ID: 918560083

View in Genome Browser
Species Human (GRCh38)
Location 1:185855168-185855190
Sequence AGCAAGAGCCAGAGGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 718
Summary {0: 1, 1: 1, 2: 5, 3: 73, 4: 638}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918560083_918560090 -6 Left 918560083 1:185855168-185855190 CCCTGCCCCCTCTGGCTCTTGCT 0: 1
1: 1
2: 5
3: 73
4: 638
Right 918560090 1:185855185-185855207 CTTGCTCCCTAAGCAAACAAGGG 0: 1
1: 0
2: 0
3: 14
4: 100
918560083_918560094 11 Left 918560083 1:185855168-185855190 CCCTGCCCCCTCTGGCTCTTGCT 0: 1
1: 1
2: 5
3: 73
4: 638
Right 918560094 1:185855202-185855224 CAAGGGAACCACTTGTTAGGTGG 0: 1
1: 0
2: 0
3: 4
4: 103
918560083_918560093 8 Left 918560083 1:185855168-185855190 CCCTGCCCCCTCTGGCTCTTGCT 0: 1
1: 1
2: 5
3: 73
4: 638
Right 918560093 1:185855199-185855221 AAACAAGGGAACCACTTGTTAGG 0: 1
1: 0
2: 0
3: 11
4: 111
918560083_918560095 12 Left 918560083 1:185855168-185855190 CCCTGCCCCCTCTGGCTCTTGCT 0: 1
1: 1
2: 5
3: 73
4: 638
Right 918560095 1:185855203-185855225 AAGGGAACCACTTGTTAGGTGGG 0: 1
1: 0
2: 1
3: 7
4: 75
918560083_918560096 18 Left 918560083 1:185855168-185855190 CCCTGCCCCCTCTGGCTCTTGCT 0: 1
1: 1
2: 5
3: 73
4: 638
Right 918560096 1:185855209-185855231 ACCACTTGTTAGGTGGGACCAGG 0: 1
1: 0
2: 0
3: 7
4: 67
918560083_918560089 -7 Left 918560083 1:185855168-185855190 CCCTGCCCCCTCTGGCTCTTGCT 0: 1
1: 1
2: 5
3: 73
4: 638
Right 918560089 1:185855184-185855206 TCTTGCTCCCTAAGCAAACAAGG 0: 1
1: 0
2: 0
3: 4
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918560083 Original CRISPR AGCAAGAGCCAGAGGGGGCA GGG (reversed) Intronic
900164550 1:1239535-1239557 AGCAGGAGCCAGGGGAGGCAGGG - Intergenic
900767292 1:4513920-4513942 AGCAATAGCCAGTGTGGGGAGGG + Intergenic
900907247 1:5568041-5568063 AGCAGGAGCAAGAGAGAGCAAGG - Intergenic
900916274 1:5640979-5641001 AGCAGGAGGAAGACGGGGCAAGG + Intergenic
901122455 1:6906689-6906711 AACAACAGCCAGAGTGGGGAAGG - Intronic
901216065 1:7556045-7556067 ATCAAGAGGCAGAGGGAGCCGGG + Intronic
902068670 1:13712858-13712880 ACCAAGAGACAATGGGGGCATGG - Intronic
902099205 1:13971852-13971874 AGCAGGAGCAAGAGGGAGGAGGG - Intergenic
902361594 1:15945126-15945148 AGCAAGAGGAGGAGGGCGCAGGG - Exonic
902728024 1:18350227-18350249 CTCAAGAGCCAGATGGGCCAGGG + Intronic
903049964 1:20593395-20593417 AACCAGAACCAGAGCGGGCAAGG + Intronic
903179972 1:21600294-21600316 TGCAGGAGCCAGAGTGGGGAGGG - Intronic
903502827 1:23811066-23811088 AGGAGGAGCTAGAGAGGGCAAGG + Intronic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
903672138 1:25042881-25042903 AGCAAGAGGCAGACAGGCCAGGG - Intergenic
903771468 1:25767035-25767057 ACCAAGGCCCAGAGTGGGCAGGG + Intronic
904315090 1:29654737-29654759 AGCAGGAGGAAGAGAGGGCAAGG - Intergenic
904393068 1:30198383-30198405 AGCCAGAGACAGAGGGGAGAAGG + Intergenic
904900920 1:33856389-33856411 AGCAGGAGCCAGTGGAGGCCAGG - Intronic
904914390 1:33959601-33959623 AGCAGGAGGGAGAGGGGGCAGGG - Intronic
905033903 1:34904937-34904959 AGCGAGGGCCAGCAGGGGCAGGG - Exonic
905310376 1:37044856-37044878 AGGAAGAGCAAGAGAGTGCAGGG - Intergenic
905315028 1:37076972-37076994 ACCCAGAGCCAGAGGAGGCCAGG - Intergenic
905340298 1:37273441-37273463 AGCAACAGCCAGAGGAAGCAGGG - Intergenic
905348458 1:37327821-37327843 TGCCAGAGCCAGAGGGAGGAGGG - Intergenic
905865127 1:41372384-41372406 AGAAAGAGGAAGAGTGGGCATGG - Intronic
906102474 1:43272324-43272346 AGCCAGAGGCAGAGAGGTCAGGG + Exonic
906129554 1:43448020-43448042 AGCAAGAGACACACAGGGCAGGG - Intronic
906132692 1:43470315-43470337 TGCAAAAGCCAGATGGGGCATGG - Intergenic
906185427 1:43858817-43858839 AGCCAGAGCTAGAGGGGAGAAGG + Intronic
906322682 1:44826816-44826838 AGCACGGGGCAGAGTGGGCAGGG + Intronic
906952435 1:50345677-50345699 AGAAAGAGAAAGAGAGGGCATGG + Intergenic
907077630 1:51592906-51592928 AGTAAAAGCCAGCTGGGGCAGGG + Intronic
907442444 1:54487684-54487706 AGCAAGAGAGAGAGGAGGCGCGG + Intergenic
907481237 1:54746826-54746848 ACCAAGGCCCAGAGAGGGCAGGG - Intergenic
907748448 1:57238369-57238391 AGAAAGAGCCAGAGGATACAGGG + Intronic
908131299 1:61078125-61078147 CTCAATAGCCAGAGGGGGCGGGG + Intronic
908737723 1:67293270-67293292 AGAAAGATGCAGAGGGGGCCAGG - Intergenic
909133312 1:71766873-71766895 AGCAAGAGCAAGAGAGAGAAGGG - Intronic
909411933 1:75364372-75364394 AGCAAGAGCAAGAGAGAGTAAGG + Intronic
910990772 1:93053637-93053659 AGGAAGAGCAAGAGGGGGTGAGG - Intergenic
911490197 1:98555331-98555353 AGCAGGAGCAAGAGGGAGAATGG + Intergenic
911761787 1:101625639-101625661 AGCACGAGCAAGAGAGGGTAGGG - Intergenic
912074056 1:105850297-105850319 AGCTGGAGCCAGAGTGGCCAGGG - Intergenic
913074898 1:115333752-115333774 AGAAAGAGAGAGAGGGGGGAGGG - Intronic
913571526 1:120124988-120125010 AGCAAGAGGAAGAGGGGGCCTGG + Intergenic
914292447 1:146286609-146286631 AGCAAGAGGAAGAGGGGGCCTGG + Intergenic
914553491 1:148737392-148737414 AGCAAGAGGAAGAGGGGGCCTGG + Intergenic
915323480 1:155068924-155068946 AGCAAGAGACAGAGGGGGCTGGG - Intronic
915604546 1:156942326-156942348 AGCAGCTGCCAGAGGTGGCATGG - Intronic
915979416 1:160410726-160410748 GGCAACAGGCAGAGGGAGCAGGG - Intronic
916095366 1:161345094-161345116 GGGAAGAGCCAGAGCTGGCAGGG - Intronic
916443162 1:164847215-164847237 AGGAAGAGCAAGAGGAAGCAGGG - Exonic
916748043 1:167699422-167699444 ACCAGGAGCCAGAGGAGGCAAGG - Intronic
917054949 1:170970761-170970783 AGAGAGAGACAGAGTGGGCAGGG + Intronic
917141733 1:171841893-171841915 AGCGGGAGCCAGAGGGTGGATGG + Intronic
917454204 1:175171665-175171687 AGCAATAGAAAGTGGGGGCAGGG + Intronic
917713243 1:177708766-177708788 AGCAAGAGCCAGAGAAGTAAAGG + Intergenic
918560083 1:185855168-185855190 AGCAAGAGCCAGAGGGGGCAGGG - Intronic
919559401 1:199098268-199098290 AGAAGGAGGCAGAGGAGGCATGG + Intergenic
919762419 1:201106386-201106408 GGCAAGAGACAGAGAGGTCAGGG - Intronic
920029079 1:203025866-203025888 ATTAATAGCCACAGGGGGCAGGG + Intergenic
920053909 1:203179385-203179407 AGCTGGAGCCAGAGGGGGACGGG + Exonic
920725863 1:208434326-208434348 AGCAAAAGCCAGAGCAGGCAGGG + Intergenic
921454366 1:215350067-215350089 AGCAAGAGAGAGTGGGGGAAAGG + Intergenic
921487554 1:215733179-215733201 AGCAAGAGAGAGAGGTGGCGGGG + Intronic
922183021 1:223250911-223250933 AGCAAGAGCTAGAGGGAAGATGG + Intronic
922240182 1:223750713-223750735 CACAAGAGCTAGAGGGGGCTTGG - Intronic
922405634 1:225309876-225309898 AGCAAGACTCGGAGGGGGGAGGG + Intronic
922507740 1:226136260-226136282 AGCAAAAGCTAGCGGGGGCCAGG + Intergenic
922746347 1:228046174-228046196 AGATAGATCCAGAGGGGGCCTGG + Intronic
922775646 1:228213205-228213227 AGCAGGAGGCAGAGGGGCTAAGG - Intronic
922905330 1:229169573-229169595 AGCATGAGCCAGAGGGGCAGGGG + Intergenic
923268936 1:232337403-232337425 AGAAAGAGCAAGAGGAAGCAAGG + Intergenic
923385259 1:233459836-233459858 GGTCAGAGGCAGAGGGGGCAGGG - Intergenic
924181462 1:241442706-241442728 AGCAGGAGCAAGAGAGAGCAAGG + Intergenic
924183998 1:241467696-241467718 AGCAAGAGCCAGGCCGTGCATGG + Intergenic
924295580 1:242584381-242584403 AGGAAGAGACAGAGAAGGCAGGG + Intergenic
924793229 1:247272296-247272318 AGCAAGAGAAAGATGGGGGAGGG + Intergenic
1062895107 10:1097362-1097384 AGCTTGAACCAGAGGGGACATGG + Intronic
1063375820 10:5553677-5553699 AGCCAGAGCCAGAGAGCACAAGG + Intergenic
1065727835 10:28683600-28683622 AGAAAGATCCACTGGGGGCACGG - Intergenic
1065727988 10:28684621-28684643 ATCAAGAGCCAGAGTGGGGTTGG - Intergenic
1065898427 10:30184383-30184405 AGAAAGAGTCTGAGGGGGAAAGG + Intergenic
1066150131 10:32607123-32607145 AGCAGGAGCAAGATGGGTCAGGG - Intronic
1066167707 10:32805978-32806000 AGCAAGAGAAAGAAGGGGGAAGG + Intronic
1066507470 10:36060336-36060358 AGGAAGAGACAGAGTGGGGAGGG + Intergenic
1067009586 10:42697961-42697983 AGAAAGAGACAGAGGGAGAAGGG - Intergenic
1067662816 10:48249290-48249312 AGCAAGACCCAGAGGAGACATGG + Intronic
1067739352 10:48882678-48882700 AGCAAGAGAGAGAGGGAGGAGGG + Intronic
1067748786 10:48956513-48956535 AGCAAGAAGCAGAGGGAGGAGGG - Intronic
1067771827 10:49132013-49132035 ATCAAGAGGCAGAGGTGGAACGG - Exonic
1070092464 10:73301384-73301406 AGCAAAAGACAGAGAGAGCAGGG - Intronic
1071485161 10:86096196-86096218 GGGAAGAGTGAGAGGGGGCAAGG + Intronic
1071595302 10:86918029-86918051 ACCAGTAGCCAGAGGAGGCAAGG - Intronic
1072787945 10:98296881-98296903 AGAAAGAGCTTGAGGGGTCAGGG - Intergenic
1072896585 10:99372407-99372429 TGCAAGAGCAAGAGTGGGCAAGG + Intronic
1073250438 10:102117737-102117759 AGCAAGAGGCTGAGGGGGCCAGG - Intronic
1073259136 10:102175400-102175422 AGAAAGAGCCACAGTGGGCCGGG - Intergenic
1073459430 10:103658194-103658216 AGGCAGAGCCAGAGGTGGCTGGG + Intronic
1075421635 10:122305481-122305503 AGCAAGAGCAGGAGAGAGCAAGG - Intronic
1075450938 10:122551624-122551646 AGCATGAGCAACAGGAGGCAGGG - Intergenic
1075596848 10:123738083-123738105 AGCAGGAGAAAGAGAGGGCAGGG - Intronic
1076058643 10:127395826-127395848 AGCAAGTGCCAGGGGTGGCTGGG + Intronic
1076083806 10:127607291-127607313 AGCAAGGGCAGGAGGGGGCTGGG - Intergenic
1076295248 10:129378778-129378800 AGCACGGGCTAGAGGGGACAAGG - Intergenic
1076406248 10:130214169-130214191 AGCATGAGCCAGAGGAGGCCAGG - Intergenic
1076838345 10:133032428-133032450 GGCAAGAGCTAGCCGGGGCACGG + Intergenic
1077204032 11:1332931-1332953 AGCAGGAGCAAGAGGGGGGAGGG + Intergenic
1077231238 11:1459024-1459046 GGCCAGAGCCAGAGGGGGCGGGG - Intronic
1077289764 11:1783616-1783638 AACAGGAGCCAGAGGGGCCTGGG - Intergenic
1077323278 11:1952007-1952029 ACCAAGACCCACAGGGGGCAGGG - Intronic
1077352120 11:2097844-2097866 AGCACGGGCCAGAGTGGGGAGGG - Intergenic
1077378194 11:2215496-2215518 AGGAGTAGCCAGAGGGAGCACGG + Intergenic
1077487330 11:2845137-2845159 AGCAGGAGCCACGGGGGTCAGGG + Intronic
1077490632 11:2859348-2859370 AGAGAGGGACAGAGGGGGCAGGG + Intergenic
1077609868 11:3637485-3637507 AGCAGGAAGCAGAGGGGGCTGGG + Intergenic
1077675443 11:4190379-4190401 AGGAAGAGCTAGAGGTGGGAAGG + Intergenic
1077836326 11:5930649-5930671 AGCAGGCGCCAGATGGGGCCCGG - Intronic
1077869779 11:6252014-6252036 GGCTAGAGCCAGAGCAGGCAGGG - Intergenic
1077947502 11:6917503-6917525 AGCAACTGCCAGAGGGCTCATGG - Intergenic
1078722362 11:13896887-13896909 CTGAAGAGCCAGAGAGGGCAGGG - Intergenic
1078891090 11:15559853-15559875 AGCCAGAGGCAGAGCTGGCAAGG + Intergenic
1079578755 11:22035611-22035633 AGGAAGAGACAAAGGGGTCAAGG - Intergenic
1080118575 11:28648120-28648142 TTGAAGAGCCAGATGGGGCAAGG + Intergenic
1080204068 11:29708592-29708614 TACAAGTTCCAGAGGGGGCATGG + Intergenic
1080401614 11:31941612-31941634 GTCAAGAGGCAGAGGGAGCAAGG + Intronic
1080826621 11:35853991-35854013 GGCAGGAGACAGAGGGGACAAGG - Intergenic
1081630151 11:44683994-44684016 GCCAAGAGCCAGAGAGGGGAAGG - Intergenic
1081864609 11:46352644-46352666 AGGAGGAGGCAGAGGGGGCAGGG - Intronic
1081869196 11:46375674-46375696 ATCAAGGCCCAGAGAGGGCAGGG - Intronic
1081999954 11:47388809-47388831 AGCGTGAGCCAGAGATGGCAAGG + Intergenic
1082219585 11:49618098-49618120 AGAAAGAGCAGGAAGGGGCATGG + Intergenic
1083260426 11:61519521-61519543 GTCAAGGGCCAGAGGGGACAGGG + Intronic
1083760408 11:64813478-64813500 AACAAAAGCCAGACTGGGCACGG + Intergenic
1084268711 11:68017956-68017978 AGCAAGAAGCAGAGTGGGCAAGG - Intronic
1084464141 11:69312533-69312555 AGTCAGAGCCAGAGAAGGCAGGG + Intronic
1084497945 11:69516104-69516126 AGCAAGAGAGAGAAGGGGGAGGG + Intergenic
1084516180 11:69639118-69639140 AGCATGAGCCAATGGGGGCGCGG - Intergenic
1084537043 11:69763454-69763476 AGCAGCAGCCAGAAGAGGCAAGG + Intergenic
1084605834 11:70171116-70171138 AGCTAGAGCCAGAGCTGGCCAGG + Intronic
1085292828 11:75412204-75412226 AGCAAGAGCCAGATCAGGGAAGG - Intronic
1085297877 11:75441161-75441183 ACCATGATCCAGAGGGGGGAAGG + Exonic
1086321925 11:85658722-85658744 ACTAAGAGCCAGAGGGGTCTAGG + Intergenic
1088570399 11:111218300-111218322 AAGAAGAGCCTAAGGGGGCATGG + Intergenic
1088851597 11:113707536-113707558 AGCAAGAGCAAGAGAGAGAAGGG + Intergenic
1089077873 11:115753231-115753253 AGCAAAAGCCAGTGGGAGGAGGG + Intergenic
1089096391 11:115923290-115923312 AGCAGGAGTAGGAGGGGGCAAGG + Intergenic
1089149689 11:116355221-116355243 AGCAGAAGCCAGAGAGGTCAGGG - Intergenic
1089296975 11:117475395-117475417 AGCAGGAGCCAGATGTTGCAGGG - Intronic
1089337414 11:117734673-117734695 TGTAAGCTCCAGAGGGGGCAGGG + Intronic
1089459391 11:118643865-118643887 AGGAAGAGCCAGAGGAGGAGGGG - Exonic
1089693971 11:120204990-120205012 AGCAAGAGGCAGAGGGTGAAAGG + Intergenic
1089694164 11:120206373-120206395 AGCAAGAGGCAGAGGGTAAAAGG + Intergenic
1089795198 11:120974720-120974742 AGGGAGAGTCAGAGGGGGCGAGG - Intronic
1089935487 11:122359850-122359872 AGCAAAAGCCAGAGAGGGATTGG + Intergenic
1090082267 11:123622008-123622030 AGAGAGAGACAGAGGGGGAAAGG - Intronic
1090307009 11:125699846-125699868 ACCAGGAGGCAGAGGGGTCAGGG + Intergenic
1090373864 11:126275504-126275526 AGCAAGGGCTGGAGGGGGAAAGG + Intronic
1090447900 11:126779909-126779931 AGGAAGAGACAGAGCTGGCAGGG + Intronic
1090736597 11:129616655-129616677 GCCAAGAGCTAGAGTGGGCAGGG + Intergenic
1091340964 11:134813460-134813482 AGAAAGAGACAGAGAGGGAAAGG + Intergenic
1202806266 11_KI270721v1_random:7202-7224 ACCAAGACCCACAGGGGGCAGGG - Intergenic
1094537925 12:31338563-31338585 AGCAAATGCCAGGTGGGGCATGG + Intergenic
1095816606 12:46429418-46429440 AGGGAGAGACAGAGGGAGCAAGG + Intergenic
1096518459 12:52171035-52171057 GGCAAGAGTCAGAGGGGCCTTGG + Exonic
1096797341 12:54086111-54086133 AGAAAGGGCCAGAGGGGGCTGGG - Intergenic
1096814113 12:54190962-54190984 AGCAAGTGACAGAGGGGTCGGGG - Intergenic
1096846175 12:54408268-54408290 AGGAAGTGGCAGAGGGGGCTTGG + Intronic
1097264449 12:57737634-57737656 AGCCAAAGCCGGCGGGGGCAAGG - Exonic
1097938464 12:65278790-65278812 AGGCAGAGCGAGAGGGGGCGCGG - Exonic
1097998676 12:65917657-65917679 AGGAAGAGACAGAAGGGGGAAGG + Intronic
1098821990 12:75243556-75243578 AGCAAGAGGGAGAAGGGGAACGG - Intergenic
1098821992 12:75243562-75243584 AGCAGGAGCAAGAGGGAGAAGGG - Intergenic
1101065497 12:101016326-101016348 AGCAAGGGCAAGGTGGGGCAGGG + Intronic
1101572792 12:105970472-105970494 AGTAAAAGCCAGGGGGGTCAGGG - Intergenic
1101598528 12:106188690-106188712 GAGAAGAGCCAGAGGGGGGAGGG + Intergenic
1101820069 12:108177064-108177086 AGCAAGAGGCAGAGCTGGGATGG - Intronic
1102953854 12:117046946-117046968 TGCCAAAGCCAGAGGGGTCAGGG + Intronic
1103615378 12:122148465-122148487 AGCAGGATCCAGAGGGAGCGAGG + Intergenic
1103829567 12:123768079-123768101 AGAAAGATACAGAGGGGACAAGG - Intronic
1103864540 12:124041657-124041679 AGCAAGTGTCAGAGGCTGCAGGG - Intronic
1104861604 12:131927086-131927108 AGCGAGAGCGAGAGGGGGAGGGG + Intergenic
1105421126 13:20253367-20253389 AGCAAGAGCGAGAGGAAGCGGGG + Intergenic
1105473352 13:20711377-20711399 AGCAAGTGACAGAGAGGGAAGGG + Intronic
1105712540 13:23026444-23026466 AGCAGGAGGGAGAGGGGACAGGG - Intergenic
1106024171 13:25941181-25941203 AGCAAGAGCCAGATGGGAGGGGG - Intronic
1106623811 13:31398007-31398029 AGCAGGAGCAAGGCGGGGCAGGG - Intergenic
1106787672 13:33123158-33123180 ACAAACAGCCAGCGGGGGCAGGG + Intronic
1107182105 13:37473031-37473053 AGAAGGAACCAGAGGGAGCAGGG - Intergenic
1107583294 13:41815575-41815597 ACCAAAACCCAGAAGGGGCAAGG + Intronic
1108556836 13:51601720-51601742 AGGAAGAGGCAGAGTGGGGAAGG + Intronic
1109412791 13:61995340-61995362 AGCATGATACAGAAGGGGCAGGG - Intergenic
1109799855 13:67362528-67362550 AGCAGGAGGGAGAGGGGGCGAGG + Intergenic
1109957989 13:69593296-69593318 ACAAAAAGCCAGAGGGGGCAAGG - Intergenic
1111494939 13:89035309-89035331 AGCAAGAGAAAGAGGGAGGAGGG - Intergenic
1111804387 13:93021214-93021236 AGCAAGGGCAAGAGAGAGCATGG + Intergenic
1112285930 13:98104473-98104495 GGCAGGAGGCAGAGGGAGCAGGG + Intergenic
1113075537 13:106464445-106464467 AGTAAAGGCCATAGGGGGCAGGG + Intergenic
1113881417 13:113628839-113628861 CTCAACAGCCAGAGGAGGCACGG - Intronic
1114268314 14:21086078-21086100 AGCAAGAGCAAGTAGGGGCCAGG + Intronic
1115146792 14:30236109-30236131 AGCAAGAAACAGAGGGGGTTTGG + Intergenic
1115262242 14:31466115-31466137 AGAGAGAGCGAGAGAGGGCAGGG - Intergenic
1115315596 14:32021609-32021631 AGCTAGAACCAGAGAAGGCAGGG + Intergenic
1115855665 14:37627094-37627116 AGCAAGAGAGAGTGGGGGGAAGG - Intronic
1117092042 14:52261274-52261296 AGCAAGAGAGAGAGGGGGGAGGG - Intergenic
1119409131 14:74418281-74418303 AGAAAGAGCCAGGGGTGGCGAGG + Intronic
1119547955 14:75486898-75486920 GGCCAGAGCAAGACGGGGCAGGG - Intergenic
1120675818 14:87419983-87420005 GGCAAGAGCCAGGTGGTGCAGGG - Intergenic
1120969287 14:90193856-90193878 GGAAACAGCCAGAGAGGGCAGGG + Intergenic
1121096183 14:91219669-91219691 GCCAAGGGCCAGAGTGGGCAGGG - Intronic
1121228706 14:92340727-92340749 AGCACAACCGAGAGGGGGCACGG + Intronic
1121888962 14:97571632-97571654 AGCAAGGACTAGAGAGGGCAAGG + Intergenic
1122115783 14:99526592-99526614 AGGAAGAGGAAGTGGGGGCAAGG + Intronic
1122143078 14:99673979-99674001 AGCAAGAGCCACAGTGGGAGAGG + Intronic
1122179376 14:99944243-99944265 AGCGAGAGCCAGGAGGGCCATGG + Intergenic
1122227224 14:100286803-100286825 TGCAAGAACCAGAGGGGGCCTGG - Intergenic
1122644310 14:103182541-103182563 AGCAGGAGCGAGAGGGTGCGGGG - Intergenic
1123466983 15:20524823-20524845 AGCAGGAGACAGAGGAGCCAGGG - Intergenic
1123651131 15:22476219-22476241 AGCAGGAGACAGAGGAGCCAGGG + Intergenic
1123741540 15:23285061-23285083 AGCAGGAGACAGAGGAGCCAGGG + Intergenic
1123745457 15:23317497-23317519 AGCAGGAGACAGAGGAGCCAGGG - Intergenic
1124267527 15:28250230-28250252 AGCAGGAGACAGAGGAGCCAGGG + Intronic
1124277729 15:28340814-28340836 AGCAGGAGACAGAGGAGCCAGGG - Intergenic
1124304971 15:28570794-28570816 AGCAGGAGACAGAGGAGCCAGGG + Intergenic
1126180506 15:45780819-45780841 GGCAGAAGCCAAAGGGGGCAGGG - Intergenic
1127716379 15:61653108-61653130 AGCCAGAACCCGAGGGAGCAGGG + Intergenic
1127821361 15:62658900-62658922 ACCAAGAGCTAGAGGGGCCTTGG + Intronic
1128329450 15:66746057-66746079 AGCATCAGCCAGAGGGTGCTGGG + Intronic
1128379930 15:67105086-67105108 AGAAAGGGCCAAAGGTGGCAAGG - Intronic
1128796447 15:70469993-70470015 AGCCAGATGCAGAGGGTGCACGG + Intergenic
1129124284 15:73424756-73424778 AGCTGGAGCCAGAGATGGCAGGG - Intergenic
1129264079 15:74384676-74384698 AGCTAGAGCCAGATGGGGTGGGG - Intergenic
1129330512 15:74824665-74824687 AGCAGGACCCAGATGGGGCTGGG - Intronic
1129513031 15:76138866-76138888 GGCAAGAGCTAGGTGGGGCAGGG + Intronic
1130572285 15:85057502-85057524 AGCATGAGCCAGAGCAGGGAGGG - Intronic
1130579132 15:85118928-85118950 AATAAGAACCAGAGGGAGCACGG - Intronic
1131261526 15:90890402-90890424 AGCAGGAGCGAGAGGGGGGAAGG + Exonic
1131396881 15:92093315-92093337 AGCCAGAGCAAGAGGGAGAAGGG + Intronic
1131426391 15:92348470-92348492 AGGAAGAGCGAGAGGGAGAAGGG - Intergenic
1131512583 15:93057415-93057437 AGAAGGAGGGAGAGGGGGCAGGG - Intronic
1131785306 15:95905884-95905906 AGCAAGAGAGAGAGGGGGGAGGG - Intergenic
1131829170 15:96343590-96343612 ACCAAGAGCCAGGGAGGGCCCGG + Intergenic
1132639583 16:971467-971489 AGCAAGGGACAGAGTAGGCAGGG + Intronic
1133234646 16:4382198-4382220 TGTGAGAGCCAGATGGGGCAGGG + Exonic
1134333862 16:13276066-13276088 GGTAAGAGACAGAGGGGGCGAGG - Intergenic
1134843582 16:17421617-17421639 AGAAACAGACAGAGGGGTCAAGG + Intronic
1135475939 16:22774991-22775013 AGAAAGAGACAGAGAGGGCCGGG + Intergenic
1135720552 16:24814063-24814085 TGCCAGAGCCAGAGGGGAAATGG + Intronic
1135815492 16:25628771-25628793 AGTGAGGGACAGAGGGGGCAAGG - Intergenic
1136485002 16:30565932-30565954 AGAAAGAGCCACAGGGAACAGGG - Intergenic
1137364386 16:47848149-47848171 AGGAAGAGCCAGATGGGGGGAGG + Intergenic
1138313604 16:56049513-56049535 AACAAGCCTCAGAGGGGGCATGG - Intergenic
1138434478 16:56989448-56989470 AGCCCGAGCCAGATGGGGCTCGG - Intergenic
1138830288 16:60366977-60366999 AGCAAGATCCAGAAAGGGGAGGG + Intergenic
1139041721 16:63006114-63006136 TGCAAGAGCAAGGCGGGGCATGG + Intergenic
1139139173 16:64240243-64240265 AGCATGAGACAGAGGGGGCGAGG - Intergenic
1139504338 16:67391602-67391624 AGCAAGAGCCAGTCTGGGCACGG + Exonic
1140136778 16:72213187-72213209 AGCAAGAGCCCGGGGGGGGGTGG + Intergenic
1140985738 16:80156648-80156670 GGCAAGACTCAGAGTGGGCAGGG + Intergenic
1141072340 16:80969255-80969277 ATCAAGAGCCAGAGGAGTCCTGG + Exonic
1141153319 16:81579588-81579610 TGGAAGAGGTAGAGGGGGCATGG + Intronic
1141426454 16:83947529-83947551 GGCAAGAGACAGAGGCGGGAAGG + Intronic
1141678500 16:85530309-85530331 AGCCAGAGGCAGAGGGAGCAAGG + Intergenic
1142023488 16:87799439-87799461 ACCAGGAGCTAGAAGGGGCAAGG + Intergenic
1142671184 17:1488094-1488116 GGCAGGAGCCAGCGGGGGCGCGG + Intronic
1142673440 17:1498253-1498275 GGCCAGAGCCGGAGGGAGCAAGG + Intronic
1143384922 17:6523491-6523513 AGCAAGAGGCAGAGTGAGCTGGG - Intronic
1143851789 17:9818278-9818300 AGCAAGAGAGAGAAGGGGGAAGG + Intronic
1143889074 17:10088490-10088512 AACAAGAGTCAGAGTGGCCAAGG - Intronic
1144101828 17:11948523-11948545 ATAAAGAGCCAGAGGAGGCCGGG - Intronic
1144292051 17:13836204-13836226 AGCAAAAGAGAGAGGGGACAGGG + Intergenic
1144596272 17:16572761-16572783 AGGTAGATCCTGAGGGGGCACGG - Intergenic
1144876145 17:18398475-18398497 TGCAAGAGCCAGAGTCGCCATGG - Intergenic
1145318759 17:21750508-21750530 AATCAGAGCCAGAGGGGGCCAGG + Intergenic
1145783791 17:27581175-27581197 AGCAAGAGCGAGAGGGGGCAGGG + Intronic
1145800263 17:27678371-27678393 GCCAAGAGGCAGAGGTGGCAGGG - Intergenic
1145897988 17:28471775-28471797 AGCAAGAGCCAGGAAGGACAGGG - Intronic
1146066779 17:29642272-29642294 CACAAGGGCCAGAGGAGGCAGGG - Intronic
1146099310 17:29963933-29963955 AGCAAGAGAGAGAGAGGGAAGGG - Intronic
1146392094 17:32431950-32431972 AGCAGGAGCAAGAGAGAGCAAGG + Intergenic
1146662513 17:34674155-34674177 AGGAAGAGCCTGAGGAGGCCTGG - Intergenic
1146684774 17:34834265-34834287 AGCAACATCCAAAGGTGGCAGGG + Intergenic
1147704128 17:42414328-42414350 AGCAAGAGGGAGGGGTGGCAAGG - Intronic
1148014209 17:44509601-44509623 AGAAAGAGAGAGAGGGGGGAGGG + Intergenic
1148469756 17:47885629-47885651 AGCTAGTGGCAGAGGGGGCAGGG - Intergenic
1148474292 17:47916835-47916857 AGCCACAGCCACAGGGGGCTGGG - Exonic
1148491088 17:48024351-48024373 AGGAAGGGGCTGAGGGGGCATGG - Intergenic
1148556604 17:48582255-48582277 AGAAAGGCCCAGAGGGGGCGCGG + Intronic
1149459483 17:56815815-56815837 AGCAAGAGGCAGAGGAACCAAGG - Exonic
1150307072 17:64094691-64094713 AGCAAGAGCTCAAGGAGGCAAGG - Intronic
1151300686 17:73222928-73222950 AGTAAGAGGCAGAGGAGGAACGG - Intronic
1151848809 17:76677362-76677384 AGCAGAAACCAGAGGGGTCAGGG + Exonic
1152251181 17:79213445-79213467 AGCAACAGCCAGACGGGGGAGGG + Intronic
1152829580 17:82488957-82488979 AGAAAGAGCCAAAATGGGCAGGG - Exonic
1152991312 18:366293-366315 AGCAAGAGTTTGAGGGAGCATGG + Intronic
1153350048 18:4069586-4069608 AGCAAGAGCAAGCGAGAGCATGG - Intronic
1153837183 18:8974304-8974326 AGCAAGAGCCTATGGAGGCAGGG - Intergenic
1155524151 18:26699476-26699498 AGCTTGAGCCAGAGAGGTCAAGG + Intergenic
1155980129 18:32171176-32171198 AGCAGGAGCCAGTGGAGACAGGG - Intronic
1156492095 18:37502367-37502389 AGCAAGAGCGGGAGGGAGGAAGG + Intronic
1157227551 18:45880674-45880696 ACCAAGACCCAGAGGCAGCATGG + Intronic
1157873576 18:51251696-51251718 TGCAAGAGCCAGATGGGGCCAGG - Intergenic
1157896251 18:51471029-51471051 ACCCAGGGCCAGAGGGGTCATGG - Intergenic
1157947961 18:52002326-52002348 AGCAAAAGCCAGAGGACTCACGG - Intergenic
1158504914 18:58038983-58039005 AGCAAGAGCAAGAGTGGGTTGGG - Intergenic
1158653095 18:59305205-59305227 AGCAAAGGCCACAGGGAGCAGGG + Intronic
1158669375 18:59461250-59461272 AGCAAGGGCCAGTGGTGGCGGGG - Intronic
1159020899 18:63142308-63142330 AGCAAGTGCCAGACAAGGCAGGG - Intronic
1159300976 18:66567274-66567296 AGCAAGAAGCAGAGGGAGGAAGG + Intronic
1159677489 18:71303970-71303992 AGCAGGAGGAAGAGGGAGCAGGG - Intergenic
1160128755 18:76205201-76205223 AACAAAAGAAAGAGGGGGCAGGG + Intergenic
1160804949 19:988525-988547 AGCGAGGCCCAGAGAGGGCATGG + Intronic
1160873590 19:1287474-1287496 AGCAGGAGACAGAGGGGACAAGG - Intronic
1161076177 19:2286885-2286907 AGCAAGGGGCAGAGGGTGGAGGG - Intronic
1161306921 19:3573565-3573587 TGCATGAGCCCGAGGAGGCAGGG - Intronic
1161376528 19:3941934-3941956 ACCAACAGCAAGAGGGGGCCGGG - Intronic
1161636578 19:5393050-5393072 AGGAAGAGCAAGAGGAGGCCAGG - Intergenic
1162180650 19:8866570-8866592 AGCAGGAGCCAGATTGGGAAGGG - Intronic
1162379296 19:10322459-10322481 AGCAATTGCCAGAGGGGGATGGG + Intronic
1162818134 19:13208233-13208255 AGCAACAGCCACAGGGAGGAGGG + Intronic
1163124223 19:15236031-15236053 AGAAAGTGCCTGAGTGGGCATGG + Exonic
1163592858 19:18204130-18204152 ACGCAGAGCCAGATGGGGCAGGG + Intergenic
1163850663 19:19661445-19661467 AGCAAAAGCCTGAGGCAGCAAGG - Intronic
1164575016 19:29400845-29400867 AGAAAGGGCCACAGTGGGCATGG + Intergenic
1164840184 19:31387377-31387399 AGCAGAAGCCAGAGGAGGCAAGG - Intergenic
1165155892 19:33787339-33787361 AGCAAGAGAGTGAGGGGGAAAGG - Intergenic
1165381862 19:35487465-35487487 AGCTAGAGGGAGAGGGGTCAGGG + Exonic
1165418499 19:35710423-35710445 AGGAAGAGGAAGGGGGGGCAAGG + Intronic
1165759704 19:38313759-38313781 TTCAAAAGCCAGTGGGGGCAAGG - Intronic
1166347916 19:42177700-42177722 AGTAAGAGACAGAGGGGTAAGGG + Intronic
1166669988 19:44703988-44704010 GGCAAGAGACAGAGGGGGAGGGG - Intronic
1166944683 19:46389807-46389829 AGCAGGAGCAGGAAGGGGCAGGG - Intronic
1167172568 19:47843035-47843057 ACCAGGAGCCGGAGAGGGCAGGG + Exonic
1167308087 19:48720255-48720277 AGAAAGGTCCAGAGGGGGCTGGG + Intergenic
1167610504 19:50505777-50505799 AGCGTGAGCCCCAGGGGGCACGG + Intergenic
1167611298 19:50508922-50508944 AGCAAGAGGCAGGGGAGGCAGGG + Intronic
1167856706 19:52247830-52247852 AGCATGAGACAGAGTGTGCAAGG + Intergenic
1168510156 19:56967362-56967384 AGGAGGAGAAAGAGGGGGCAGGG - Intergenic
925092509 2:1166946-1166968 ATGGAGAGCCAGAAGGGGCATGG - Intronic
925325657 2:3020065-3020087 AGCAAGAGCCAGATAAAGCAGGG + Intergenic
926297743 2:11580879-11580901 GGCCAAGGCCAGAGGGGGCATGG + Intronic
926484197 2:13434412-13434434 AGAGAGAGAAAGAGGGGGCACGG - Intergenic
926546410 2:14246091-14246113 TGCAAAAGCCAGATGTGGCATGG + Intergenic
926549163 2:14280159-14280181 AGCAAGAGGCAGAGAGGGTGTGG - Intergenic
926692840 2:15748986-15749008 GACAAGAGCAAGAGTGGGCAGGG - Intergenic
926798726 2:16640401-16640423 AGCCAGGGCCAGCTGGGGCATGG - Intronic
927319263 2:21723405-21723427 AGGAAGTGGAAGAGGGGGCAGGG + Intergenic
927737698 2:25536715-25536737 AGCGAGAGCGAGAGGGGAGATGG + Intronic
927782651 2:25951994-25952016 GCCAAGAGGCAGAGGGGGCTGGG + Intronic
927810509 2:26178016-26178038 ACCCAGGGCCAGAGGAGGCAGGG - Intronic
927843656 2:26460602-26460624 TCCAAGAGCCAGAGTGGGGAGGG + Intronic
927928491 2:27028919-27028941 AGAAAGGGTCAGAGTGGGCAGGG + Intergenic
928447976 2:31349867-31349889 GGCAAGAGACTGTGGGGGCAGGG + Intronic
929533114 2:42764502-42764524 AGCCAGAGCTGGTGGGGGCAGGG - Intergenic
930485819 2:52009442-52009464 AGAAAGAGACAGAGGGAGAAAGG - Intergenic
930612473 2:53558382-53558404 AGCAAGAGAGAGAGGGGGAGAGG + Intronic
931832847 2:66070394-66070416 AGCAAGACACAGAGGGGAGAAGG - Intergenic
932749624 2:74363127-74363149 TGCAACATGCAGAGGGGGCAGGG + Exonic
932844405 2:75120500-75120522 AGAAAGAGCAAGAAGGGGCCAGG + Intronic
933415257 2:81979168-81979190 AGCCAGAGCCAGATGGGGTTAGG - Intergenic
933746804 2:85577685-85577707 AAGAGGAGCCAGAGGGGGCTTGG + Intronic
934555644 2:95285740-95285762 AGCAGGAGCCACAGGGGGCTTGG + Intronic
935408073 2:102730343-102730365 AGAAAGATCCAGAGGTGGCCAGG - Intronic
935817863 2:106864070-106864092 AGTAAAAGCCAGAGGAGGCTGGG + Intronic
936594474 2:113834808-113834830 ACAAAGAACCAGAGGGGGCGGGG + Intergenic
936665877 2:114594941-114594963 AGGAAGATCCAGTGGGGGCTGGG - Intronic
936878477 2:117220996-117221018 AGCAAGAGTCATGGGAGGCAAGG + Intergenic
937063036 2:118994350-118994372 AGCAAGAGACAGAGGAAGAAGGG - Intronic
937208114 2:120249820-120249842 GGCAAGAGCCAGATGATGCAGGG - Intronic
938029371 2:127979430-127979452 AACAAAATCCAGAGGGGGTATGG + Intronic
938032884 2:128010566-128010588 ACCAAGAGCCAGGCCGGGCACGG + Intronic
938974008 2:136458406-136458428 AGCAAGAGAGAGAGAGGGGAAGG + Intergenic
939371052 2:141300672-141300694 AGCAAGAGCGAGAGGGGCGGGGG - Intronic
940122407 2:150281471-150281493 TGCTAGAGCCTGAGGGGCCAGGG + Intergenic
940413674 2:153395483-153395505 AGCAAGAAACAGAGTGGGAAGGG - Intergenic
941018615 2:160384980-160385002 AGCAAGAGAGAGAGAGGGAAAGG - Intronic
941164974 2:162074444-162074466 ACCGAGACCCAGAGAGGGCAGGG + Exonic
941586190 2:167362588-167362610 AGCAAGAGACAACGGGGACATGG - Intergenic
941649361 2:168077298-168077320 ACATAGAGCCAGAGGGGGAAAGG - Intronic
944036239 2:195297879-195297901 AGCAAGAGGAAGAGGGAGCAAGG + Intergenic
944896476 2:204170676-204170698 CACAATAGCCAGAGGGGGCTGGG - Intergenic
944962599 2:204892086-204892108 AGGGGGAGCCAGAGGGGACAAGG + Intronic
945107587 2:206330520-206330542 AGAAAGAGGCAGAGGCGGCCAGG + Intergenic
945212949 2:207402484-207402506 AGCAAGAGAGAGAGAGTGCAGGG - Intergenic
946043115 2:216799498-216799520 CACAAGTGCAAGAGGGGGCAAGG - Intergenic
947805748 2:232966768-232966790 AGCAAGAGTCCAAGGGGCCAAGG - Intronic
948593078 2:239063643-239063665 AGCACGAGGCAGAAGGGGAAAGG - Intronic
948987365 2:241533551-241533573 AGCAAGAGGGAGAGGTGGCAGGG - Intergenic
1168757129 20:325617-325639 AGGAAGAGCCCGCGGGGGCCCGG + Exonic
1168860329 20:1041715-1041737 GGGAAGAGCCATAGGAGGCAGGG - Intergenic
1168893998 20:1311317-1311339 AGCAGGAGCCAGAGGGTGGATGG - Intronic
1168996999 20:2140703-2140725 TGCCAGAGCTAGAGGGAGCAGGG + Intronic
1169068944 20:2709879-2709901 AGAAGGAGCCAGGGAGGGCAGGG + Intronic
1169138155 20:3210001-3210023 AGCAGGACCCAGAGAGGGCGTGG + Intronic
1169712410 20:8579848-8579870 ATCAGGAGACAGAGGGAGCAAGG + Intronic
1169746791 20:8951340-8951362 ATCAGGAGGCAGAGGGAGCAAGG + Intronic
1169811399 20:9612513-9612535 AGCAAGAGAGAGAGTGGGGAGGG + Intronic
1170804157 20:19615511-19615533 AGCAGGAGCAAGAGAGAGCAAGG + Intronic
1171166811 20:22979233-22979255 AGAAAGAGGCAGATGGGCCAGGG - Intergenic
1171849185 20:30295969-30295991 AGAAAGGGCCAGAGGGGGCTGGG - Intergenic
1172058219 20:32168954-32168976 ATCATGAGCCAGACTGGGCACGG + Intergenic
1172274120 20:33670576-33670598 AGGATGAGGAAGAGGGGGCAGGG - Intronic
1172770967 20:37382411-37382433 AGCAAGAGCGAGACAGGGTATGG - Intronic
1173522377 20:43709647-43709669 AGGAACAGTGAGAGGGGGCACGG - Intronic
1173728698 20:45313947-45313969 AGGAAGAGCCAGAGGCAACAAGG + Intronic
1173768838 20:45640202-45640224 AGCAAGAGAGAGAGGGGGCAGGG + Intergenic
1173825874 20:46047364-46047386 AGCAAGAGGGAGATGGGGCAGGG - Intronic
1173835091 20:46119504-46119526 AGAAAGAGCCAGAGGAGGTGGGG + Intronic
1173853679 20:46235654-46235676 AGTAAGAGGCAGAGGAGACAAGG - Intronic
1174064548 20:47855012-47855034 AGCAGAAGCCAGGGAGGGCAAGG + Intergenic
1174404051 20:50292475-50292497 ACCAAGGCCCAGAGAGGGCAAGG - Intergenic
1174621034 20:51874835-51874857 AGTAAGAGACAGAGAGGGCTGGG + Intergenic
1175131188 20:56790879-56790901 TGCAAGGGCCAGAGGTGGGAAGG + Intergenic
1175143785 20:56880891-56880913 AGCAAGAGCCAGAGAGGGTGAGG - Intergenic
1175256042 20:57647821-57647843 ACCAGGAGCCAGAGGGGTCTGGG + Intergenic
1175400261 20:58696223-58696245 AGCAAGAGCAGGAGTGGGCGTGG - Intronic
1175581235 20:60101598-60101620 TGCAAGAGTGAGAGTGGGCATGG + Intergenic
1175904044 20:62371192-62371214 AGCAAGTGGCAGAGGGGCCAGGG - Intergenic
1175967037 20:62664929-62664951 AGCAGGAGCCAGATGGAGCTGGG - Exonic
1176719086 21:10378939-10378961 AGAAAGAGACAGAGGGGAGAGGG - Intergenic
1178251347 21:31006350-31006372 AGCAAGACCTAGAGAGGACAGGG + Intergenic
1178465334 21:32842627-32842649 AACAAGAGAGAGAGGGGGAAGGG - Intergenic
1179005545 21:37510959-37510981 AGCATCAGCCAGAGTGGTCAGGG + Intronic
1179162772 21:38911532-38911554 AGGAAAAGCCAGAGGGAGGATGG - Intergenic
1179457273 21:41508161-41508183 AGCGAGAGCCAGGGCGGGCCGGG - Intronic
1179893922 21:44351008-44351030 AGCAACCTCCAGAGAGGGCAGGG + Intronic
1180300319 22:11031927-11031949 AGAAAGAGACAGAGGGGAGAGGG - Intergenic
1180966282 22:19789479-19789501 AGCAAGACCCAGTGGGGGGTTGG + Intronic
1181948774 22:26539397-26539419 AGCAAGGGACAGAGGGAGGAAGG + Intronic
1182102679 22:27669165-27669187 AGCAAGTGCCAGAGAGGGCTTGG + Intergenic
1182317922 22:29460098-29460120 AGCAACAGCCGGAGGGGACCTGG + Intergenic
1182368177 22:29792582-29792604 AGCAAGAGCCACAAGGAGGAGGG + Intronic
1183089747 22:35513764-35513786 AGGGAGAGCCAGAGGGAGAAAGG + Intergenic
1183511235 22:38236232-38236254 AGAAAGTTCCAGATGGGGCATGG - Intronic
1183708032 22:39487082-39487104 AGCAGGCTGCAGAGGGGGCAGGG + Intronic
1184058651 22:42068565-42068587 AGCAAGAGCACTAGGGGGCAAGG + Exonic
1184673044 22:46025643-46025665 AGAGAGAGCAAGAGGGTGCAGGG - Intergenic
1184821069 22:46909677-46909699 AGCAGGGGGCAGAGGGGACAGGG - Intronic
1184919165 22:47593536-47593558 GGCAAGAGCCAGAGAGGGGAGGG - Intergenic
1185043549 22:48517802-48517824 AGCAACCAACAGAGGGGGCAGGG - Intronic
1185172119 22:49300170-49300192 AGAGAGTCCCAGAGGGGGCAAGG + Intergenic
1185211579 22:49573541-49573563 AGCAAGGCCCAGAGTGGGCAGGG + Intronic
1185379662 22:50502626-50502648 CGGAAGGGCCAGAGTGGGCAAGG - Intergenic
949538394 3:5013292-5013314 AGCAAGAAACAGTAGGGGCATGG - Intergenic
949787457 3:7757655-7757677 AGTAGGAGCCAGAAGAGGCAAGG + Intergenic
950645225 3:14373029-14373051 AGAAGGAGAGAGAGGGGGCAGGG - Intergenic
950712259 3:14820759-14820781 ACCAGGAGCCTGAGGGGTCAGGG + Exonic
951271200 3:20626565-20626587 AGCAGGAGGAAGAGGGAGCAGGG + Intergenic
951535419 3:23736110-23736132 ACCAAGAGCCAGAAGGGCCTGGG - Intergenic
952268556 3:31810164-31810186 ATAAAGAGTCAGAGGGGGCGAGG - Intronic
953049435 3:39327535-39327557 ACCAAGAGCCAGAAGTGGCAAGG + Intergenic
954423055 3:50428725-50428747 AGGAAGAAACTGAGGGGGCAGGG + Intronic
954453055 3:50582047-50582069 AGCAAGAGCCAAAGGGCACAAGG - Exonic
955287552 3:57657860-57657882 AGGAACAGCCAGAGAGGGAATGG + Intronic
956330782 3:68105056-68105078 AGCAGGAGCAAGAGAGAGCAAGG + Intronic
958179616 3:90043055-90043077 AGGAAGAGCCAGGTGGGGGAGGG + Intergenic
958535310 3:95395565-95395587 TGTAAGATCCAGAGGGGGCAGGG - Intergenic
958699626 3:97571295-97571317 AATAAGGGCCAGAGGTGGCATGG + Intronic
959389483 3:105756987-105757009 AGCAGGAGCAAGAGAGAGCAAGG - Intronic
960274254 3:115709226-115709248 TGCAAAAGCAAGAGGAGGCAGGG - Intronic
960885883 3:122394095-122394117 AGCAAGAGCAAGAGAGATCAGGG + Intronic
961042229 3:123685738-123685760 AGGCAGAGGCAGATGGGGCAGGG - Intronic
961391249 3:126553443-126553465 AGGAGGCGTCAGAGGGGGCAGGG + Intronic
961502980 3:127350644-127350666 AGCAGCAGCCAGAAGGGGAATGG - Intergenic
961513748 3:127420221-127420243 AGCAAGGACCAGAGGGCTCAGGG - Intergenic
961532575 3:127548119-127548141 AGCGAGATCCAGAGAGGGGAGGG - Intergenic
961660901 3:128468327-128468349 AGCGAGGCCCAGAGAGGGCAGGG + Intergenic
961663029 3:128480471-128480493 AGCCAAAGCCAGAGTGGCCACGG - Exonic
961849771 3:129804446-129804468 AACAATAGCCAAAGGGGTCAGGG - Intronic
962005456 3:131344760-131344782 AGCAAGAGAGAGAGTGGGGAGGG + Intronic
962914584 3:139888451-139888473 AGCAGGAGCCAGAGAGAGAAAGG + Intergenic
962924789 3:139981915-139981937 AGCAAGAGAGGGAGGGGTCAGGG - Intronic
963260870 3:143189597-143189619 AGCAAGTGCCAGAGGCACCAAGG - Intergenic
963299609 3:143584111-143584133 AGCCAGAGCCACAGAGGGGAGGG - Intronic
963533769 3:146502770-146502792 AGCAAGAGAGAGAGGGGAGAAGG - Intergenic
964210391 3:154220410-154220432 AGCAAGAGACAGAGAGGGCTGGG + Intronic
965338356 3:167455810-167455832 AGGAAGAGAAACAGGGGGCAGGG + Intronic
965460364 3:168954453-168954475 AGCAAGAGAGAGAGCGAGCAGGG - Intergenic
966075734 3:175935222-175935244 AGCAAGAGGAAGAGGGGGCGGGG - Intergenic
966399496 3:179534265-179534287 AGCAAGAGACAATGTGGGCATGG + Intergenic
966782144 3:183593095-183593117 AGCAGGAGCCAGAGAGGGGGCGG - Intergenic
966942670 3:184756806-184756828 AACAGGATCCAGAGGGGGCTGGG + Intergenic
969391048 4:6891530-6891552 AGCAGGAGGAAGTGGGGGCAGGG + Intergenic
969499592 4:7544659-7544681 AACAAGAGACAGAGGGAGCTGGG + Intronic
969571386 4:8010741-8010763 ATGGAGAGGCAGAGGGGGCAGGG + Intronic
970249391 4:14098019-14098041 AGCAAGAGAAAGAGAGGGAAAGG - Intergenic
970468091 4:16348064-16348086 AGCAAAAGCCAGATCAGGCATGG - Intergenic
970790575 4:19853654-19853676 AGCAGGAGCAAGAGAGAGCAAGG + Intergenic
971834205 4:31741134-31741156 AGTAAGAGCCAGAAGAGGCCTGG + Intergenic
972420765 4:38884102-38884124 AGCAAGAGCTAGTTGGGGTACGG + Intronic
973128340 4:46617432-46617454 AGCAAAAAACAGAGGGGGAAAGG - Intergenic
973979285 4:56293659-56293681 AGCAGGAGCAAGAGAGAGCAAGG + Intronic
974325512 4:60409195-60409217 AGCAAGAGACAGAGTGGGTGGGG - Intergenic
975893374 4:79056033-79056055 GGCAAGAGCAAGAGGTTGCAGGG + Intergenic
976315996 4:83659731-83659753 AGCAAGAGCAGGAAGGGGCATGG + Intergenic
977852430 4:101846645-101846667 AGCAGGAGATAGAGAGGGCAGGG + Intronic
978134917 4:105245650-105245672 AGAAAGAGCAAGAGGAGTCAGGG - Intronic
978555794 4:109979238-109979260 AGGAGGAGCTAGAGGGGTCACGG + Intronic
978706471 4:111718797-111718819 AGACACAGCCAGAGGGGGGAGGG + Intergenic
979399700 4:120233407-120233429 AGCAAGAGAAAGAGGGGGGTGGG + Intergenic
979428164 4:120593721-120593743 AGCAAGAGGAAGAGAGAGCAGGG + Intergenic
980897889 4:138877135-138877157 ACCAGGAGCTAGAAGGGGCAAGG + Intergenic
981486456 4:145291615-145291637 AGCAAGTGCAAGAGAGAGCAGGG - Intergenic
981661001 4:147166462-147166484 AGCAAGAGCCAGAGACGGAAGGG - Intergenic
981944424 4:150324621-150324643 AAAAAGAGCCAGAGGTAGCAGGG + Intronic
982178975 4:152732516-152732538 AGCAGGAGCAAGAGAGAGCAAGG - Intronic
982473083 4:155817310-155817332 AGTGAAAACCAGAGGGGGCAAGG - Intergenic
982652918 4:158109315-158109337 AGCAGGAGCAAGAGGGGGCAAGG - Intergenic
983958747 4:173727407-173727429 AGCAGGAGGCACAGGGGTCAGGG + Intergenic
984374962 4:178917992-178918014 AGCAAGAGAGAGAGAGAGCAGGG - Intergenic
985202083 4:187494331-187494353 AGGAAGAGAGGGAGGGGGCAGGG - Intergenic
985414309 4:189721115-189721137 AGCAATAACCAGAGGTGACAGGG + Intergenic
985489885 5:173008-173030 AGCAAGACCCAGAAGGTGGAGGG + Exonic
985520020 5:370033-370055 AGCAAGAGCCCGGGAGGGCAGGG - Intronic
985933384 5:3076982-3077004 AGCAGGAGCAAGAGAGAGCAAGG - Intergenic
986003248 5:3646881-3646903 AGGGAGAGAGAGAGGGGGCAAGG + Intergenic
986044981 5:4028108-4028130 AGAAGGAGCAAGAAGGGGCATGG + Intergenic
986952868 5:13112234-13112256 AGCAAGAGACAGAGGGAGGGAGG - Intergenic
987914635 5:24196192-24196214 AGGAAAAACCATAGGGGGCAAGG - Intergenic
988314728 5:29610117-29610139 ACCCAGAGCCAGAGGGTGGAAGG - Intergenic
988714822 5:33815181-33815203 TCCAAGACCCAGAGGGTGCAAGG - Intronic
988877126 5:35458653-35458675 AGCAAGAGAGAGAGTGGGGAAGG - Intergenic
989134032 5:38135691-38135713 AGCAAGAGACAAAGGGAGGAAGG - Intergenic
989141370 5:38204755-38204777 AGCAGGAGAAAGAGGGGCCAGGG - Intergenic
989690078 5:44131550-44131572 AGCAGGAACAAGAGAGGGCAGGG + Intergenic
989762993 5:45042586-45042608 AACAAGGACCACAGGGGGCACGG + Intergenic
990776293 5:59309338-59309360 AGCCAGAGCCAGAGGTGCAAGGG - Intronic
991600879 5:68350427-68350449 AGCAGGAGCAAGAGAGAGCAAGG + Intergenic
992531990 5:77660791-77660813 AGAAAGAGCAAGAGGGAGAAAGG - Intergenic
994193314 5:96893611-96893633 AGGGAGGGCCAGAGGGAGCATGG - Intronic
995245481 5:109930632-109930654 AGCAAGAGAAAAAGAGGGCAGGG - Intergenic
995602100 5:113808556-113808578 AGAAAGATCCAGAGGAGGAAAGG - Intergenic
996096433 5:119404080-119404102 AAGAAGAGAAAGAGGGGGCAAGG - Intergenic
996548667 5:124707474-124707496 ACCAACAACCAGAGGGGGAATGG + Intronic
999368001 5:151035415-151035437 AGAAAGAGTCAGAGAGGGGAAGG + Intronic
999393137 5:151208825-151208847 AGCAGAAGCCAGAGTGGGAAGGG - Intronic
999698476 5:154206890-154206912 CGCAGGAGCCACAGGAGGCAGGG + Intronic
1000684840 5:164235715-164235737 GGCAGGAGCCAGATGAGGCAGGG - Intergenic
1001221352 5:169903510-169903532 AGTAGGAGCCAGCGGGGGCCGGG + Intronic
1001600681 5:172926345-172926367 AGCAAGAGGCAGCAGGGGCCTGG - Intronic
1001867491 5:175117891-175117913 ATCAAGAGCCAGTGGGGGCTTGG - Intergenic
1002050666 5:176568824-176568846 AGCATCAGCCGGAGAGGGCACGG + Intronic
1002203985 5:177550244-177550266 AAGAAGAACCAGAGGTGGCAAGG + Intronic
1002322608 5:178384623-178384645 ACCAAGGCTCAGAGGGGGCAGGG + Intronic
1002939449 6:1703261-1703283 AGCAAGAGCCAGAGGGGTGGAGG - Intronic
1004112973 6:12738570-12738592 AGCAGGAGCCAGGCTGGGCATGG + Intronic
1004572097 6:16856683-16856705 AGCAAGACCCAGAGTGGTTAAGG + Intergenic
1004953808 6:20704542-20704564 AGAAAGTGCCAGAGGGAGAATGG + Intronic
1005363818 6:25057394-25057416 GGCAATAGCCAGCAGGGGCAGGG + Intergenic
1005669971 6:28095541-28095563 AGCAAGAGCAAGAGAGAGAAGGG - Intergenic
1005784697 6:29231472-29231494 AGGAAAAGTCAGAGGAGGCATGG + Intergenic
1006202375 6:32306293-32306315 AGCAAGAGTCAGAGGAGGTTGGG - Intronic
1006303594 6:33206824-33206846 AAGAAGAGCCGGAGGTGGCAGGG - Exonic
1006666554 6:35698789-35698811 AGCAAGAGAGAGAGTGAGCAGGG + Intronic
1006840627 6:37026054-37026076 AGGAAGAGGGAGAGGGGGGAGGG - Intronic
1007118145 6:39358481-39358503 AGCGAAAGCCAGAGTAGGCAAGG - Intronic
1007219578 6:40267968-40267990 AGCAAGAGCAAGAGAGAGCGAGG - Intergenic
1007283090 6:40726628-40726650 AGCAGGAGCAAGAGAGAGCAGGG - Intergenic
1007697212 6:43741262-43741284 AGCAAGTGCAGGAGGAGGCAGGG + Intergenic
1008623877 6:53298877-53298899 AGCAAGAGAAGGTGGGGGCAAGG + Intronic
1011348617 6:86398885-86398907 AGCAGGAGCAAGAGAGAGCAAGG + Intergenic
1011366588 6:86588788-86588810 AGCAGGAGGCAGAAGGAGCAGGG + Intergenic
1011387618 6:86815095-86815117 ATCAGGAGCCAGGGGGGTCAGGG + Intergenic
1011533066 6:88346049-88346071 AGCAGGAGCAAGAGGGGGGCAGG + Intergenic
1011540672 6:88424567-88424589 AGCAAGAGAGAGAGCGGGAAGGG - Intergenic
1011839159 6:91474988-91475010 AGCTAGAGAAAGAGGGAGCAGGG - Intergenic
1012760704 6:103297015-103297037 AGCAGGAGGAAGAGTGGGCAGGG + Intergenic
1012935413 6:105362855-105362877 AGCAAGGGGCAGAGGAGGCAGGG + Intronic
1013174029 6:107662288-107662310 AGCAAAAGCCAGAGTTGGGAGGG - Intergenic
1013482124 6:110561877-110561899 AGAGAGAGACAGAGAGGGCAGGG - Intergenic
1014232578 6:118920662-118920684 AGCAGGAGCAAGAGTGGGGAGGG - Intronic
1014587752 6:123221704-123221726 GGCAAGAGCCAGAGAGAGAAAGG + Intronic
1016209164 6:141507139-141507161 AGCAAAAGCCTGAGGGACCAGGG - Intergenic
1016230272 6:141795442-141795464 AGCAGGAGGAAGAGAGGGCAGGG + Intergenic
1016264190 6:142212759-142212781 AGCAGGAGACAGAGAGGGAAGGG + Intronic
1016321694 6:142853725-142853747 AGCAAGACACAGATGGGCCAGGG + Intronic
1017763504 6:157589171-157589193 AGCAGGAGGAAGAGGGTGCAAGG + Intronic
1017768648 6:157627620-157627642 ATAAAGTGCCAGAGGCGGCATGG + Intronic
1017936116 6:159006822-159006844 AGCAGGAGCAAGAGGGAGAAGGG + Intergenic
1018988992 6:168659333-168659355 GCCAAGAGACAGAGGGAGCAAGG + Intronic
1019335389 7:480312-480334 GGCAAGAGCCCTGGGGGGCAGGG + Intergenic
1019345117 7:525947-525969 AGCCAGACCCAGTGGAGGCAAGG - Intergenic
1019486795 7:1293121-1293143 ATCAAGACCCAGAGGGGCTAAGG - Intergenic
1019506126 7:1392394-1392416 AGCAAGAGTGAGAGGGAGGAGGG - Intergenic
1019530979 7:1503285-1503307 AACAAGGGTCAGAGGAGGCAAGG + Intronic
1020274508 7:6616048-6616070 AGAAAGAGCCAGGAGGCGCAGGG - Exonic
1020753934 7:12177058-12177080 AACAAGAGGCAGAGGGGACAGGG - Intergenic
1020967256 7:14886858-14886880 AGCAGGAGTCAGATGGCGCAAGG - Intronic
1021174317 7:17433361-17433383 AACAAGAGCCAGAAGGTACAAGG - Intergenic
1021902796 7:25303965-25303987 AGCAAGATCAAGAGAGGGCTTGG - Intergenic
1022151832 7:27616160-27616182 AGCAAGAGAAAGAAGGGGAAGGG + Intronic
1022947487 7:35301959-35301981 AGCAGGAGCAAGAGAGAGCACGG - Intergenic
1023732916 7:43209279-43209301 AGCAGGAGCAACAGGGGACAGGG - Intronic
1023870388 7:44260259-44260281 AACCAGAGCCAGAGGAGGGAGGG - Intronic
1024516450 7:50263013-50263035 GGCAAGAGACAGAGGTGGGAGGG - Intergenic
1024559229 7:50629428-50629450 GGCGAGACCCTGAGGGGGCAAGG + Intronic
1024803741 7:53111444-53111466 AGCAGGAGGAAGAGGGGGAAAGG - Intergenic
1025806500 7:64838439-64838461 AGCAGGTGCCAGACGGGGCCTGG + Intergenic
1025813794 7:64891421-64891443 AGCCAGAACCAGAGGGGCCTAGG + Intronic
1025818924 7:64945511-64945533 AGCCAGAACCAGAGGGGGCAGGG - Intergenic
1026735249 7:72945126-72945148 AGCCAGAGCCAGTCAGGGCAAGG + Intronic
1026785591 7:73300055-73300077 AGCCAGAGCCAGTCAGGGCAAGG + Intergenic
1026837259 7:73647375-73647397 AGGGAGAGCCAGAGGGAGGAAGG + Intergenic
1026877374 7:73887285-73887307 AGCCTGAGCCAGGGAGGGCAGGG + Intergenic
1027108476 7:75419881-75419903 AGCCAGAGCCAGTCAGGGCAAGG - Intronic
1027254895 7:76425028-76425050 TGCAAGAGCCAGAGGGGTTGGGG - Exonic
1028275004 7:88844705-88844727 AGCAAGATTCAGACGGGGAAGGG - Intronic
1028692429 7:93668516-93668538 AGCAAGCCCCAGTGGGGTCATGG - Intronic
1028936136 7:96466040-96466062 AGCAAGAGCCAGAGATGGCCTGG - Intergenic
1029456314 7:100674170-100674192 AGCAAGAGGCAGTCGGGGCTGGG - Intronic
1030127528 7:106168636-106168658 AGCAGGAGCAAGAGAGAGCAAGG - Intergenic
1030161342 7:106511373-106511395 GGCAAGAGGCAGAGTGGGCAGGG - Intergenic
1031051511 7:116950359-116950381 AGAAAGAGGGAGAGGGGGAAGGG - Intergenic
1031090886 7:117352195-117352217 AGCAGAAGTCAGAGGGAGCAGGG + Intergenic
1031443413 7:121821588-121821610 AGCAAGAGCAGGTGGAGGCAGGG - Intergenic
1031567077 7:123313755-123313777 AGCAGGAGTCAGAGAAGGCAAGG - Intergenic
1031780532 7:125956687-125956709 AGCAAGAGAGAGAGTGGGGAAGG - Intergenic
1032222968 7:130008175-130008197 CTCAAGGGCCAGAAGGGGCAGGG + Intergenic
1033132370 7:138755595-138755617 AGCAAGGGCCCTGGGGGGCAGGG + Intronic
1033355706 7:140597772-140597794 AGGAAGAGCCAGAAGGGGCGTGG + Intronic
1033597295 7:142866856-142866878 AGCAGGGGCAAGAGGGGGCCAGG + Intronic
1034550213 7:151815571-151815593 GGCAGGAGGCAGAGGGAGCAAGG - Intronic
1035082306 7:156226943-156226965 GGCAAGTGCCAGAGGGGTCAGGG + Intergenic
1036134664 8:6149664-6149686 AGCAGGAGCAAGAGAGGGGAGGG + Intergenic
1036637167 8:10559342-10559364 AGCAGGTGCCAGAGTGGCCAAGG + Intergenic
1037929202 8:22867596-22867618 GGCTGGAGCCAGAGGGGGAAGGG - Intronic
1038321180 8:26528766-26528788 GGCAGGAGGCAGAGGGAGCAGGG + Intronic
1038364573 8:26918150-26918172 AGCAAGAGCAAGATGGAGGAAGG + Intergenic
1040564391 8:48552964-48552986 AGCACCAGGCAGAGTGGGCAAGG + Intergenic
1040848561 8:51873705-51873727 AGCAGGAGCCAGAGAGCGTAGGG - Intronic
1041038440 8:53820224-53820246 AGCACGAGCTACAGGGAGCAGGG + Intronic
1041044722 8:53879462-53879484 AGCAGGAGCGAGAGGCGGCCCGG - Exonic
1041203226 8:55471782-55471804 AGCAGGAGCAAGAGGGGGTGGGG - Intronic
1041300640 8:56407777-56407799 AGGAGGAGGCAGAGGGGGAAGGG + Intergenic
1041964072 8:63654127-63654149 AGCAAGAGACAGAGCGAGGAGGG + Intergenic
1042808067 8:72793486-72793508 AGCAAGAATCAGAGGAGACATGG + Intronic
1043487144 8:80709576-80709598 AGTGAGAGCCAGAGAAGGCAGGG + Intronic
1043878189 8:85510237-85510259 AGCAATAGCTTGAGAGGGCAGGG - Intergenic
1044496296 8:92888656-92888678 AAAAATAGCCAAAGGGGGCAAGG - Intronic
1044605655 8:94045192-94045214 AGGAAGAGGCAGGGGAGGCAGGG - Intergenic
1044615810 8:94139601-94139623 AGGAAGAACCATAGTGGGCAGGG + Intronic
1044684185 8:94811382-94811404 AGCAAGAGCAAGAGAGTTCAGGG + Intergenic
1045093570 8:98772741-98772763 AGCAGGAGCAAGATAGGGCAGGG - Intronic
1045333724 8:101179961-101179983 AGCAGGAGCCAAATGCGGCAAGG - Intronic
1045834891 8:106508089-106508111 AGAAATAGACACAGGGGGCAAGG - Intronic
1047240820 8:123086428-123086450 TGCAAGTGCCAGAGCCGGCAGGG + Intronic
1047773222 8:128047337-128047359 ACCATGGGCCAGAGGAGGCAGGG + Intergenic
1048014833 8:130488073-130488095 AGCAGGAGCAAGAGAGGGGAGGG + Intergenic
1048537945 8:135315243-135315265 AGTGAGAACCAGAGGGGACATGG - Intergenic
1048580881 8:135729089-135729111 AAGAAGAGTCACAGGGGGCAAGG - Intergenic
1048859641 8:138714557-138714579 AGGAAGAGCAAGAGTGGGAAAGG - Intronic
1049215614 8:141406490-141406512 AGCAAGGGCCAGAGGCAGGAGGG - Intronic
1049774021 8:144396463-144396485 ACCAAGAGCCAGTGAGGGGAGGG + Exonic
1051700414 9:19816711-19816733 AGCAGGAGCAAGAGAGGGCAAGG + Intergenic
1051945125 9:22559817-22559839 AGCAGGAGCAAGAGAGAGCAAGG - Intergenic
1053131570 9:35618511-35618533 GGCCAGGGCCAGAGGGGCCACGG + Intronic
1053135977 9:35650505-35650527 AGCAGGAGCCATCCGGGGCAGGG - Exonic
1053786906 9:41658688-41658710 AGAAAGGGCCAGAGGGGGCTGGG - Intergenic
1055122689 9:72680710-72680732 AACAAAAGGCAGTGGGGGCAGGG - Intronic
1055330665 9:75179650-75179672 AGCAGAAGCAAGAGGGGGCCTGG + Intergenic
1055747074 9:79459836-79459858 AGCAAGAGAAAGACAGGGCATGG + Intergenic
1055781768 9:79828606-79828628 AGAAAGAGACAGAGAGGGCTGGG + Intergenic
1056382233 9:86065659-86065681 AGTGAGAGCCAGAGAGGTCATGG - Intronic
1056427612 9:86492772-86492794 AGCAAGAGCCAGAGGGAGTAGGG - Intergenic
1057146419 9:92762294-92762316 AGCAAGAGCCTGTGTTGGCATGG + Intronic
1057167270 9:92938882-92938904 AGCAAGAGGAAGAAGGGGAAAGG - Intergenic
1058189116 9:101891547-101891569 AGCAGGAGCAAGAGAGAGCAGGG + Intergenic
1058924020 9:109643982-109644004 AGCAAGAGCAAGGGGTGGCGGGG + Intronic
1059001759 9:110356055-110356077 AGGAAGAGAGAGAAGGGGCAGGG - Intergenic
1060763573 9:126276180-126276202 AGCCAGAGCCAGGGAGGGCGTGG - Intergenic
1060869825 9:127030601-127030623 AGCAGGAGCTGGAGGGGACAGGG + Intronic
1061119181 9:128632771-128632793 AGCAAGAGCCTGAGCAGGGAGGG - Intronic
1061521437 9:131120578-131120600 ACCAAAAACTAGAGGGGGCAGGG + Exonic
1061773439 9:132944919-132944941 CGCGAGAGCCCGAGGGGGCGGGG + Intergenic
1185958176 X:4515107-4515129 AGCAAGAGACAGAGTGGGGTAGG + Intergenic
1186811531 X:13194056-13194078 AGCTAGGGCAAGAGGGGACAAGG - Intergenic
1186957590 X:14700301-14700323 AGAAAGAGCAGGAAGGGGCAGGG + Intronic
1189356876 X:40316604-40316626 AGCAAGAGAGAGATGGGGGAAGG + Intergenic
1189492520 X:41481348-41481370 AGAAAGAGCCAGAGGGCTAAGGG - Intergenic
1189618472 X:42810404-42810426 AGAAAGGGCCAGATGGGGCCGGG + Intergenic
1189754195 X:44253802-44253824 AGCAGGAGGCACAGGGGTCAGGG - Intronic
1190116693 X:47629978-47630000 AGAAGGAGGCAGAGGGGACAGGG - Intronic
1190726380 X:53193201-53193223 AGCTAGAGCCAAAGAGGGTACGG - Exonic
1192173638 X:68872441-68872463 TGCAGGAGCCAGAGGAGGGAAGG + Intergenic
1192501549 X:71657113-71657135 AGCAAGAGCAAGAGAGAGCAGGG + Intergenic
1192502985 X:71665436-71665458 AGCAAGGGACATAGGGGGCATGG + Intergenic
1192503826 X:71669147-71669169 AGCAAGGGATAGAGAGGGCATGG - Intergenic
1192510191 X:71716823-71716845 AGCAAGGGACAGAGGAGGCATGG + Intronic
1192516506 X:71764730-71764752 AGCAAGGGACAGAGGAGGCATGG - Intronic
1192522588 X:71815191-71815213 AGCAAGGGATAGAGAGGGCATGG - Intergenic
1192529315 X:71871945-71871967 AGCAAGGGACAGAGGGGACATGG + Intergenic
1193192207 X:78584020-78584042 AGCAGGAGCAAGAGAGAGCAAGG - Intergenic
1193271405 X:79533822-79533844 AGCAAGAGAGAGAGGGAGTAGGG + Intergenic
1193322232 X:80136320-80136342 AGCAAGATCCAGTCGGGGCCTGG + Intergenic
1195376615 X:104234184-104234206 GCCAAGAGCCAGAAGAGGCAGGG + Intergenic
1195443095 X:104920530-104920552 AGCAGGAGCAAGAGAGGGGAGGG - Intronic
1195989834 X:110671570-110671592 AGCAAGAGACAGAGGAGGAGAGG + Intergenic
1196083745 X:111661424-111661446 AGCAAGAGGAAGAGAGGGAAGGG - Intergenic
1196210383 X:112989400-112989422 AGCAAGTGACAGAGTAGGCAGGG + Intergenic
1197569645 X:128132655-128132677 AGCAAGAGAGAGAGAGTGCAGGG - Intergenic
1197711802 X:129676954-129676976 AGCAGGAGCACGAAGGGGCAGGG - Intergenic
1197907558 X:131442723-131442745 AGCAGGAGCCTGAGTGGGCAGGG - Intergenic
1197911809 X:131491268-131491290 AGCAGGAGCCTGAGTGGGCAGGG - Intergenic
1198801160 X:140449070-140449092 AGAAAGAGCCTGAGGGGGGAGGG - Intergenic
1199073073 X:143501221-143501243 AGGAAGAGCTGTAGGGGGCAAGG + Intergenic
1199678339 X:150206570-150206592 AGCAAGAGCCAGCTGAGGAAGGG - Intergenic
1199763745 X:150925632-150925654 AGAGAGAGACAGAGGGGGCCAGG + Intergenic
1199763857 X:150926424-150926446 AGCAAGTTCCAGAGCAGGCAGGG - Intergenic
1199993757 X:153005883-153005905 AGCAAGAGAGAGAGAGAGCAGGG + Intergenic
1200090778 X:153634980-153635002 AGCAGGAGCCAGATGGCTCAGGG + Intergenic
1200164355 X:154025990-154026012 AGGAAGACCCGGAGGGAGCAGGG + Intronic
1201236925 Y:11920908-11920930 AGCAGGAGCCAGAGGATGCGGGG + Intergenic
1201567935 Y:15385922-15385944 AGCAGGAGAAAGAGGGGGAAGGG - Intergenic
1201645438 Y:16224633-16224655 AGCAGGAGGGAGAGGGAGCAAGG + Intergenic
1201657375 Y:16360679-16360701 AGCAGGAGGGAGAGGGAGCAAGG - Intergenic
1201770189 Y:17611417-17611439 AGCAGGTGCCAGACGGGGCCCGG - Intergenic
1201831365 Y:18294570-18294592 AGCAGGTGCCAGACGGGGCCCGG + Intergenic