAGAGTTAAAATGG - Intronic
1042910672 8:73822465-73822487 CTGTTGCCTGAGAGCACAGAGGG + Intronic
1044532228 8:93320301-93320323 CTGTTTTGTAAGAGCTATCATGG - Intergenic
1045504146 8:102766881-102766903 CTGTTCTCTGGAAGCTCACATGG - Intergenic
1047964423 8:130035464-130035486 CTGTTGTCTGAGTTCTTTCAGGG - Intergenic
1048313298 8:133342915-133342937 CCCTTGTCTGAGAGCTTCCACGG - Intergenic
1049449639 8:142653733-142653755 CTTTTGGGTGAGAGCTACCAAGG - Intergenic
1049625215 8:143616891-143616913 CTGTAGGCTGAGAGCTCCCAGGG - Intronic
1049715320 8:144087089-144087111 CTGTTGTCTGGGAGGTTCCAAGG + Intergenic
1049724807 8:144140783-144140805 CTGATGTCTGAGTGCTAAGAGGG - Exonic
1051350913 9:16197256-16197278 CTTTTGGCTGAGAGGCAACATGG + Intergenic
1052042655 9:23757019-23757041 CTGTTGTCAGAGAGCTTCCCAGG - Intronic
1054834644 9:69663952-69663974 CTGTTATCTTGGAGGTAACAGGG - Intronic
1057967417 9:99517710-99517732 CTGTGGTCTTAGAGCTCTCATGG + Intergenic
1058711342 9:107681990-107682012 CTGTTGTCTGGGAACCAAAAAGG + Intergenic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1060385826 9:123227426-123227448 ATGTGGTCAGAGAGGTAACAGGG + Intronic
1062000821 9:134214814-134214836 CTGTTGTCAGGGAGCCAGCATGG + Intergenic
1186620232 X:11232800-11232822 ATTTTGTTTGAGAACTAACAGGG - Intronic
1188711743 X:33409422-33409444 CTTTTCTCTGATAGCAAACAGGG + Intergenic
1188764310 X:34073587-34073609 CTGCTGTCTGAGGTATAACATGG - Intergenic
1189065197 X:37800263-37800285 CTGTTTCCTGAGTGCTACCATGG - Intronic
1189589044 X:42492531-42492553 CTGTTATCTGAGAGCTCAGTTGG - Intergenic
1190480001 X:50867138-50867160 CTGATTTATGAGAGCTATCAAGG - Intergenic
1197495837 X:127178468-127178490 CTATTGTCTGAGAGCCATGAAGG + Intergenic
1200425763 Y:3019039-3019061 CTTTTGTCTCTGAGCTGACAAGG + Intergenic
1201786173 Y:17782243-17782265 CTGGTGGGTGAGATCTAACAGGG - Intergenic
1201815380 Y:18123745-18123767 CTGGTGGGTGAGATCTAACAGGG + Intergenic
1202345572 Y:23921285-23921307 CTGGTGGGTGAGATCTAACAGGG - Intergenic
1202525198 Y:25748805-25748827 CTGGTGGGTGAGATCTAACAGGG + Intergenic