ID: 918558457

View in Genome Browser
Species Human (GRCh38)
Location 1:185834392-185834414
Sequence CAAGCTACTCACATGGTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918558452_918558457 11 Left 918558452 1:185834358-185834380 CCTTGCAAAACTTGACTGAAAAA 0: 1
1: 0
2: 2
3: 24
4: 317
Right 918558457 1:185834392-185834414 CAAGCTACTCACATGGTTGTTGG 0: 1
1: 0
2: 2
3: 12
4: 143
918558451_918558457 20 Left 918558451 1:185834349-185834371 CCTTGTGGTCCTTGCAAAACTTG 0: 1
1: 0
2: 1
3: 16
4: 179
Right 918558457 1:185834392-185834414 CAAGCTACTCACATGGTTGTTGG 0: 1
1: 0
2: 2
3: 12
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918558457 Original CRISPR CAAGCTACTCACATGGTTGT TGG Intronic
901167932 1:7233067-7233089 CAAGCTTCTCACATTCTGGTGGG - Intronic
902898190 1:19494133-19494155 CAAGTTACTAACACGGTTTTAGG + Intergenic
904480816 1:30792205-30792227 CAAGCTCCTCACAGGGCTGTGGG + Intergenic
905177219 1:36144773-36144795 CATGCCATTCACAGGGTTGTTGG + Intronic
905406466 1:37735679-37735701 CCAGCTTCTCTCATGGTGGTCGG + Intronic
906165642 1:43684161-43684183 CAAGACACTCACAGGGTGGTGGG + Intronic
915269064 1:154739838-154739860 TAAGCTACTCATGTGGTGGTTGG - Intronic
918558457 1:185834392-185834414 CAAGCTACTCACATGGTTGTTGG + Intronic
920684000 1:208095328-208095350 CCAGCTTCTCACACAGTTGTGGG + Intronic
922483108 1:225952840-225952862 CAAGCTCCTCTCATTGTGGTGGG - Intergenic
924472803 1:244357971-244357993 CAAGCTACTCAGAAGGCTGAAGG + Intronic
1067823891 10:49555397-49555419 CTAGGTACTCTGATGGTTGTGGG + Intergenic
1069506131 10:68999605-68999627 CAACTTACTCACATGGTTGTTGG + Intronic
1069808751 10:71143053-71143075 CATGCTACTTACATGATTTTAGG + Intergenic
1072924547 10:99605094-99605116 AAATTGACTCACATGGTTGTGGG - Intergenic
1075154613 10:119964288-119964310 AAGCCCACTCACATGGTTGTTGG + Intergenic
1078817649 11:14842622-14842644 CAAGCTACTCAGGTGGCTGAGGG + Intronic
1079870738 11:25794810-25794832 GAAGCTACTCAGCTGGTTGGAGG + Intergenic
1081817381 11:45955867-45955889 TGAGCTCATCACATGGTTGTTGG - Intronic
1085750231 11:79155099-79155121 CAAGCTACTCACTTGGATAATGG - Intronic
1088887747 11:114021000-114021022 CAAGCTACTCCATTGGTTGTGGG - Intergenic
1090516594 11:127434939-127434961 CAAGCTAATCATATAGTTGAGGG + Intergenic
1093635515 12:21462495-21462517 TAAGGTAGTCACATGGTTATTGG + Intronic
1095359317 12:41317226-41317248 GAATGGACTCACATGGTTGTGGG + Intronic
1095641296 12:44488424-44488446 TAAGCCGCTCACAAGGTTGTAGG - Intergenic
1096664442 12:53153718-53153740 GAAGCTCCTCACATCATTGTGGG + Intergenic
1100886718 12:99079076-99079098 TAACTCACTCACATGGTTGTAGG - Intronic
1100920283 12:99476898-99476920 AAGACCACTCACATGGTTGTTGG + Intronic
1103379289 12:120481401-120481423 CCAGCTACCCACATTTTTGTTGG + Intronic
1114058166 14:18993395-18993417 CAAGCTGCTCACATTGATATTGG + Intronic
1114104381 14:19408359-19408381 CAAGCTGCTCACATTGATATTGG - Intronic
1117506685 14:56411270-56411292 CAAGATCCTCAGATAGTTGTAGG + Intergenic
1121161489 14:91745364-91745386 CAAGCGCCTCAGCTGGTTGTAGG - Intronic
1121457832 14:94050119-94050141 TATGCTTCTCCCATGGTTGTGGG + Exonic
1121830061 14:97043803-97043825 CAACCTACCCATAAGGTTGTTGG + Intergenic
1123497288 15:20840946-20840968 CAAGCTGCTCACATTGATATTGG - Intronic
1123590767 15:21851899-21851921 CAAGCTGCTCACATTGATATTGG - Intergenic
1124689866 15:31812786-31812808 AAAGCTCCTCACATGGTGGATGG - Intronic
1127246656 15:57183766-57183788 CAAACAGCTCACAAGGTTGTTGG - Intronic
1127445124 15:59054048-59054070 CCAGCTACTCACAAGGCTGAGGG - Intronic
1131014075 15:89043115-89043137 CTAGCTACTCCCATGGTTTTGGG - Intergenic
1202962868 15_KI270727v1_random:141778-141800 CAAGCTGCTCACATTGATATTGG - Intergenic
1134089740 16:11385100-11385122 CAAGCTTGTCACCTGGCTGTGGG - Intronic
1135652902 16:24222416-24222438 AAGCTTACTCACATGGTTGTTGG + Intergenic
1137497999 16:48985771-48985793 CAAGCTACAGAAATGGGTGTGGG + Intergenic
1138406476 16:56798752-56798774 CCAGCTACTCCGGTGGTTGTGGG + Intronic
1142314561 16:89335380-89335402 CAAGCTGCTCCCATGCTTCTGGG - Intronic
1150781511 17:68126705-68126727 GAAGCTTCTCACATCGTTGTTGG + Intergenic
1151170221 17:72239440-72239462 AAACCCACTCACATGGCTGTTGG + Intergenic
1154455310 18:14517354-14517376 CAAGCTGCTCACATTGATATTGG - Intronic
1155728821 18:29126207-29126229 TAAACTTCTTACATGGTTGTTGG + Intergenic
1161884547 19:6983837-6983859 CAAGCTACTCACAAGGTTGCTGG - Intergenic
1162812863 19:13174971-13174993 CCAGCTACTCACAAGGCTGAGGG - Intergenic
1163332118 19:16646326-16646348 CAAGCAAATCACACAGTTGTGGG + Exonic
1164969345 19:32517827-32517849 AAGCTTACTCACATGGTTGTTGG + Intergenic
929170973 2:38933232-38933254 CAAGCTTATCACCTGGTTATTGG + Intronic
930217188 2:48708936-48708958 CATTCTACTCACAAGGTTTTCGG + Exonic
931066096 2:58588919-58588941 CCAGCTACTCAGAAGGTTGAGGG + Intergenic
931967971 2:67554330-67554352 AAAGCCACTCTCATGGTTGATGG - Intergenic
936625974 2:114149851-114149873 CCAGCTGCCCACATGTTTGTGGG + Intergenic
937500543 2:122473817-122473839 CAAGGTAGTCTCAAGGTTGTTGG + Intergenic
938276949 2:130035213-130035235 AAAGCTACTCCAATGGCTGTGGG - Intergenic
938327916 2:130425989-130426011 AAAGCTACTCCAATGGCTGTGGG - Intergenic
938362030 2:130695494-130695516 AAAGCTACTCCAATGGCTGTGGG + Intergenic
938438438 2:131302182-131302204 AAAGCTACTCCAATGGCTGTGGG + Intronic
938476575 2:131620335-131620357 CAAGCTGCTCACATTGATATTGG + Intergenic
939731499 2:145790201-145790223 CAATCTACTTACATGGTCATAGG + Intergenic
940897404 2:159094190-159094212 CCAGCTAGTCAAATGGCTGTGGG - Intronic
944710909 2:202334266-202334288 CAAGCTACTCAGAAGGCTGAGGG - Intergenic
945901269 2:215540213-215540235 CCAGGTACTCAAATGGGTGTTGG - Intergenic
946225280 2:218261206-218261228 GTAGCTACTCACATGGCTGTTGG - Exonic
946669451 2:222086724-222086746 CCAGCTACTCACGAGGTTGAGGG + Intergenic
947562630 2:231170682-231170704 CAATATACTCAAATGGTTCTGGG - Exonic
1168928223 20:1599988-1600010 CAAGCAACTAACATGCTTTTTGG + Intronic
1172726051 20:37042785-37042807 CCAGCTACTCAGAAGGCTGTGGG + Intronic
1172801114 20:37576890-37576912 CAAGGAACTCACATGCTGGTGGG - Intergenic
1174286700 20:49479211-49479233 CATGGTACTCACATTCTTGTGGG + Intronic
1176818859 21:13635958-13635980 CAAGCTGCTCACATTGATATTGG + Intronic
1177803665 21:25853112-25853134 GCAGCTACTCATAGGGTTGTTGG + Intergenic
1180144218 21:45910314-45910336 CTAGCTGGTCACATGGTTCTGGG + Intronic
1180476653 22:15716011-15716033 CAAGCTGCTCACATTGATATTGG + Intronic
1181742902 22:24935577-24935599 CCAGCTACTGCCATGATTGTGGG - Exonic
1183173083 22:36202219-36202241 CCAGCTACTCAGAAGGTTGAAGG - Intronic
1183180134 22:36254450-36254472 CCAGCTACTCAGAAGGTTGAAGG + Intronic
949173349 3:1029666-1029688 CTAGCTTCTCACATAGTTGGGGG + Intergenic
951174220 3:19580188-19580210 CAACCTTCTCACATGGCTATGGG - Intergenic
952136088 3:30422248-30422270 GAACCTACTCACATGTTTGTTGG + Intergenic
954462816 3:50637302-50637324 CAAGCTGCTCCCAGGGTGGTAGG + Intronic
958448505 3:94244258-94244280 GAAGCTATTCAAATAGTTGTGGG - Intergenic
958803764 3:98785162-98785184 CAACCTTCTCTCTTGGTTGTTGG + Intronic
959732596 3:109620879-109620901 AAAGATACTTACATGGCTGTTGG + Intergenic
960394375 3:117118274-117118296 AAAGCAACTAACATGGTTGGAGG + Intronic
960402440 3:117218187-117218209 CAATCTACTCTCATGGTGGGCGG + Intergenic
961414001 3:126744242-126744264 CAATTTATTCACATGGTTTTTGG + Intronic
961416135 3:126758661-126758683 CAAGCCACTCTCAAGTTTGTAGG + Intronic
964931310 3:162027952-162027974 TAAGCTACACAGATAGTTGTGGG + Intergenic
967144531 3:186595353-186595375 TAGGCTACTTACATGGTTATGGG + Intronic
969229115 4:5817294-5817316 CAAGCTACCCACGTGGTGTTTGG + Intronic
972618105 4:40719596-40719618 CTAGCTAATCACAGGGTAGTAGG + Intergenic
977390565 4:96403559-96403581 CAGTCTACTCACATGGCTGTTGG - Intergenic
983972470 4:173891926-173891948 AAAGCCATTCACATGGATGTTGG + Intergenic
984744429 4:183200638-183200660 CAAGCCACTCGTACGGTTGTTGG + Intronic
989775791 5:45205751-45205773 GAATATACTTACATGGTTGTTGG + Intergenic
991697783 5:69289077-69289099 CAAGCTCCACACAGGGTTGCAGG + Intronic
992818362 5:80468029-80468051 CAAGCTACTCAGGAGGTTGATGG + Intronic
994043079 5:95279917-95279939 AAAGCTACTAACATTGTTTTAGG + Intronic
996220206 5:120923170-120923192 AATGCTACTCATATGGTTGCTGG + Intergenic
997866352 5:137466978-137467000 CAGTCCACTCACATGGTTGTTGG + Intronic
1000260489 5:159583707-159583729 ATATTTACTCACATGGTTGTTGG - Intergenic
1002439028 5:179254551-179254573 GAAGCAACTCAAATGCTTGTAGG + Intronic
1007204794 6:40140202-40140224 CAAGTTGCTCACATGTTGGTGGG - Intergenic
1009561326 6:65248065-65248087 AAAGATACTCAGATTGTTGTTGG + Intronic
1010742199 6:79521315-79521337 CAATCTACATACATGGTTGGTGG + Intronic
1010874445 6:81084662-81084684 CAAATTGCTCACATAGTTGTGGG + Intergenic
1018934826 6:168266869-168266891 CGAGCAACTCACCTGGTTTTTGG + Intergenic
1019852970 7:3577789-3577811 GAAGCTTCTAACATGGTTGGGGG - Intronic
1020905160 7:14054786-14054808 CAAGCTACTCAGTTGGCTGAGGG - Intergenic
1020911078 7:14132338-14132360 CAAGCCACTTACATGCCTGTTGG + Intergenic
1022345519 7:29510491-29510513 AAGCCCACTCACATGGTTGTTGG + Intronic
1027820233 7:83033067-83033089 CAACCTTCTTACATGGTGGTAGG - Intronic
1029333415 7:99879279-99879301 GTAGCTGCTCACATGGTTTTTGG - Intronic
1030899853 7:115109668-115109690 CACACTATTCACATGTTTGTGGG - Intergenic
1030996766 7:116368820-116368842 CAAGCTACTCTCATACTTGATGG - Intronic
1031716309 7:125112928-125112950 CACATTACTCACATGTTTGTGGG - Intergenic
1031981316 7:128127544-128127566 CTAGCTTCTCACATGGTGGACGG + Intergenic
1034206253 7:149318498-149318520 CTAGCTTCTCAAATGGTGGTGGG + Intergenic
1036028960 8:4944384-4944406 CACACTATTCAGATGGTTGTAGG + Intronic
1038127637 8:24692054-24692076 AGAGCTTCTCACATGGTTGGCGG + Intergenic
1040085498 8:43336014-43336036 CAAGCTGCTCACATTGATATTGG + Intergenic
1042091475 8:65164406-65164428 CAAGCTACTGTCAGGGTTTTTGG + Intergenic
1042667274 8:71220954-71220976 CAAGGCACTTACATGGTTATGGG + Intronic
1044653951 8:94528117-94528139 CCAGCTACTCAGATGGCTGAGGG + Intronic
1047627542 8:126671806-126671828 GAAGCAACTCACATATTTGTTGG + Intergenic
1047891283 8:129313874-129313896 AAGTTTACTCACATGGTTGTTGG - Intergenic
1048943378 8:139422513-139422535 CAAGCACCTCAGGTGGTTGTAGG - Intergenic
1049935019 9:493314-493336 TCAGCAACTCACATGGTTGCTGG - Intronic
1049935179 9:494661-494683 TCAGCAGCTCACATGGTTGTTGG - Intronic
1055115740 9:72603328-72603350 CATGATACTCACATGGTTATGGG - Intronic
1059431283 9:114251890-114251912 CAAGGCACTCAGAGGGTTGTAGG - Intronic
1061066261 9:128279461-128279483 CAAGCAAGTCACATGATCGTGGG + Intronic
1203528498 Un_GL000213v1:113547-113569 CAAGCTGCTCACATTGATATTGG - Intergenic
1186830753 X:13387725-13387747 CGGGTTACTCACATGGTTGTTGG + Intergenic
1189103530 X:38214516-38214538 CAACCTACTCACGTGGCTGGGGG + Intronic
1190441594 X:50480285-50480307 CTCTCTAGTCACATGGTTGTTGG + Intergenic
1190934188 X:54980037-54980059 CAACTTACTCACAAGGTTGTTGG - Intronic
1191675504 X:63788173-63788195 CTAACTACTCATATGGTTCTAGG - Intergenic
1192164522 X:68819185-68819207 AAGCCCACTCACATGGTTGTTGG - Intergenic
1193238919 X:79143280-79143302 CAAGCTACTCAGATGGCTGAGGG + Intergenic
1193708363 X:84850854-84850876 CAAACCAATCACATTGTTGTGGG + Intergenic
1196565605 X:117200960-117200982 CAAGCTACTAACCTGCTTTTTGG - Intergenic
1197022472 X:121708113-121708135 CAAGATAATCATATGGTTTTAGG + Intergenic
1198911860 X:141624001-141624023 CAAGCTTCTCATATTGTTTTTGG - Intronic
1199522939 X:148757505-148757527 CATGCTACTAGCATGGTAGTTGG + Intronic
1201388772 Y:13473498-13473520 CAAGGCAATAACATGGTTGTGGG + Intronic
1202163683 Y:21963661-21963683 CAAACTATTCACATCGTTGGAGG - Intergenic
1202227673 Y:22622704-22622726 CAAACTATTCACATCGTTGGAGG + Intergenic
1202315484 Y:23573474-23573496 CAAACTATTCACATCGTTGGAGG - Intergenic
1202555317 Y:26097123-26097145 CAAACTATTCACATCGTTGGAGG + Intergenic