ID: 918559457

View in Genome Browser
Species Human (GRCh38)
Location 1:185847089-185847111
Sequence GTGAAAAATAAGAAATCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 745
Summary {0: 1, 1: 1, 2: 6, 3: 68, 4: 669}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918559457 Original CRISPR GTGAAAAATAAGAAATCTGA TGG (reversed) Intronic
900038930 1:440890-440912 GTGCAAAGAAAGACATCTGAGGG - Intergenic
900060362 1:675866-675888 GTGCAAAGAAAGACATCTGAGGG - Intergenic
901255674 1:7824433-7824455 TTGAAAAAGAATAAAGCTGAAGG - Intronic
901339935 1:8488225-8488247 ATAAAAAATAAAAAGTCTGATGG - Intronic
901470288 1:9451281-9451303 GTGAATATTATGAGATCTGATGG - Intergenic
901558632 1:10051783-10051805 GACAAAAATAAGTCATCTGATGG - Intronic
901819505 1:11818114-11818136 ATTAAAAAAAAGAAATCTCAGGG + Intronic
902276004 1:15339830-15339852 CTCAAAAAAAAAAAATCTGATGG - Intronic
902670068 1:17966990-17967012 GTGAGAAATAAGAGATGTGCAGG - Intergenic
904667079 1:32131291-32131313 CTCAAAAAGAAGAAATCTTAGGG + Intronic
905329136 1:37179920-37179942 GTGAAAAATGAGGAATTGGAGGG - Intergenic
906062100 1:42955654-42955676 AGGAAAAATCAGAAATCTGCAGG - Intronic
906927151 1:50129908-50129930 GAGAAAAACAACAAATCTGAAGG - Intronic
908038831 1:60085427-60085449 ATGAAAAATTATTAATCTGATGG + Intergenic
909143991 1:71905597-71905619 TTGCAACATAAGAATTCTGAAGG - Intronic
909167096 1:72240896-72240918 GGAAACAATAAGAAATCAGAAGG - Intronic
909627459 1:77733483-77733505 ATGAAACATAAGAAAACTGAAGG + Intronic
909716469 1:78713448-78713470 ATGAAAAATAACAGATCAGAGGG + Intergenic
910267576 1:85354902-85354924 GTAAAAAGAAAGAAATGTGAAGG + Intronic
910419903 1:87047887-87047909 TTGAAAAATAAGAAAATTGAAGG - Intronic
910994340 1:93088099-93088121 GAAAAAAATAAGAGAACTGAGGG - Intronic
911087072 1:93987903-93987925 GTGGAAGAGAAGGAATCTGAGGG + Intergenic
911343686 1:96671693-96671715 GTGAACAATAAGAAATCATCTGG - Intergenic
911374312 1:97032325-97032347 GTGAATAAAATGACATCTGAAGG - Intergenic
911399316 1:97354911-97354933 ATGAAAAATAAAGAAACTGATGG - Intronic
911545820 1:99215108-99215130 GTGAAAAATAAGACATAGAATGG - Intergenic
911618589 1:100041001-100041023 GTTGAAAAGAAGAAATCAGAAGG - Intronic
911730306 1:101285671-101285693 ATCAAAAAAAAGAAATCTGTGGG + Intergenic
912127524 1:106557254-106557276 GTGAGAAATAAATTATCTGAAGG + Intergenic
912710555 1:111946687-111946709 CTGAAAAGTGAGAAGTCTGAAGG + Intronic
913242733 1:116843670-116843692 CTCAAAAATAAGGAAGCTGACGG - Intergenic
913292615 1:117287984-117288006 GCAGAAGATAAGAAATCTGAAGG - Intergenic
913536447 1:119777555-119777577 TTGAAAAATAAGAATAATGAGGG + Intergenic
915046283 1:153019612-153019634 GTGCAAAATAAATTATCTGATGG + Intergenic
915395121 1:155577667-155577689 TTGAAAAATAACAAATTTAAAGG - Intergenic
916730749 1:167564681-167564703 GTGAAAAATAAAAGACCAGAAGG + Intergenic
916857849 1:168769566-168769588 GCAAAAAAGAAGAAATCTGAAGG - Intergenic
916909384 1:169329225-169329247 GTGAGAAATAAGGAATATGTGGG - Intronic
916981064 1:170137611-170137633 AGCAAAAATAACAAATCTGAAGG + Intergenic
917274499 1:173317876-173317898 CTGAAAAGTAAGAAATGTAAAGG + Intergenic
917289845 1:173460934-173460956 GGGAAAAATTAGAAGTCTGTTGG - Intergenic
918136762 1:181680796-181680818 GTGAGAAATGAGAAATCTAGGGG - Intronic
918287883 1:183076416-183076438 ATGAAAAATGAGAAACTTGAGGG + Intronic
918559457 1:185847089-185847111 GTGAAAAATAAGAAATCTGATGG - Intronic
918665866 1:187150248-187150270 GAAAAAAATAAGAAAACTGAAGG - Intergenic
918677669 1:187307723-187307745 ATGTAAAATGATAAATCTGAAGG - Intergenic
918766785 1:188496945-188496967 GTTAAAAAAAAGAAATCAAAAGG - Intergenic
919150045 1:193684839-193684861 GTGAAAAGTGAGACATCTGAGGG + Intergenic
919170385 1:193946944-193946966 TTGAAAAAGAACAAATCTGGAGG + Intergenic
919564811 1:199171232-199171254 GTGAAAAAGAAAAAATATAAAGG + Intergenic
919825935 1:201503143-201503165 CTCAAAAAAAAGAAGTCTGAAGG + Intronic
920206651 1:204297042-204297064 GTTTAAAAAAAGAAATCTGCAGG - Intronic
920555884 1:206904193-206904215 GTGAAAACCAAGAAATGTAATGG + Intergenic
921093630 1:211867385-211867407 GTTAAGAATAAGAAAAATGAAGG + Intergenic
921842060 1:219839310-219839332 TTGAAAAATAAGAAATGTTGGGG + Intronic
921984487 1:221297113-221297135 ATGGAAAATATGAAATTTGATGG - Intergenic
922248021 1:223819383-223819405 GTAAAGAGTAAGAAAACTGAGGG + Intronic
923244321 1:232117438-232117460 TTGAAAAAGAACAAAGCTGAAGG - Intergenic
923710037 1:236380391-236380413 CTGGAAAATAAGAAGACTGAAGG + Intronic
924174120 1:241372354-241372376 ATTTAAAATAAGAAAACTGAGGG - Intergenic
924204635 1:241698982-241699004 GAGAAGAATGAGAAAACTGAGGG + Intronic
924696705 1:246407959-246407981 GTGTAAATGAAGAAACCTGAGGG + Intronic
1063277081 10:4581466-4581488 GTGGAAAAAAACAAATCAGATGG + Intergenic
1063397659 10:5706279-5706301 TTGAAAAAGAACAAAGCTGAAGG - Intronic
1064545805 10:16448911-16448933 GTGAAAATTAATAAATCTCCTGG - Intronic
1064776728 10:18787126-18787148 TTAAAAAAAAAAAAATCTGAAGG - Intergenic
1064958040 10:20933163-20933185 GTGAACCATAAGTAATCTAAAGG - Intronic
1065637728 10:27747075-27747097 GTGACACATATGAAATTTGAGGG - Intergenic
1065681684 10:28241270-28241292 ATAAAAAACAAGAAATATGAGGG - Intronic
1065793808 10:29287041-29287063 GTTAAATATAAAAAATCTGCAGG - Intergenic
1066145140 10:32549851-32549873 AGCAAAAAGAAGAAATCTGAAGG - Intronic
1066665289 10:37776883-37776905 TTGACAAACAAGAAAACTGACGG - Intronic
1067052055 10:43027301-43027323 GGGAAAAATAAGAGCTCTGAAGG - Intergenic
1068102709 10:52575910-52575932 GAGATAAATAATAAATGTGAGGG - Intergenic
1068721247 10:60248441-60248463 ATAAAAAATAAGAAATTTGGGGG + Intronic
1068755736 10:60650601-60650623 GTGAAAAATCTGAAATTTTATGG + Intronic
1069271655 10:66535832-66535854 GTGAGAGATAAGAATTATGAAGG + Intronic
1070025968 10:72632333-72632355 GTAAAAAATATAAAATCTGTGGG - Intergenic
1070495955 10:77022732-77022754 GTGAAAAAAAGGAAAACTTATGG - Intronic
1071125350 10:82328475-82328497 GTAAAAAATATGAATTATGATGG - Intronic
1071768078 10:88691348-88691370 ATGAGCAATAAGAAATCTGAAGG + Intergenic
1072341481 10:94456405-94456427 GTGTCAAAGAAGAAATCTTAAGG - Intronic
1073167662 10:101471668-101471690 GTGAATTCTATGAAATCTGAAGG - Intronic
1074069660 10:110053641-110053663 GTGAAAATTAAGACTACTGATGG - Intronic
1074281478 10:112055753-112055775 CTTAAAAATGAGAAAACTGAGGG + Intergenic
1074716355 10:116223115-116223137 CTCAAAAATAAAAAATCAGAGGG + Intronic
1074856675 10:117479106-117479128 CAGAAAAAAAAAAAATCTGAGGG - Intergenic
1075361252 10:121836825-121836847 AAGAAAAAGAAGAAAGCTGAAGG + Intronic
1075392490 10:122102485-122102507 GTGAAAAATAAACTATTTGATGG - Intronic
1075476727 10:122741798-122741820 GTGAACAATAAGTAACTTGAGGG - Intergenic
1075599607 10:123757860-123757882 GTGAAAATTAAGTAACCTAATGG - Intronic
1075971300 10:126655932-126655954 GTAAAATATACCAAATCTGAAGG - Intronic
1076965137 11:76801-76823 GTGCAAAGAAAGACATCTGAGGG - Intergenic
1077833867 11:5906029-5906051 GCAAAAAATAACAAATCTGAAGG - Intronic
1077941643 11:6849260-6849282 GAGAAAAACATGAGATCTGAGGG + Intergenic
1077941655 11:6849333-6849355 GAGAAAAACATGAGATCTGAGGG - Intergenic
1078245453 11:9570190-9570212 GGGAAAAATAGGAAGTGTGATGG + Intergenic
1078945201 11:16058721-16058743 GTGAAAATCAGGAAATCTGCAGG - Intronic
1079247996 11:18767281-18767303 TTGAAAAAGAAGATATCAGAGGG - Intronic
1079276961 11:19049089-19049111 GAGAAAAAGAACAAAGCTGAAGG + Intergenic
1079521028 11:21327339-21327361 GTATAAAAAAAAAAATCTGATGG + Intronic
1079693456 11:23448950-23448972 ATCAAAAATAAGAAATTTCAGGG + Intergenic
1080439540 11:32278737-32278759 GGGAAAAATAAGAAACACGATGG + Intergenic
1080622675 11:33999890-33999912 ATTTCAAATAAGAAATCTGAAGG + Intergenic
1080978332 11:37369129-37369151 GTCAAAAAGAACAAATCTGGAGG + Intergenic
1081064053 11:38518036-38518058 GAGAAAAACAAGAAAAATGAAGG + Intergenic
1081107748 11:39093175-39093197 TTGAAAAATTAAAGATCTGAAGG + Intergenic
1081777979 11:45689450-45689472 TTGACAAATGAGAAAACTGAAGG + Intergenic
1083914595 11:65732704-65732726 GAGCAAAATAACAAATCTGGAGG + Intergenic
1084909158 11:72373586-72373608 GGGAAAAATAAAAAAGCAGAGGG - Intronic
1085327407 11:75617629-75617651 GTGCAAAATAAGAAAACTTACGG + Intronic
1085371169 11:76007009-76007031 TTGAAAAAAAAGAAATGTAAAGG - Intronic
1086041836 11:82488313-82488335 GTGAAAAATGAGAAATTACAAGG + Intergenic
1086051548 11:82597595-82597617 TTAACAAATAAGAAAGCTGAGGG + Intergenic
1086163237 11:83746944-83746966 GTAAGAGATAAGAAATCTTATGG - Intronic
1086274115 11:85104745-85104767 TTGAAAAACAAAAAAACTGATGG + Intronic
1086277149 11:85144924-85144946 ACAAACAATAAGAAATCTGAAGG - Intronic
1086284687 11:85233390-85233412 GTGAAAAATGAGGGATCTTAGGG - Intronic
1086297961 11:85392523-85392545 ATGAAAAAGAACAAATCTGGAGG + Intronic
1086543058 11:87935425-87935447 GTGAAAAAGAAGTCTTCTGAAGG - Intergenic
1087488447 11:98789991-98790013 GTGAAAAGTGAGAAATGTCATGG - Intergenic
1088238878 11:107753622-107753644 GTGAATCATTAGAAATCTCATGG - Intergenic
1088657577 11:112015284-112015306 GTTTAAAATAAGGAATATGAAGG - Intronic
1088774169 11:113066214-113066236 GTGAGAAAAAAAAAATCTGTAGG + Intronic
1088878797 11:113957659-113957681 GTGAAACATAAGACATCAGGTGG + Intergenic
1089357521 11:117864149-117864171 CTGAAAAAGAACAAAGCTGAAGG + Intronic
1089483681 11:118828259-118828281 GTAAAAAAGAAGAAAACAGAAGG + Intergenic
1090122751 11:124049953-124049975 GTGAAGAATAAGAGAGATGATGG - Intergenic
1090499004 11:127243460-127243482 GTGAAAAGGAAGAAAGCTGGAGG + Intergenic
1090900518 11:131026762-131026784 GGGAAAAATAAGAAATCACTGGG + Intergenic
1090967160 11:131609046-131609068 GTTAAAAATAACAAAACTGGGGG + Intronic
1090995446 11:131861689-131861711 GTGAAATATCAGAAACCTCAGGG - Intronic
1091803609 12:3341030-3341052 ATTATAAATAAGAAATTTGAGGG - Intergenic
1092693453 12:11142397-11142419 TTAAAAAATAAGAAATTTGGAGG + Intronic
1092798819 12:12142380-12142402 GTGAAAAATAAGTAAGCTACTGG + Intronic
1093006792 12:14059838-14059860 GGGAACAAGAGGAAATCTGAAGG + Intergenic
1093287198 12:17279392-17279414 GAAAAAAATAACAAATCTGTGGG - Intergenic
1093445516 12:19252710-19252732 TAGAAAAAAATGAAATCTGAAGG - Intronic
1093563918 12:20578985-20579007 GAGAAAAAAAATAAAACTGATGG - Intronic
1093606199 12:21091936-21091958 GTGTCATATAAAAAATCTGATGG + Intronic
1094332477 12:29310063-29310085 TAGAAAAATCAGAAATCGGAAGG - Intronic
1094390468 12:29944036-29944058 GGGAGAAATAAATAATCTGAAGG + Intergenic
1095308612 12:40667820-40667842 GTGAAATATAAGATACCTGGAGG + Intergenic
1095397923 12:41781626-41781648 TTAAAAAATTAGAAATTTGATGG + Intergenic
1095408873 12:41900271-41900293 GGCAAAAAGAAGAAATCTGGAGG + Intergenic
1096190951 12:49618754-49618776 GAGAAAAATAAGAAATTAGAAGG + Intronic
1096764791 12:53876121-53876143 ATAAATAATAAGAAAGCTGAAGG + Intergenic
1096943939 12:55382840-55382862 GTGCATATTAGGAAATCTGATGG + Intergenic
1097002692 12:55891162-55891184 GAAAAAAATAAGAAATATAAGGG + Intergenic
1098001171 12:65945032-65945054 GTAAAAAAAAAAAAATCTTAGGG - Intronic
1098172391 12:67759977-67759999 GTGAAAAGTAAGAAACCAGTAGG - Intergenic
1098767732 12:74510845-74510867 GTGAAGAATAAAAGAGCTGATGG - Intergenic
1099057425 12:77861711-77861733 TTGAAAAAACAGAAATCTTAGGG + Intronic
1099988804 12:89700671-89700693 GAAAATAAAAAGAAATCTGAAGG - Intronic
1100249861 12:92807969-92807991 TTGAAAAATAATAAAGGTGAAGG + Intronic
1100518545 12:95351612-95351634 GAGAAAAAGAAGCAATCTAAAGG + Intergenic
1100925370 12:99540570-99540592 GTGCCAAAGAAGAATTCTGAAGG + Intronic
1100958747 12:99938859-99938881 GGTAAAAATGAGAAATTTGAAGG + Intronic
1102181433 12:110915514-110915536 GAGAAAAAAAAGATATCTGAAGG + Intronic
1102457633 12:113080542-113080564 AAGAAAAAAAAGAAATCAGAAGG + Intronic
1102893630 12:116581090-116581112 GTGAGAAGTGAGAGATCTGATGG + Intergenic
1104271970 12:127290366-127290388 GTGTAAAATAATAAAGTTGAGGG + Intergenic
1104607025 12:130197647-130197669 GTGAAGACTAACATATCTGAAGG + Intergenic
1104708250 12:130965068-130965090 ATAAAAAATAATAATTCTGAGGG - Intronic
1104855691 12:131901539-131901561 GTGAAGAATGAGAAAGCAGAGGG - Intronic
1105670825 13:22613240-22613262 GAGAAAAAGAACAAAGCTGAAGG - Intergenic
1106755235 13:32815748-32815770 GCGAATATTAAGAGATCTGAAGG + Intergenic
1106846539 13:33743474-33743496 CTAACAAATCAGAAATCTGAGGG + Intergenic
1107671680 13:42752778-42752800 GTCACAAATAAGAAAGCTGAGGG + Intergenic
1107956098 13:45512981-45513003 GGGAAAAAAAAAAAATCTCAGGG - Intronic
1108120753 13:47183489-47183511 CTGAACAATTAGATATCTGAAGG + Intergenic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1108533827 13:51352049-51352071 TTGAAAAAGAAGAAAGTTGAAGG - Intronic
1108597818 13:51964685-51964707 GTAAATAATAAATAATCTGAGGG - Intronic
1108619043 13:52163140-52163162 CTAAAAAATAAGAAATTTGGAGG - Intergenic
1109210019 13:59524460-59524482 GTATAAAATAAAAATTCTGAAGG + Intergenic
1109340888 13:61056977-61056999 TTCAAAAATAAGAAAACTCAAGG - Intergenic
1109412390 13:61988021-61988043 CTTAAAAATAAGAAATCTGGTGG - Intergenic
1109522103 13:63526835-63526857 GAGAAAAATAATAAATAAGAAGG + Intergenic
1109595225 13:64544140-64544162 GTGACAAATAAAGAATCTGATGG + Intergenic
1109762718 13:66850708-66850730 ATGGAAAATAACAAATATGAGGG - Intronic
1109979999 13:69895243-69895265 GGGAAAAATAAGAAAACAAAGGG - Intronic
1110279529 13:73676655-73676677 GGGAACTATAAGAAATCTAATGG + Intergenic
1110670591 13:78172679-78172701 GTGTAAAGTTAGAAATTTGACGG + Intergenic
1110962347 13:81643448-81643470 TTGAAAAGTAAGAAATGTGAAGG + Intergenic
1110994264 13:82085779-82085801 GTGCAAAATTAGAAATCTGTAGG - Intergenic
1111188442 13:84775753-84775775 GTGCAAAGTAACAAATTTGAGGG + Intergenic
1111440565 13:88278750-88278772 ATGTAAAATAAGATATTTGAGGG + Intergenic
1111461525 13:88549276-88549298 GGTAAAATTAAGAAATCTGTGGG - Intergenic
1111520334 13:89394081-89394103 GTGAAAAATAAGAGATCACAGGG - Intergenic
1112070372 13:95843904-95843926 TTGAAAAATAAGAAAGTTAAAGG - Intronic
1112077841 13:95932001-95932023 AAGAAAAAGAACAAATCTGAAGG - Intronic
1112416663 13:99208685-99208707 GTCAGACACAAGAAATCTGAGGG - Intronic
1112510817 13:100007597-100007619 CTGAAAAATATGATATCTAAAGG + Intergenic
1112640296 13:101266271-101266293 GTGTAACATAAGAAATCAGGTGG + Intronic
1113031236 13:105996173-105996195 TTGAAAAATAAGCAATATGATGG - Intergenic
1113146184 13:107210332-107210354 GTGTGAAAGAAGAAATCTGATGG - Intronic
1113314596 13:109165379-109165401 CTGGAAACTAAGAAATGTGAAGG + Intronic
1113470498 13:110541577-110541599 CTGAAAAATGAGAAGTCAGAAGG - Intronic
1114173144 14:20294797-20294819 GTGAGAAAAAAGAAATGTAAAGG - Intronic
1114404940 14:22447860-22447882 GAGAAAAATAAGAAATGTTATGG - Intergenic
1114768296 14:25399768-25399790 GTGAAATAAAATAAATTTGAGGG + Intergenic
1115016204 14:28617245-28617267 GTGAAATATAAGAGATATTAAGG - Intergenic
1115570158 14:34658916-34658938 GAGACAAAGAAGAAATCAGAGGG - Intergenic
1115735532 14:36324299-36324321 TTGATAAATAAGAATTCTCAAGG + Intergenic
1115854936 14:37621227-37621249 CTGAAAAAAAAGAAAAATGAAGG - Intronic
1115947944 14:38684728-38684750 GTATAAAATTAGAAATCAGAGGG + Intergenic
1116147238 14:41089802-41089824 AAGAAAAAGAACAAATCTGAAGG - Intergenic
1116213211 14:41974490-41974512 GTGAAAAACAAAAAATGTAATGG - Intergenic
1116225071 14:42140110-42140132 GAGAAAAGTATGGAATCTGAGGG - Intergenic
1116298832 14:43149718-43149740 CTGACAAATATGAAATCTGTAGG - Intergenic
1116530357 14:45965293-45965315 GTGACAAATTAGGAAACTGAGGG - Intergenic
1116598287 14:46882745-46882767 GAGAAAAATAAAAAATCACAAGG + Intronic
1117599087 14:57355092-57355114 GTGAAAGTTCAGAAATCTTATGG + Intergenic
1117818096 14:59619238-59619260 GCCAAAAACAGGAAATCTGAGGG + Intronic
1121805247 14:96813763-96813785 GTGCAAAACAAGAAGTCTTAAGG - Intronic
1122309789 14:100787310-100787332 GTGATAAATGAGAAGTCAGATGG - Intergenic
1123691493 15:22842037-22842059 GTAAAAAATAAAACATGTGAAGG - Intronic
1124069796 15:26380702-26380724 GGGAAACATAAGAAAGGTGAAGG - Intergenic
1124987446 15:34635006-34635028 ATTAAAACTAAGAATTCTGAAGG - Intergenic
1125088615 15:35763183-35763205 CTGAAAAAGATGAAATCTCATGG + Intergenic
1125306693 15:38325337-38325359 GTGCATAATAAGACATCTTAAGG - Intronic
1125315360 15:38425681-38425703 CTGTAAAATAATAAATCTGAGGG + Intergenic
1126246771 15:46516024-46516046 TTAAAAATTAAGAGATCTGAAGG - Intergenic
1126833188 15:52631301-52631323 GTGAAAAATAAGCACTGTGCTGG + Intronic
1127050134 15:55074098-55074120 TAGAAAAATAATAAAGCTGAAGG + Intergenic
1127136910 15:55933678-55933700 GTATAAAAAAAAAAATCTGATGG + Intronic
1127272044 15:57410251-57410273 ATGTAAAATGAGAAAACTGAAGG - Intronic
1127317029 15:57806715-57806737 TTGCAAAATAAGAAATAAGATGG + Intergenic
1127502152 15:59564059-59564081 TTGAAAAAGAAGAAAGTTGAAGG - Intergenic
1127598794 15:60514338-60514360 CTGAAATATCAAAAATCTGAAGG + Intronic
1127771082 15:62231218-62231240 AAGAAAAAAAAGAAAGCTGACGG + Intergenic
1128043476 15:64595911-64595933 GAGAAAAATAAGAGCTATGATGG - Intronic
1129948701 15:79564718-79564740 TTAAAAAATAAGAAGACTGAGGG + Intergenic
1130165328 15:81450841-81450863 GAGAAAAAGAACAAAGCTGAAGG + Intergenic
1130569738 15:85031186-85031208 CTGCCAAATAAGAAATGTGATGG - Intronic
1130573198 15:85067413-85067435 GTGAATAATAAGAATTATTAAGG + Intronic
1130793723 15:87186291-87186313 TTGAAAAAGAACAAATTTGAAGG + Intergenic
1130936438 15:88474773-88474795 GAATAACATAAGAAATCTGATGG - Intronic
1131329460 15:91483435-91483457 AGCAAAAATAAGAAATCTGGAGG - Intergenic
1131652589 15:94417289-94417311 GATAAAAATAAAAAATTTGATGG - Intronic
1131685576 15:94764067-94764089 GTGGAAAATAAAAAACATGATGG - Intergenic
1131706864 15:95006164-95006186 AAAAAAAAAAAGAAATCTGAAGG - Intergenic
1132905731 16:2281757-2281779 GAGAAAAATCATAAATCTGCTGG + Intronic
1133109314 16:3536465-3536487 GTGGAAAAAAATAAATCTTAGGG - Exonic
1134140477 16:11714039-11714061 CTCAAAAAAAAAAAATCTGAAGG - Intronic
1134226943 16:12398672-12398694 GTGAGAAAAAACACATCTGAGGG - Intronic
1134677193 16:16098990-16099012 GTGAAAACACAGACATCTGACGG - Intronic
1135700616 16:24629238-24629260 GTTAAAAATGACAAAGCTGAAGG - Intergenic
1136632657 16:31498043-31498065 GGGAAAAATAACAGAACTGAAGG + Intronic
1137050067 16:35702624-35702646 AAAAAAAATAAAAAATCTGAAGG - Intergenic
1137541501 16:49365289-49365311 CTGAAAAGAAAGAAATCTCAAGG - Intergenic
1137661367 16:50209786-50209808 GCTAAAAATAAAAAATCAGAAGG + Intronic
1137981131 16:53070935-53070957 ATGAAAAAGAACAAATCTGGAGG - Intronic
1138671267 16:58616632-58616654 ATGAAAAATAAGCACTATGATGG - Intronic
1138963329 16:62053285-62053307 GTTAAAAGTAAGATTTCTGAAGG - Intergenic
1140234107 16:73143072-73143094 GTTAAAAAAAAAAAATCTGTTGG - Intronic
1140336007 16:74105778-74105800 GTGGAAAATGAGAAAAATGAAGG + Intergenic
1143257406 17:5571801-5571823 GTAAAAAATAACAAATCTGGAGG + Intronic
1144492865 17:15729881-15729903 ATGAAAAATAAGCCACCTGAAGG + Intergenic
1144907388 17:18646778-18646800 ATGAAAAATAAGTCACCTGAAGG - Intronic
1146132896 17:30293810-30293832 GTGTAAAAAAAGAAACCTGGTGG + Intergenic
1146470266 17:33118654-33118676 GTGCAAAATAAGAAGTTTGGAGG - Intronic
1146822693 17:35997379-35997401 GAGAAAAATAAGAATTGTTATGG + Intronic
1147033790 17:37664193-37664215 GTGAAAAATATAAAGACTGATGG - Intergenic
1147509310 17:41053559-41053581 GTAAATAAAAAGAAAACTGAAGG - Intergenic
1147576461 17:41602867-41602889 GTCAAGCATAAGGAATCTGAAGG + Intergenic
1148002899 17:44400401-44400423 GTGAAAATTAATAGTTCTGATGG + Exonic
1149046114 17:52247267-52247289 GAGAAAAATAAGATATGTAAAGG + Intergenic
1149047260 17:52261481-52261503 ATGAAAAAGAACAAATCTGAAGG - Intergenic
1149408433 17:56378806-56378828 GGGAAAAATAACAAGTCTGCTGG + Intronic
1150490011 17:65567898-65567920 GAGCAAAATAAGATATCAGAAGG - Intronic
1150663834 17:67111313-67111335 GTGAAAAATAAAATATAAGATGG + Intronic
1150947084 17:69759572-69759594 GGGAAAAAAGAGAAATCTGGAGG - Intergenic
1151780508 17:76241885-76241907 ATGAAAAATACGAAATGTGCCGG - Intergenic
1153395841 18:4619667-4619689 TTAAAAAAAAAAAAATCTGAAGG - Intergenic
1153481550 18:5552195-5552217 GTGAGAATCAACAAATCTGATGG - Intronic
1153695160 18:7632922-7632944 GTGCAGCATCAGAAATCTGATGG - Intronic
1155426407 18:25711967-25711989 GTGAAAGATAACAAATATTATGG - Intergenic
1155437996 18:25833187-25833209 GTGAAAAAAAAGAGGCCTGAGGG + Intergenic
1156075866 18:33278724-33278746 GTGAAGTACAAGAAATCTGCTGG + Intronic
1156618586 18:38820710-38820732 GTGAAAAAGAACAAAACTGTAGG + Intergenic
1157505926 18:48226511-48226533 TTCAAAAATGAGAAAACTGAGGG + Intronic
1158098316 18:53800761-53800783 GTTAAAGATAAGAAAACTAAAGG + Intergenic
1158363279 18:56700984-56701006 AAGAAAATTAAAAAATCTGAAGG + Intronic
1158490269 18:57903563-57903585 ATGCAAAATAAAAAGTCTGAAGG - Intergenic
1158807782 18:60995728-60995750 GAGACAAATATGAAATCTGTAGG + Intergenic
1159573763 18:70150257-70150279 GTAAAAAATTAGAAATATTAAGG - Intronic
1159664005 18:71134629-71134651 CTGAAAACCACGAAATCTGAAGG - Intergenic
1159685559 18:71414743-71414765 GAAAAAAATCAGTAATCTGATGG + Intergenic
1159969782 18:74635211-74635233 GTGAAAAAGAAGAAATCTGAGGG + Exonic
1159972200 18:74668359-74668381 GGAAAACATATGAAATCTGAAGG + Intronic
1160008338 18:75085160-75085182 TTGAAAAATGGGAAATCCGAGGG - Intergenic
1160641942 19:146431-146453 GTGCAAAGAAAGACATCTGAGGG - Intergenic
1162257915 19:9507653-9507675 TTGAAAAATATCAACTCTGAGGG - Intergenic
1162355467 19:10181085-10181107 GTGAAAAATGGGAAAGCTGGAGG + Intronic
1162758695 19:12875381-12875403 ATAAAAAATAAAAAATCTAAGGG - Exonic
1163199452 19:15754173-15754195 GAGAAAAAGAACAAACCTGAAGG - Intergenic
1163422741 19:17223635-17223657 AAGAAAAATAAGAAATGAGAAGG + Intergenic
1163532079 19:17855878-17855900 GTGAAAATTCGGAAAACTGATGG - Intergenic
1164365180 19:27572317-27572339 GTGAAAAAGAAGATATCTTCAGG + Intergenic
1165066013 19:33228560-33228582 GTGAAGAAGAACAAATCTGGAGG + Intergenic
1165142436 19:33708664-33708686 TTGAAAAAGAACAAAGCTGAAGG - Intronic
1165670670 19:37676101-37676123 GTGAAGAACAAGAAATATGAAGG + Intronic
1166576310 19:43841731-43841753 TTCAAAAATAAGAAAGATGAAGG - Intronic
1166880965 19:45929690-45929712 GAAAACAAAAAGAAATCTGAGGG - Intergenic
1167767519 19:51493553-51493575 GTGCAAAAAAAGAGATCTGGGGG - Intronic
1167867517 19:52340220-52340242 GTGAAAAATAAAAAATTAGCTGG + Intronic
1168086269 19:54049639-54049661 GAGAAAGATATGAAATCTAATGG - Intronic
1168256838 19:55171379-55171401 GAGAAAAATTAAAAATCTCATGG + Exonic
925842242 2:8003434-8003456 GTAAGAAAGAAAAAATCTGATGG - Intergenic
925923774 2:8656085-8656107 GTGATAAATCAGAAATTTCAGGG + Intergenic
926546118 2:14242455-14242477 GAGTAAAATAAGAAAACTGATGG + Intergenic
927827926 2:26322305-26322327 AAGAAAAAAAAGAAAGCTGATGG + Intronic
929261312 2:39869551-39869573 GTGAAAAAAAACAAGTCTCATGG - Intergenic
929428719 2:41869517-41869539 GTGAAATGGAAGAAATATGAGGG + Intergenic
929948052 2:46385227-46385249 TTGGAAAAAAAGAAATGTGAAGG + Exonic
930164755 2:48194197-48194219 GTGTAAAATAAGAAAACAGAGGG + Intergenic
930288611 2:49465943-49465965 ATGAGCAATAAGAAATCTGAAGG - Intergenic
930820484 2:55641656-55641678 GTGAAAAATAAGAAATGGGATGG - Intronic
931077056 2:58727111-58727133 ATAAAAAATAAAAAAACTGAAGG - Intergenic
931273045 2:60719478-60719500 GAGAAAAAAAAGAAATGTCAGGG + Intergenic
931372467 2:61676615-61676637 ATGCAAAATAAGGAAACTGATGG - Intergenic
931680533 2:64744139-64744161 GTGAAAAGAAAAAAATCTGTGGG + Intronic
932430184 2:71669370-71669392 GTGCAGAAAAAGAAATCTGGTGG - Intronic
932652100 2:73569313-73569335 GTAGAAAATAAGCAAGCTGAAGG - Intronic
932846923 2:75144928-75144950 GTAAAATATAAGAGATATGAGGG + Intronic
933464367 2:82633683-82633705 GTGAAAAATAAGAGATAGTAGGG - Intergenic
933505837 2:83176271-83176293 GTGAAGAACAAGAAATCAGAGGG - Intergenic
933527372 2:83458972-83458994 ATGAAAAAGAGAAAATCTGAGGG - Intergenic
933528820 2:83479041-83479063 ATGAAAAATGAGAAAATTGAGGG - Intergenic
933538837 2:83613124-83613146 GTAAAAAATAACAAAACTGCTGG - Intergenic
933569146 2:83988647-83988669 TTGAAAAATAACAAATTTGGAGG - Intergenic
934506872 2:94901890-94901912 GTCAAATAGAAGAAATGTGATGG - Intergenic
934707756 2:96496734-96496756 GGGAAAAATAAGACATTTAAAGG + Intergenic
934934460 2:98454605-98454627 GTGAAAAATAAGAGTACTGTGGG - Intronic
935410313 2:102755257-102755279 TTGTAAAATCAGATATCTGAAGG - Intronic
935458885 2:103304330-103304352 GTGAGAAATGAGAAATTTTAAGG - Intergenic
935475502 2:103516317-103516339 GTCAAAAAGAAGAAATTTGAAGG - Intergenic
935813170 2:106819646-106819668 ATGAGCAATAAGAAATCTGAAGG + Intronic
935894253 2:107717056-107717078 ATGAGAAAAAAGAAACCTGAAGG - Intergenic
935952236 2:108340723-108340745 ATGAAAAAGAACAAAGCTGAAGG - Intergenic
936289766 2:111213356-111213378 GGGTAAAATAAGAAATCAAAAGG - Intergenic
936796364 2:116209315-116209337 TTGAAAAATAAAAAATTTGGAGG - Intergenic
937715986 2:125033269-125033291 GAGAAAAAGAAGAAATCTGGAGG - Intergenic
938514880 2:131993211-131993233 GAGAAAACTTAGAAATATGAAGG - Intergenic
939575797 2:143893245-143893267 GTGAAGAGGAAGAAATCTGAAGG + Intergenic
939591357 2:144067454-144067476 GAGGACAATAAGAAATTTGATGG + Intronic
939654533 2:144807528-144807550 GTGAAATAAATGAAATCAGATGG - Intergenic
940074950 2:149731432-149731454 GGGAAAAAAAGGAAACCTGAAGG + Intergenic
940550694 2:155152235-155152257 TTCAAAAATGACAAATCTGATGG - Intergenic
940766965 2:157800156-157800178 GTGAAACATCAGGAATGTGATGG + Intronic
940832032 2:158477432-158477454 TTGACAAATAAGAAATTAGAAGG + Intronic
941545509 2:166845653-166845675 GAGCAAGATAATAAATCTGAGGG + Intergenic
941593580 2:167449035-167449057 AGCAAAAATAACAAATCTGAAGG - Intergenic
942198092 2:173542835-173542857 TTAAAAAAAAAGAAATTTGATGG + Intergenic
942782443 2:179661117-179661139 GTTAAAAATAGGAAAACTGAGGG + Intronic
942851514 2:180493472-180493494 GAAAAAAATAACAAAGCTGAAGG - Intergenic
942872483 2:180751983-180752005 GGAAAAAATAACTAATCTGAAGG - Intergenic
943469624 2:188277406-188277428 CTGAAATAGAAGAAAACTGAGGG + Intergenic
945030236 2:205656456-205656478 ATGTAAAATATGAAATCTGTTGG + Intergenic
945134883 2:206616511-206616533 GGGAAAAATAAGAACTTTGCAGG + Intronic
945891797 2:215437220-215437242 TTGAAATATAAAAAATCTGGCGG - Intergenic
947043087 2:225947031-225947053 AAGAAAAATAAGAAATGAGAAGG + Intergenic
947064244 2:226202648-226202670 CTGAAAAATAAGAAATTTGTTGG + Intergenic
947275153 2:228382732-228382754 GTGAAAAAATAGAAATTTGTAGG + Intergenic
947487935 2:230569636-230569658 ATGAAAAATGAAAAATGTGAAGG + Intergenic
947679222 2:232014559-232014581 GTGAAAAATAAGGAATCCTGCGG - Intronic
948719210 2:239887209-239887231 GTGTAAAAGAAGAAATCAAAAGG + Intergenic
1168754634 20:307893-307915 ATAAAAAATAAGAACTTTGATGG + Intergenic
1169118058 20:3079632-3079654 GTGAAAAATATGAAATCTTTTGG + Intergenic
1169390823 20:5189597-5189619 GTGAGAAGTATGAAATCTAATGG - Intronic
1169421947 20:5467448-5467470 TTAAAAAATAAGAAATGGGAGGG - Intergenic
1169662146 20:7991413-7991435 TGAAAAAATCAGAAATCTGAAGG - Intronic
1169823227 20:9736948-9736970 GTTTCTAATAAGAAATCTGATGG - Intronic
1169865480 20:10195457-10195479 TTTACAAATAAGAAATTTGAGGG + Intergenic
1170401855 20:15994765-15994787 CTGAAAAATAATAAATATGGAGG - Intronic
1170865865 20:20157028-20157050 TTGAAAAATAACAAAGCTGTAGG + Intronic
1171232961 20:23501842-23501864 ATTAAAAACAAGGAATCTGAAGG - Intergenic
1171511379 20:25687468-25687490 GTGAAAAGAAGGAAATGTGAAGG + Intronic
1171960442 20:31489887-31489909 GTGAAAAATAATAAAGCTGAAGG - Intergenic
1173927649 20:46792659-46792681 GTGAAAATTTAGATGTCTGAGGG - Intergenic
1174157564 20:48525952-48525974 ATGAAAAAAAAAAAATCAGAAGG - Intergenic
1174642807 20:52059784-52059806 TTTAAAACTAAGAAAACTGAGGG + Intronic
1174803511 20:53585548-53585570 CAAAAAAATAAGAAATATGATGG + Intronic
1177069191 21:16481454-16481476 AGCAAAAATAACAAATCTGAAGG - Intergenic
1177171513 21:17660971-17660993 GTGTAAAATAAGAAGTGTGGGGG + Intergenic
1177458969 21:21384461-21384483 GTGAAAAATAATAAATTTTCAGG - Intronic
1177584376 21:23070831-23070853 ATAAAAAATAAGAAATTTGTGGG + Intergenic
1179111099 21:38446005-38446027 ATTAAAAAAAAGAAATCTGAAGG + Intronic
1179432911 21:41336716-41336738 GCAAAAATTAAGAGATCTGAAGG - Intronic
1180024072 21:45148604-45148626 GTGAAAAATCAGGGCTCTGAGGG + Intronic
1181730292 22:24841191-24841213 GTGTCAAAGAAGAAATCTCAAGG - Intronic
1182237420 22:28886339-28886361 GTGAGAAATGAGAAAGCAGAAGG + Intronic
1184265933 22:43346044-43346066 GTGAAAAATAGGACAGCTGTGGG - Intergenic
1184382363 22:44153117-44153139 GCGGAAAATAAGAAATGTGTTGG - Intronic
949094834 3:73967-73989 GTGAAAAAGAAGGAACTTGAAGG + Intergenic
949214219 3:1545971-1545993 TTGAGAATTAAGAAATATGAGGG - Intergenic
949429081 3:3953577-3953599 ATGCAAAATAATAAATATGATGG - Intronic
949852616 3:8434157-8434179 GAGAAAAATAAGAAAACTGAGGG + Intergenic
949938742 3:9137140-9137162 GTAAATATTAAGAAATCTGTTGG + Intronic
950323832 3:12085425-12085447 GTGAATATTAAAAGATCTGAAGG + Intronic
950739395 3:15037873-15037895 ATGAAAAATCAGTAATCTCAAGG - Intronic
950985431 3:17359063-17359085 TATAAAAATAAGAAATTTGAGGG + Intronic
950987623 3:17392195-17392217 ATAAAAAATAAAAAATCTAAGGG - Intronic
951293021 3:20897686-20897708 TTGAAAAATAAGAAAAATGTAGG + Intergenic
951342344 3:21503746-21503768 ATGATAAAGAAGATATCTGATGG - Intronic
951471890 3:23065313-23065335 GTGAGAAATGTGAAATCTCAAGG + Intergenic
951504749 3:23430959-23430981 GTGAATCATAACAAATATGAGGG + Intronic
951699297 3:25478682-25478704 GAGAAAAAGAAGAAATCAGAAGG + Intronic
952121851 3:30254567-30254589 TTAAAAAAGAAGAAATCTGTAGG - Intergenic
952218445 3:31300750-31300772 GTGGAAAATAGGAAAGCTGATGG - Intergenic
952251221 3:31656922-31656944 GTGTCAAATAAGAAATCACAAGG + Intergenic
952341035 3:32447567-32447589 GTGAAAAATGAGAAAAATGAAGG - Intronic
952893884 3:38063951-38063973 TTTAAAAATAAGAAAGCAGATGG - Intronic
953062264 3:39437010-39437032 TTAAAAAATAAAAAATCTGTTGG + Intergenic
953468670 3:43147834-43147856 ATGAAAAAGAACAAATCTGGAGG - Intergenic
956889719 3:73600248-73600270 CTGAAAAAGAAGACATCTGGTGG + Intronic
957015850 3:75064257-75064279 AGGAAAAAGAAGAAATCTGGAGG - Intergenic
957155917 3:76543865-76543887 GCTAGAAATAAGAGATCTGAGGG - Intronic
957589993 3:82184350-82184372 CTGAAAAATCAGTAAACTGAAGG + Intergenic
958108183 3:89104774-89104796 GTGAAAAACAAGATTTCTGGAGG - Intergenic
958806337 3:98815349-98815371 GAGAAAAATAAGAAAACTGAAGG + Intronic
958855652 3:99381522-99381544 GTGAAAAACAACAAAGCTGGAGG + Intergenic
958926952 3:100169062-100169084 GTGACAAATCAGAAATCAGTAGG + Intronic
959210302 3:103370392-103370414 GTGAAGAATCTGAAATCTGGAGG - Intergenic
959335208 3:105055816-105055838 CTGAGAAATAAGAAAGCTGTTGG - Intergenic
959385000 3:105693099-105693121 GTGAGAAATGAGAAACCTGGTGG + Intronic
959632161 3:108518908-108518930 ATGAAACATAAGTAATCTGAGGG + Intronic
959678922 3:109070331-109070353 GAGAAAAATAAAGAATCGGAAGG + Intronic
959729377 3:109583618-109583640 TTGAACAATATGAAATCTGATGG + Intergenic
960058134 3:113290804-113290826 GGGAAAACTTAGAATTCTGACGG + Exonic
960211722 3:114976318-114976340 GTCAAAACAAAAAAATCTGAAGG + Intronic
960820649 3:121727179-121727201 CTAACAAATAAGAAATCTTAGGG + Intronic
960940591 3:122930479-122930501 GCCATAAATAAGAAATCTCAGGG + Intronic
961442203 3:126959797-126959819 GTGAAAAATCAGAGAACAGAGGG + Intronic
962023318 3:131522904-131522926 TTTACAAATAAGAAACCTGAAGG + Intergenic
962577105 3:136764559-136764581 AAGAAAAAAAAGAGATCTGATGG + Intergenic
962938408 3:140102944-140102966 TTGAAAGGTAAGAAAACTGAGGG - Intronic
963052763 3:141156580-141156602 GCCAAAAATAAGAAATTAGAAGG + Intergenic
963089784 3:141472200-141472222 GTGAAAAACAACAAAACTGGAGG - Intergenic
963190637 3:142468466-142468488 GTGAAAAATATGAAATTGTACGG + Intronic
963411527 3:144933396-144933418 GTGAGCAATAAGAAATCTGATGG + Intergenic
963498646 3:146097372-146097394 GAAAAAATTGAGAAATCTGATGG + Intronic
963546116 3:146660406-146660428 GGGAAAAAAAAGAAATCAAATGG + Intergenic
963703742 3:148659538-148659560 GAGAAAATTAAGAATTATGAAGG - Intergenic
963914337 3:150843883-150843905 TTTAAAAATGAGAAAGCTGAAGG + Intergenic
964103306 3:153013043-153013065 CTGAAAAATAAAAAAAATGAGGG + Intergenic
964306601 3:155347736-155347758 GTGAACAATATTAAATCTTAAGG + Intergenic
964555123 3:157928724-157928746 GTGAAAATCATGAAATCTCAGGG - Intergenic
965144591 3:164884810-164884832 TTTAAAAGTAAGAAATCTAAAGG - Intergenic
965272136 3:166630894-166630916 GTGAAGAAAAAGAAATCTTTAGG - Intergenic
965745790 3:171924491-171924513 GGCAAAAAGAACAAATCTGAAGG + Intronic
965770044 3:172172448-172172470 GTCCAAAATTACAAATCTGAGGG + Intronic
965992674 3:174839048-174839070 AGCAAAAAGAAGAAATCTGAAGG + Intronic
967508503 3:190281973-190281995 GTGAAAATTCAGAATTCTGAAGG + Intergenic
968534746 4:1116923-1116945 TTGAAAAATAAGAGCTGTGAGGG - Intergenic
969062200 4:4445883-4445905 CTGAAAATTTAGAAATTTGAAGG + Intronic
969894629 4:10291954-10291976 GAGAAAAATAAGCAATATGGGGG + Intergenic
969966267 4:10999985-11000007 TTGACAGATAAGAAAACTGAGGG + Intergenic
970379049 4:15488162-15488184 ATGAGCAATAAGAAATCTGAAGG - Intronic
970633052 4:17975303-17975325 GTGTAAAATAAGACATCATAAGG - Intronic
971952829 4:33377011-33377033 GTGAAAAAAAAGAAGTCGGTTGG + Intergenic
972091948 4:35297778-35297800 GTGGAAAATAACATATATGATGG - Intergenic
972116671 4:35644121-35644143 CTGAAGGATAAGAAATCAGATGG - Intergenic
973783121 4:54308965-54308987 GTGAAAAAGTAGAAAGCCGATGG + Intergenic
974252212 4:59401031-59401053 GTAAAACAAAAGAAAACTGAAGG - Intergenic
974325302 4:60406677-60406699 GAGAAAAATGAGAACTCAGAAGG - Intergenic
974435460 4:61852074-61852096 GTGGAAAATAGCAAAACTGAGGG + Intronic
974872769 4:67663348-67663370 TTAACAAATAAGAAACCTGAAGG + Intronic
975016437 4:69426579-69426601 AAGAAAAAGAAGAAATCTGTAGG - Intergenic
975103229 4:70538018-70538040 GTGATAGATAAGAAATGTGAGGG - Intergenic
976255029 4:83091207-83091229 GTAAAAACTGAGTAATCTGAAGG - Intronic
976620308 4:87120541-87120563 GTGAAAAAGAGGAAAGCTCACGG - Intronic
976776880 4:88716922-88716944 GTAATAAACAAGACATCTGAAGG - Intergenic
976869954 4:89779494-89779516 GCAAAAAATAACAAATCTGGAGG + Intronic
976929741 4:90551337-90551359 GGGCAAAATATGAAATATGAGGG - Intronic
977034925 4:91937962-91937984 GCGAATATTAACAAATCTGAAGG + Intergenic
977214064 4:94258142-94258164 AAGAAAAAAAAAAAATCTGATGG - Intronic
977352825 4:95910096-95910118 ATTAAAAATAAAAATTCTGATGG - Intergenic
977814039 4:101392763-101392785 GTGAAAAATAAAACATATAATGG - Intergenic
977879545 4:102188274-102188296 GAAAAAAATAAGGAATATGATGG - Intergenic
978262763 4:106781460-106781482 TTGAAAAAGAACAAATTTGAAGG - Intergenic
978727068 4:111981682-111981704 CTCACAAATAAGAAAACTGAAGG + Intergenic
979380656 4:120002682-120002704 GGGAAAAAGAAGAAATCTTGAGG - Intergenic
979570280 4:122215359-122215381 TTAAAAAATAAGAGATCTGTTGG + Intronic
979618403 4:122770412-122770434 GTGAAAAATTGGACATCAGAGGG - Intergenic
980345795 4:131616542-131616564 GTGTCAAATAAGAAATCCAAAGG - Intergenic
980669359 4:135983970-135983992 GTAAAAAATAATACATCTTAGGG - Intergenic
980838246 4:138224449-138224471 TTGAATAATAAGAATTCTGTAGG - Intronic
980995521 4:139776484-139776506 GTGAAAAATAACAAAGCTCCCGG + Intronic
981127811 4:141126823-141126845 TTTATAAATAAGAAAACTGAGGG + Intronic
981813747 4:148805128-148805150 ATGAAAAATAAAACATCTGTCGG - Intergenic
981844045 4:149146137-149146159 GTGAAAAAGAAACAACCTGAAGG - Intergenic
982145857 4:152390968-152390990 TGGAAACATAAAAAATCTGAAGG + Intronic
982634764 4:157880251-157880273 GTGATAAAAAAGAAATATGAAGG - Intergenic
983019368 4:162656201-162656223 GGGGAAAATAAGTAATTTGAAGG - Intergenic
983168009 4:164501037-164501059 GTGCAAAGTAAGAAGGCTGACGG - Intergenic
983290367 4:165795902-165795924 GAGAAAAATAATAAATATGAAGG - Intergenic
983426902 4:167596586-167596608 AAGTAAAATAAGAAATCTAAAGG - Intergenic
983637577 4:169914013-169914035 GTCAGAATTAAGAAATCTGTGGG + Intergenic
983803027 4:171959895-171959917 CTAAAAAATATGAAATATGAAGG - Intronic
984199826 4:176704589-176704611 GTGAAAAATAATAAAGATGGTGG - Intronic
984278991 4:177644637-177644659 GGAAAAAAAAAGAAATATGAAGG - Intergenic
984419586 4:179503101-179503123 TTGAAAAATAACAAATTTGGAGG - Intergenic
984560813 4:181267264-181267286 GTAAAAAAGAAAAACTCTGAAGG - Intergenic
984563399 4:181298121-181298143 GGCAAAAAGAACAAATCTGAAGG - Intergenic
984640020 4:182153624-182153646 GTGACAAATGAGAGATCTGAAGG + Intronic
987187691 5:15442163-15442185 GGGAAAAAAAAGTAATCAGAAGG - Intergenic
987419699 5:17704748-17704770 TTGAGAAATAAGAAATAAGAAGG - Intergenic
987831260 5:23098717-23098739 ATGAAAAATGAGAAATCCCAAGG + Intergenic
988077049 5:26366750-26366772 GAGAAATATAATAAATCTAAAGG - Intergenic
990250553 5:53910088-53910110 GTGAAAGTTAAGAATCCTGAGGG - Intronic
991209393 5:64087167-64087189 GTGAAAAAAAAAAAAATTGAGGG + Intergenic
992980372 5:82164635-82164657 GTTAAAAATGAGAAAACTGTGGG + Intronic
993371767 5:87101252-87101274 CTGAAAAATAACAAATATGCTGG + Intergenic
993380103 5:87197033-87197055 GTGAAAAAGATAAAATCTCAAGG - Intergenic
993463665 5:88217772-88217794 GTGAGACATTAAAAATCTGAAGG - Intronic
994217644 5:97157225-97157247 ATGAGCAATAAGAAATCTGAAGG - Intronic
994243437 5:97450617-97450639 GTGAAAAAGAAGAAGTGGGAAGG - Intergenic
994701493 5:103141030-103141052 GTTAAAAATAAGAAATCATCTGG + Intronic
994713106 5:103290111-103290133 TTGAAAAATAAGCAATTTCAGGG - Intergenic
994868540 5:105313294-105313316 TTGAAAAAGAAGAAAGTTGAAGG - Intergenic
994955341 5:106523957-106523979 GTGAAAAATAAGAAATATCCTGG + Intergenic
995087637 5:108132958-108132980 GGGAAAAATAAGAATTTTAAGGG + Intronic
995157973 5:108938409-108938431 GTGGAAAATAAGAAATGAGTTGG + Intronic
995284666 5:110374107-110374129 ATGAAAAATAACAAAACTGGAGG - Intronic
995522538 5:113024590-113024612 ATTCAAAATACGAAATCTGAAGG + Intronic
996506682 5:124275896-124275918 GTAGAAAATAAGGAAACTGATGG + Intergenic
996718993 5:126611820-126611842 GGGAAAAGAAAGAAATCAGATGG + Intronic
997075959 5:130677409-130677431 GAAAACAATAAGAAATCAGAAGG + Intergenic
997101420 5:130973294-130973316 GTGAAAAAGAATAAAACTAATGG - Intergenic
998289957 5:140905472-140905494 AACAAAAAGAAGAAATCTGAAGG - Intronic
998706262 5:144765196-144765218 TTCAAAAATAAAAATTCTGATGG + Intergenic
998964443 5:147524068-147524090 GTCATAATTAAGAAAACTGAGGG + Intergenic
999124698 5:149238556-149238578 GTGAAACAAAACAAATCTGAGGG - Intronic
1000485330 5:161835031-161835053 GTGAAAAATCAGATATTAGATGG + Intergenic
1000759902 5:165209674-165209696 GTGAAAAATGAATAATCTCATGG + Intergenic
1000859674 5:166441119-166441141 TTGAAAAATAAGAAAATTGGAGG - Intergenic
1000912003 5:167033965-167033987 GGGAAAAATAAAAAATCTCTGGG - Intergenic
1002395928 5:178954367-178954389 GAGAAAAAGAAAAAAACTGAAGG - Intronic
1002734917 5:181378053-181378075 GTGCAAAGAAAGACATCTGAGGG + Intergenic
1002749609 6:96069-96091 GTGCAAAGAAAGACATCTGAGGG - Intergenic
1002861346 6:1082239-1082261 GTGACAGGCAAGAAATCTGAAGG + Intergenic
1004084828 6:12436399-12436421 GTGAGAGATAACAAAACTGAAGG + Intergenic
1004678943 6:17873585-17873607 GAGGAAAATAAGAAATTTTATGG - Intronic
1004702652 6:18093412-18093434 GTGGAAAATAAGAATTGGGAGGG - Intergenic
1004833379 6:19501978-19502000 GTGAAAAATGAGGAATTTGATGG - Intergenic
1005089317 6:22040028-22040050 TTGAAAAAGAACAAAGCTGAAGG - Intergenic
1005212642 6:23485774-23485796 GTGACAAATAAGAAAAATTAGGG + Intergenic
1006963214 6:37955355-37955377 CTGAAAAATAGAAAATCTCAAGG + Intronic
1007048632 6:38802881-38802903 GTGAAAAGAAAGAAGGCTGAAGG - Intronic
1007205902 6:40150584-40150606 GTAAAGAATAAGAATACTGAAGG - Intergenic
1007852855 6:44822223-44822245 GTGCCAAATAAGATTTCTGAAGG + Intronic
1008133565 6:47746069-47746091 GTGATAAATAAGAGATATGCTGG + Intergenic
1008390474 6:50945453-50945475 TTTAGAAATAAGAAAACTGAGGG + Intergenic
1008443106 6:51555526-51555548 ATGAAAAAAAAGAAAACTGCAGG + Intergenic
1008534492 6:52497284-52497306 GTGAAAAATAATAGACATGAGGG + Intergenic
1008843323 6:55931180-55931202 ATGTAAAATAAGAAGTGTGAAGG - Intergenic
1009063977 6:58434061-58434083 GTGAAAAAGAAAATATCTTAAGG + Intergenic
1009759856 6:67991232-67991254 GTGAAGAATAACAAAGTTGAAGG + Intergenic
1009898625 6:69783870-69783892 ATTAAAAATAAAAAGTCTGAAGG + Intronic
1009984375 6:70765602-70765624 TTGAAAAACAACAAATATGATGG + Intronic
1010367516 6:75068670-75068692 CTGAAAAATAACAAAGCTGAAGG - Intergenic
1010392900 6:75357140-75357162 GTAAAAAATAAGAAATGAAAGGG - Intronic
1010499195 6:76574525-76574547 GTGAAAAATATGAAATAAAAAGG - Intergenic
1010579612 6:77578248-77578270 GTAAAAAATGAGAAAGCTGGGGG + Intergenic
1010733932 6:79420825-79420847 GTGGAAAATAAGAAAATTTAAGG - Intergenic
1010751619 6:79621815-79621837 GTGAGATATAAGAAGTCTGCTGG + Intergenic
1011118692 6:83926039-83926061 ATGAAAAACAACAAACCTGAGGG - Intronic
1011248725 6:85347855-85347877 GGGAAAAAAAAGGAATCTGCTGG - Intergenic
1011317035 6:86046029-86046051 GTGGAAAATAAGATATATAAAGG - Intergenic
1011460700 6:87600272-87600294 GTAAACAACAAGAAATATGAGGG + Intronic
1011703291 6:89975460-89975482 GAGAAACAAAAGAAAGCTGAGGG - Intronic
1011730816 6:90261456-90261478 GTGAAAAATAAGAAATGAGATGG - Intronic
1011928523 6:92678786-92678808 GTGAAAAATAACAAAGTTGAAGG + Intergenic
1011982425 6:93398589-93398611 GAAAAAAAAAAGAAATCAGATGG + Intronic
1012463411 6:99490159-99490181 TTAAAAAAGAAAAAATCTGAGGG - Intronic
1012484994 6:99711222-99711244 GTGAACAGTAAGAAAGCTGTAGG + Intergenic
1012692495 6:102332465-102332487 GAAAAATATAACAAATCTGAAGG - Intergenic
1012876420 6:104733854-104733876 GAGAAAAAAAAGAAATCAGCCGG + Intronic
1013193794 6:107827526-107827548 GTAAGAAAAAAGAAATTTGATGG + Intergenic
1014421807 6:121255546-121255568 ATGCAACATAAGAAATCTTATGG - Intronic
1014559928 6:122877167-122877189 GTGAAATCTAAGAAATCTAAGGG - Intergenic
1014667401 6:124256300-124256322 GTGAAAAATAAGATAGTTAAGGG + Intronic
1015668496 6:135659444-135659466 GTGAAACAAAAGAAATTTGGGGG + Intergenic
1015770943 6:136767739-136767761 TTGAAAAAGAAGAAAGCTGGAGG + Intronic
1015896635 6:138023737-138023759 GTGAAAAATAAGCAATTTGCCGG - Intergenic
1015946885 6:138511906-138511928 TTGAAAAGTAAGATATCTGAGGG + Intronic
1016274228 6:142329789-142329811 GAGAAGAATAAGATATCTTAAGG - Intronic
1016398779 6:143655910-143655932 GAGAAAAAGAAGAAAACAGACGG + Intronic
1016408469 6:143756758-143756780 ATTAAATATAAGAAATCTTATGG + Intronic
1017113417 6:150953618-150953640 GTGATACATAAGAAATGTGAAGG - Intronic
1017920879 6:158870807-158870829 GGAAAAAATAAGAAAAATGAAGG - Intronic
1018638639 6:165886571-165886593 TTGAACAAGAAGAAATCAGAAGG + Intronic
1019002407 6:168765748-168765770 GTGGAAAATTAGAAATCTTGAGG + Intergenic
1019239179 6:170650370-170650392 GTGCAAAGAAAGACATCTGAGGG + Intergenic
1019574056 7:1727768-1727790 GCAAAAAATAAGAAATCAGCTGG - Intronic
1020389077 7:7640004-7640026 GAGTAAACTAAGAAATCTGAAGG + Intronic
1020522810 7:9215374-9215396 GTGAAAAACAAGAAATATGGAGG - Intergenic
1020931224 7:14397678-14397700 GTGAAAAATAAGTAATCAAAAGG - Intronic
1021111520 7:16699755-16699777 GGTTAAAATGAGAAATCTGAAGG - Intronic
1021196285 7:17678125-17678147 GGGAAAAATAAAACAACTGAAGG + Intergenic
1021592443 7:22278331-22278353 GTAAAAAATCAGAAAACTTATGG - Intronic
1021838088 7:24700486-24700508 CTGAATTTTAAGAAATCTGAAGG + Intronic
1022248325 7:28582877-28582899 GGGAAAAACAAGATAACTGATGG + Intronic
1022814466 7:33901569-33901591 TTTAAAAATGAGAAATCTAAAGG - Intergenic
1023590314 7:41774529-41774551 CTTAAAAATAAGAAAACTGTTGG + Intergenic
1023849689 7:44143617-44143639 GCAGAAAACAAGAAATCTGAAGG + Intergenic
1024442460 7:49436391-49436413 ATGAAAAAGAACAAATCTGGAGG + Intergenic
1024781259 7:52852822-52852844 ATGAAAAACAAGAAATATGGAGG + Intergenic
1025195901 7:56933072-56933094 GTGAAAAATTAGAAATGTTGTGG - Intergenic
1025676047 7:63643864-63643886 GTGAAAAATTAGAAATGTTGTGG + Intergenic
1025957002 7:66190509-66190531 GTGATAAATAAGTAATCTGTTGG - Intergenic
1026455703 7:70570784-70570806 GTGAAAGACAAGAGATCAGATGG - Intronic
1027495447 7:78882201-78882223 TTAAAAAATAAAAAATCTCAAGG + Intronic
1027630785 7:80602726-80602748 AACATAAATAAGAAATCTGAAGG - Intronic
1027704728 7:81514797-81514819 TTGAAAAATATGCAGTCTGACGG - Intergenic
1027816996 7:82987879-82987901 GGGAAAAATAAGTAAAATGAAGG + Intronic
1027972526 7:85103619-85103641 GTGAAAAAGAAGAATTATGGTGG - Intronic
1028405628 7:90470747-90470769 GTTAAAAAAGAGAAATCTGTGGG - Intronic
1028826675 7:95281585-95281607 TTGAAAAGAAAAAAATCTGAAGG - Intronic
1029790044 7:102833261-102833283 GTAGAAGAAAAGAAATCTGAGGG + Intronic
1030122519 7:106123952-106123974 AAGAAAAATAAGAAAGCAGAGGG - Intergenic
1030215143 7:107037077-107037099 GAGAAAAATAAGAAAATTAAAGG - Intergenic
1030825012 7:114144661-114144683 GTGAAAAATAATAATTTTAAGGG - Intronic
1031568256 7:123326243-123326265 GTGAAGAGTCAGAAATCTTAAGG + Intergenic
1031593132 7:123618222-123618244 GGGAAGAATGGGAAATCTGAAGG + Intronic
1031867518 7:127054201-127054223 GTGAATAGTAAGAAATTTCAGGG - Intronic
1031921284 7:127602504-127602526 GTGAAAGGTAAGAAGTCTGCCGG - Intergenic
1032657178 7:133943717-133943739 TTGCAAAATAAGTCATCTGATGG - Intronic
1032676822 7:134137321-134137343 ATGAAAACTAAGAAATTTGGGGG - Intronic
1033021663 7:137731303-137731325 GAGACAAATAATAAATCTGTAGG - Intronic
1033229821 7:139588019-139588041 ACTAAAAATAAGAAATCTGCTGG + Intronic
1034220849 7:149445016-149445038 GGAAAGAATAAGAAAACTGAAGG - Intronic
1035508593 8:156238-156260 GTGCAAAGAAAGACATCTGAGGG - Intergenic
1035519160 8:263177-263199 GTGAAAATGATGAAATTTGAGGG + Intergenic
1035851847 8:2928015-2928037 GTTCTAAATAACAAATCTGAAGG - Intergenic
1035937451 8:3857405-3857427 GTGAAAAACAAAAACTGTGATGG + Intronic
1036042073 8:5096418-5096440 GTGCTAAAGAAGAAATCTCAAGG - Intergenic
1036960769 8:13242387-13242409 GAGAAAAAAAAAAAAACTGATGG - Intronic
1037326489 8:17696362-17696384 GTGGAAAATAAGAAACACGAGGG + Intronic
1037346782 8:17909473-17909495 GTAAAAAATTACAAATCTCAAGG - Intronic
1038574610 8:28694185-28694207 GGGAAAAATAAGCAATCAGTGGG + Intronic
1038852861 8:31297100-31297122 GATAAAGAAAAGAAATCTGAGGG + Intergenic
1038977243 8:32713560-32713582 GTAAACAAAAAAAAATCTGATGG - Intronic
1039192339 8:34990909-34990931 GAGAAAAGTAAGAAAGCTGCAGG + Intergenic
1039304189 8:36243291-36243313 TTGCAAAATAAAAAATCTCAAGG + Intergenic
1040064258 8:43132059-43132081 GTGAAAAATAACGAATTTGCAGG - Intergenic
1040086115 8:43344322-43344344 TTAAAAAAGAAGAAAACTGAAGG - Intergenic
1041520498 8:58750560-58750582 GTGTGAAATAAGAAATTTGATGG + Intergenic
1041756563 8:61319656-61319678 GTCAAAACTAAGAAATCTCCAGG - Intronic
1042626356 8:70762136-70762158 ATCAAAAATAACAAAGCTGAAGG - Intronic
1042899422 8:73707544-73707566 GTGAGCCATAAGAAATGTGATGG + Intronic
1043023650 8:75038765-75038787 GTGAAAGATAAGACAATTGATGG - Intergenic
1043314410 8:78902210-78902232 ATAAAAAATAAGAAAGGTGATGG + Intergenic
1044518734 8:93172844-93172866 GGGAATAATAAGAAATTAGAAGG + Intergenic
1044592671 8:93929441-93929463 GGGAAAAACAAGAAAAGTGAGGG + Intergenic
1044796242 8:95901288-95901310 GAAAAAAGAAAGAAATCTGAAGG + Intergenic
1045132302 8:99166764-99166786 TTGAAAAAGAACAAAGCTGAAGG + Intronic
1045313389 8:101023098-101023120 GTGATATATAAGATATTTGAAGG + Intergenic
1045602086 8:103729025-103729047 GTGAAAAACAAAAAAACTAAAGG - Intronic
1046465775 8:114601292-114601314 GTGAAATATAGGAAAGCTGTGGG + Intergenic
1046498099 8:115040253-115040275 TTGAAAAAGAAGAAATAAGATGG - Intergenic
1046776541 8:118169730-118169752 TTGAAAAATAAAAAAGATGAAGG + Intergenic
1046782422 8:118230002-118230024 ATTAAAAAAAAGAAAACTGAGGG + Intronic
1046844198 8:118897654-118897676 ATGAAAAAGAAGAAATGTTATGG + Intergenic
1047137405 8:122095933-122095955 GTGAAAAAAAAAAAGGCTGATGG + Intergenic
1050260507 9:3836515-3836537 CTGGAAAAGAAGAAATCTGAAGG - Intronic
1050685302 9:8162123-8162145 AAGAAAAAAAAGAAATCTAATGG - Intergenic
1050830860 9:10010474-10010496 GTGAAAAATGAGGAAAATGAGGG + Intronic
1050912863 9:11095978-11096000 GTGAAAAATATGCATACTGAGGG - Intergenic
1050968378 9:11837424-11837446 GTGACAAACATGTAATCTGAGGG + Intergenic
1051352405 9:16210128-16210150 TTGAAAAAGAAGAAAGCTGAAGG - Intronic
1051591598 9:18781314-18781336 CAGAAAAATAAAAAATGTGATGG - Intronic
1051812580 9:21066940-21066962 GTGAAAATAATGAAAGCTGAGGG + Intergenic
1051893346 9:21965389-21965411 GTGAAAAAAAAGAAGCCAGAGGG - Intronic
1052396122 9:27940465-27940487 GAGAAAAGTGAGAAACCTGAGGG - Intergenic
1052673838 9:31593916-31593938 GAAAAAAAAAAGAAATGTGAGGG - Intergenic
1053170499 9:35877085-35877107 TTGAATAATAACAAAGCTGAAGG - Intergenic
1053330388 9:37200675-37200697 GAGTCAAATAAGAAATTTGAGGG + Intronic
1054991608 9:71333927-71333949 GAGGAAAATAACACATCTGAAGG + Intronic
1055326425 9:75135548-75135570 GGAAAAATTAAGAAAACTGAAGG - Intronic
1055559602 9:77509691-77509713 GTGATTAATAAGTAATATGAAGG - Intronic
1058370820 9:104265481-104265503 GTGGAAAATGAGAAATCACAAGG + Intergenic
1058781869 9:108345464-108345486 TTAAAAAATAAGAAAGGTGAAGG + Intergenic
1058812848 9:108658060-108658082 GTAAATAATAAGAAATTTTAAGG + Intergenic
1059557393 9:115295025-115295047 ATGAAAGATAAAGAATCTGATGG - Intronic
1059777297 9:117488460-117488482 GGGAAAAATAACAATTCAGATGG + Intergenic
1060851688 9:126882292-126882314 GTAGAAAATGTGAAATCTGATGG + Exonic
1062759385 9:138330661-138330683 GTGCAAAGAAAGACATCTGAGGG + Intergenic
1203599834 Un_KI270748v1:1433-1455 GTGCAAAGAAAGACATCTGAGGG + Intergenic
1186254655 X:7705264-7705286 GAGAAATAAAAGAAATCTGTAGG + Intergenic
1187105952 X:16241976-16241998 GTGAAAAAAAGGAAAACTAATGG - Intergenic
1187570598 X:20496835-20496857 GAGAAAAATAAGAAGTCTAGAGG + Intergenic
1188487004 X:30692936-30692958 GTGATAAATAAGAATACAGATGG + Intronic
1188514390 X:30969397-30969419 ATGGAAAAAAAGAGATCTGAGGG - Intronic
1188571534 X:31591306-31591328 ATGAAAACTAAGATATCTGTGGG - Intronic
1188812432 X:34667358-34667380 GTAAAAAATAAGAAGACTGAAGG - Intergenic
1188891599 X:35618025-35618047 GTGAAACACAAGGAATTTGAGGG + Intergenic
1188953859 X:36410929-36410951 TTGAAAAATAAAAAAGTTGAAGG - Intergenic
1189028007 X:37418789-37418811 GTGAAAGCTAATTAATCTGAAGG - Intronic
1190246732 X:48695955-48695977 GTGAATGAGAAGTAATCTGAGGG + Intronic
1191081854 X:56520737-56520759 GTGAAAAATATAAAATGTCAAGG - Intergenic
1191806653 X:65142937-65142959 GTAAAAAAGAAAAAATCTGGAGG - Intergenic
1191892888 X:65962950-65962972 TTTAAAAATAAGTAATTTGAAGG - Intergenic
1191994156 X:67072659-67072681 GCCAAAAATAACAAATCTGGAGG + Intergenic
1192381771 X:70624638-70624660 GTGAGAAATAAGAAACCAGCAGG - Intronic
1192508372 X:71705249-71705271 GTGAAAAAGAACAAAGCTGGAGG - Intergenic
1192518324 X:71776304-71776326 GTGAAAAAGAACAAAGCTGGAGG + Intergenic
1192605957 X:72517825-72517847 TTGAAAAAGAACAAATTTGAAGG - Intronic
1192944690 X:75952913-75952935 ATTAAAAATAAAAAATCTGGAGG - Intergenic
1193175966 X:78393369-78393391 GGCAAAAAGAATAAATCTGAAGG + Intergenic
1193572393 X:83160616-83160638 GTGAAACCTAAGAAACCTAATGG + Intergenic
1193692545 X:84664835-84664857 TTTAAAAATAACAAATTTGAAGG - Intergenic
1193791473 X:85820380-85820402 GGTAAAAAGAACAAATCTGAAGG + Intergenic
1194117412 X:89920319-89920341 GTGACAAGTAAGAACTCTTAAGG + Intergenic
1194178217 X:90679129-90679151 TTTTAAAATAAGAAATATGAAGG + Intergenic
1194204265 X:90993591-90993613 TTGAAACATAAGACATATGATGG + Intergenic
1194424703 X:93722066-93722088 GCGAAGAATATGAAATGTGATGG - Intergenic
1194840296 X:98732348-98732370 ATAAAAAAAAAGAAATCAGAAGG - Intergenic
1194946676 X:100076483-100076505 GTAAAGAATAAGAAAACTGTGGG - Intergenic
1194995504 X:100587620-100587642 TTGAAAACTAAGAAATCAGCTGG + Intronic
1195039807 X:101003655-101003677 GTAATTAATAAGAAATCTGTGGG - Intergenic
1195419039 X:104653202-104653224 GTGAAAATAAAGTGATCTGATGG - Intronic
1196745208 X:119065650-119065672 GTAAAAAAAAAAAAATGTGATGG + Intergenic
1196752117 X:119127355-119127377 GAGAAAAATATGAAAGATGAGGG + Intronic
1197072679 X:122319305-122319327 GAGAAAAAAAAGAAAGCTGGAGG - Intergenic
1197372440 X:125641320-125641342 CTGAAAAATAGGGAAGCTGACGG + Intergenic
1198268957 X:135036052-135036074 ATGAAAAGTATGAAATCTGTTGG + Intergenic
1198430587 X:136562809-136562831 ATGAGCAATAAGAAGTCTGAAGG - Intergenic
1198496437 X:137197983-137198005 AAGAAAAAAAAGAAATCTCAAGG + Intergenic
1199921625 X:152411151-152411173 TTAAAAAATAAGAAATCAGGTGG + Intronic
1200470202 Y:3577462-3577484 GTGACAAGTAAGAACTCTTAAGG + Intergenic
1200524878 Y:4261280-4261302 TTTTAAAATAAGAAATATGAAGG + Intergenic
1200550104 Y:4569030-4569052 TTGAAACATAAGACATATGATGG + Intergenic
1200733488 Y:6768703-6768725 GTGAAAGATCAGAAATCCAAAGG - Intergenic
1200856120 Y:7940389-7940411 GTGAAAAATAAAAAACAGGAAGG + Intergenic
1200879053 Y:8193449-8193471 GTAAAAAATAAGAACTTTGAGGG + Intergenic
1200949183 Y:8877372-8877394 GTGAAAAATAAAATATTTGATGG + Intergenic
1201384749 Y:13426863-13426885 GTGTAAAAGAAAATATCTGAAGG + Intronic
1201408916 Y:13678527-13678549 AAGCAAAATAACAAATCTGAAGG + Intergenic
1201518716 Y:14848052-14848074 GTAAAAACTGAGAAATCAGATGG + Intergenic
1201848965 Y:18455729-18455751 GTGAAAAAGAAGGTATCTCAAGG + Intergenic
1201884353 Y:18864646-18864668 GTGAAAAAGAAGGTATCTCAAGG - Intergenic