ID: 918564131

View in Genome Browser
Species Human (GRCh38)
Location 1:185906855-185906877
Sequence CCTGATATGGAGACTGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 209}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918564131 Original CRISPR CCTGATATGGAGACTGAAGA GGG (reversed) Intronic
900919986 1:5663934-5663956 ATGGAGATGGAGACTGAAGAGGG + Intergenic
902322856 1:15681063-15681085 GCTGCTTTGGAGGCTGAAGAGGG - Intergenic
903078632 1:20791013-20791035 GCTGCTTTGGAGACTGAAGCAGG - Intergenic
910896428 1:92074684-92074706 CCTGATATGGATGATGAAGAAGG - Exonic
911282116 1:95942534-95942556 GCTGATATGGAGGCTGAACTGGG + Intergenic
915020042 1:152770663-152770685 CATCATATTGAGACTGAACATGG - Intronic
918564131 1:185906855-185906877 CCTGATATGGAGACTGAAGAGGG - Intronic
918892191 1:190289436-190289458 TCAGATAGGGAGACTGAATATGG + Intronic
920018089 1:202929739-202929761 TCTGCTTTGGAGACTGAAGCAGG + Intergenic
920458006 1:206115982-206116004 CCACATCTGGACACTGAAGAAGG + Exonic
921177699 1:212608473-212608495 CCTGATATGGAGAGAGAGGGCGG + Intronic
922026625 1:221755733-221755755 CCAGCTATGGAGAGTGAAGATGG + Intergenic
1065341551 10:24711443-24711465 TCTGACGTGGGGACTGAAGATGG - Intronic
1067108272 10:43380134-43380156 CCTAATCTGGAGGCTGAAGTGGG - Intergenic
1068265247 10:54639971-54639993 GCTGATCTGGAGGCTGAGGAAGG + Intronic
1070366800 10:75744606-75744628 CCTGAGATGGAGACAGAAGGAGG + Intronic
1070432430 10:76354271-76354293 TGTGATATGGAGGCTGAACAGGG + Intronic
1071481762 10:86069984-86070006 CGTGATATGGTGCCTGTAGAGGG + Intronic
1072256355 10:93625023-93625045 CCAGATCTGGACATTGAAGAAGG - Intronic
1072486477 10:95861150-95861172 TCTGATTTGGGGACTGAAGGAGG - Intronic
1073571504 10:104584302-104584324 TCAGTGATGGAGACTGAAGAGGG + Intergenic
1079889756 11:26036639-26036661 CATGATATAGAGAATAAAGATGG - Intergenic
1081523558 11:43907002-43907024 TCAGATATGGAAACTGAAAAAGG + Intronic
1085292092 11:75408360-75408382 CCAGATATGGAGGCTGAGGTGGG + Intronic
1085803378 11:79612069-79612091 CCTGAAATGGAGCCAGAAGCTGG + Intergenic
1085857905 11:80196601-80196623 GCAAATATGGAAACTGAAGAGGG + Intergenic
1086501598 11:87459317-87459339 GCTGCTATGGAGACTGGAGACGG - Intergenic
1087595121 11:100243822-100243844 GCTAATTTGGAGACTGAAGAGGG - Intronic
1088479481 11:110281439-110281461 CCAGCTATGGAGGCTGAAGCAGG - Intronic
1088732602 11:112696388-112696410 GCTGACATGAAGACTGGAGAAGG - Intergenic
1091033767 11:132214787-132214809 GCTGCTATGGAAACAGAAGATGG + Intronic
1091087683 11:132738613-132738635 CCTCACATGGACACTGTAGAAGG - Intronic
1093316500 12:17657631-17657653 CCTGAGAGGGACACTGGAGAAGG - Intergenic
1094105273 12:26804844-26804866 ACTGATAGGGAGGCTGAAGTGGG - Intronic
1096654132 12:53078072-53078094 GCTACTAAGGAGACTGAAGATGG + Intronic
1097418183 12:59339965-59339987 CCTGATAACGTGAGTGAAGATGG - Intergenic
1097643479 12:62208851-62208873 CCTCAGGTGGAGACTGAAGGAGG - Intronic
1098133938 12:67381702-67381724 CCTCATCTGTAGACTGGAGATGG - Intergenic
1098503284 12:71219525-71219547 GCTGATAAGGACACTGAAGTTGG - Intronic
1100258387 12:92907382-92907404 TCTGAGATGGAGAATGTAGATGG - Intronic
1101043651 12:100782647-100782669 CCAGATAAGGAAACTGAAGCTGG - Intronic
1101385145 12:104250700-104250722 GATGATAAGGAGATTGAAGAAGG + Intronic
1101864702 12:108512077-108512099 CCTGACAAGGAGATTGAAGGAGG + Intergenic
1102629819 12:114268216-114268238 CCTGTTATGGAGCCTGTTGAGGG + Intergenic
1102826523 12:115951767-115951789 CCTGGTATGGATAGTGAAGAGGG - Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1106376700 13:29195923-29195945 CCTGCTGTGGAGCCTGAAGCAGG + Intronic
1107177979 13:37422313-37422335 GCTGAAAGGGACACTGAAGAGGG + Intergenic
1107536544 13:41340786-41340808 GCTGATCTGGAGACTGAGGCAGG - Intronic
1108305334 13:49126231-49126253 CCTAAGATGTAGACAGAAGAGGG - Intronic
1108715263 13:53072380-53072402 CCTGGTGTGGAGATTGAGGAAGG + Intergenic
1111344966 13:86939935-86939957 ACTGACATGGAAACTGAACAGGG + Intergenic
1111772803 13:92621296-92621318 CCAGATATGGGGGCTGAGGATGG - Intronic
1112085320 13:96025102-96025124 CCTGATTCAGAGACAGAAGAAGG - Intronic
1112854964 13:103757217-103757239 CCCGATATAGAGGCTGAAGTAGG - Intergenic
1114683600 14:24507266-24507288 CCTGCACTGGGGACTGAAGAGGG - Intronic
1115729972 14:36258110-36258132 CCAGATCTGGAGGGTGAAGAAGG + Intergenic
1116158879 14:41240939-41240961 TCTGATATGGAGGCTGAATAGGG - Intergenic
1116233673 14:42250412-42250434 TTTGATATGGAGACAGAAAATGG - Intergenic
1117201871 14:53398620-53398642 CCTGAGATGGGGAGTGCAGAAGG + Intergenic
1117743888 14:58847751-58847773 CTTGGTATAAAGACTGAAGAAGG + Intergenic
1122965752 14:105124664-105124686 CCAGATGTTGAGACTGAAGAAGG - Intergenic
1123048964 14:105531513-105531535 CCTGGCATGGAGAGAGAAGAGGG + Intergenic
1128487327 15:68106737-68106759 CCTGATCTGTAGAGTGAAGGGGG + Intronic
1128721968 15:69956733-69956755 CATGAAATAGAGGCTGAAGATGG - Intergenic
1129518479 15:76171100-76171122 CCGGATCTGGAGGGTGAAGAGGG + Exonic
1129937701 15:79464441-79464463 CCTCATTTGTAAACTGAAGATGG - Intronic
1130616541 15:85414511-85414533 GATGATATAGAGAATGAAGATGG + Intronic
1132141679 15:99402389-99402411 CCTGATCCGGAGCCTGCAGAGGG + Intergenic
1132533554 16:466231-466253 CCTGTCATGGAGAGTTAAGACGG + Intronic
1133924962 16:10184583-10184605 GCTGAAATGGAGACAGGAGAGGG + Intergenic
1135605978 16:23825069-23825091 CCTGATCCGGAGTCTGATGAGGG - Intergenic
1136104307 16:28018595-28018617 CCTGACAAGGAGACTGAAAAGGG - Intronic
1138908485 16:61367533-61367555 CCTGATCTGCAGTCTGAACAGGG - Intergenic
1140306725 16:73809670-73809692 CCAGATCTGGAGACTGATGAGGG - Intergenic
1141496134 16:84410973-84410995 CCTGATTTAGACACTGATGATGG - Intronic
1143293828 17:5855793-5855815 GCTGATATGGAGACGGATGGAGG + Intronic
1144426903 17:15151711-15151733 TCTGAAATGGAGAGGGAAGAGGG - Intergenic
1144464171 17:15483372-15483394 TCTGGTATGGAGTCAGAAGAGGG + Intronic
1145263574 17:21368811-21368833 GCTGGTACGGAGGCTGAAGATGG + Intergenic
1146955730 17:36935552-36935574 CCTGAAGTGGAGTCTGAAGGTGG - Intergenic
1147587623 17:41661429-41661451 CCTACTGTGGAGACTGAAGTGGG + Intergenic
1148439029 17:47702338-47702360 CAGGATATGAAGGCTGAAGAGGG + Intronic
1149615842 17:57997679-57997701 GCTGATATGGCAACTGGAGATGG + Intronic
1149677159 17:58476260-58476282 CCTGATATGGATGATGAAGAAGG - Intronic
1150253629 17:63725461-63725483 GCTGCTAGGGAGACTGAAGCAGG - Intronic
1151186038 17:72364564-72364586 GGTGTTATGGAAACTGAAGATGG - Intergenic
1151223089 17:72627995-72628017 CCAGATGTGGAGACTGCATAGGG + Intergenic
1151250861 17:72833835-72833857 CCTGAGTTGGGGACTGAAGTGGG - Intronic
1153793468 18:8600998-8601020 CCAGCTCTGGAGACTGAAGCAGG - Intergenic
1154124140 18:11674581-11674603 TCTGAAATGCAGACTGAAGGTGG + Intergenic
1156894192 18:42226080-42226102 CCATATATGTAAACTGAAGAGGG - Intergenic
1159334938 18:67049926-67049948 ATTTATATGCAGACTGAAGAGGG - Intergenic
1163245221 19:16089325-16089347 CCTGAGATGGAGATCAAAGATGG - Intronic
1164451171 19:28366352-28366374 CCTTATGTGGAGGCTGATGAAGG + Intergenic
1164563536 19:29310142-29310164 CCAGATATGGAAACTGAGGCAGG + Intergenic
1165661601 19:37585579-37585601 CCTGATATGGAGACAGAACTCGG + Intronic
1168318200 19:55493462-55493484 CCTCATTTGGATAGTGAAGATGG + Intronic
1168487863 19:56779790-56779812 CCTGCTATGAAGACTAAAAAGGG + Intronic
926979738 2:18555735-18555757 CCTTACATGAAGACTGAAGATGG - Exonic
927193340 2:20531893-20531915 CCTGTTCTGGAGACGGGAGAGGG - Intergenic
928032482 2:27793465-27793487 CCTGATGTGGGGCCTGGAGAAGG + Intronic
928098519 2:28420770-28420792 CCAGAGGTGGAGCCTGAAGAAGG - Intergenic
928270453 2:29850517-29850539 CCTGATAAAGAGACTGAACAGGG + Intronic
929461993 2:42109128-42109150 GCTGATCTGGAGGCTGAAGTGGG + Intergenic
933667679 2:84977530-84977552 CCTGCTATGGAGGCTGAAGTGGG - Intronic
936830983 2:116646533-116646555 CAGGCTATGGAGTCTGAAGAAGG + Intergenic
938370599 2:130766008-130766030 CTTTATTTGGAGACTGAAAATGG - Exonic
942044696 2:172093339-172093361 TCTGAAATTGACACTGAAGAAGG - Intergenic
942569743 2:177301990-177302012 TCTGAGATGGAGACTGAGTAGGG - Intronic
942599938 2:177630437-177630459 TCTGATATGAAAGCTGAAGATGG - Intronic
943380108 2:187134168-187134190 CCTGAAATTGAGTTTGAAGAAGG + Intergenic
946557163 2:220871812-220871834 CATGCCATGGAGACTGGAGATGG + Intergenic
947095178 2:226558508-226558530 TCTGAAGTGGATACTGAAGAAGG + Intergenic
947561586 2:231158646-231158668 CCTGGGATGGAGACTGGGGAGGG - Intronic
948310945 2:236986334-236986356 AATGATATGGAGACAGATGAAGG + Intergenic
1169194467 20:3675726-3675748 GTTGAGATGGAGCCTGAAGATGG - Intronic
1169507440 20:6227094-6227116 CCTGATATGAAAACTGAAGTCGG - Intergenic
1169874808 20:10285390-10285412 CCTAACATGGAAACTGAAAAGGG + Intronic
1172574456 20:35996967-35996989 CAGGAAATGGAGAATGAAGAAGG - Intronic
1175658292 20:60791016-60791038 CATGAAATGGTGACTGCAGAAGG + Intergenic
1175751497 20:61501206-61501228 TCAGATAAGGAGACTGGAGATGG - Intronic
1176116790 20:63435417-63435439 CCTAACGTGGAGCCTGAAGACGG + Intronic
1176922123 21:14700315-14700337 CCTGATAAGTAAACTGAAGTTGG - Intergenic
1181463086 22:23096784-23096806 CCAGATTTGCAGACTCAAGATGG - Intronic
1182404663 22:30115784-30115806 GCTGAAGTGGAGAATGAAGAAGG + Intronic
1183114834 22:35683388-35683410 CCTTATATGCAGATTGGAGAAGG + Intergenic
950252264 3:11475594-11475616 GCTGATCTGCAGACTGCAGAGGG - Intronic
951280897 3:20748137-20748159 ACTGATGTGGAGACTGTGGAAGG + Intergenic
954655363 3:52191137-52191159 CCTGATATGGAGAAGGAGCATGG - Intergenic
955990810 3:64625431-64625453 CCTTATGTGGATACTAAAGAGGG + Intronic
956366569 3:68509846-68509868 CCTGAAAGGGAGAATGAAAAGGG + Intronic
957389535 3:79546017-79546039 CATGATATTCATACTGAAGAGGG - Intronic
957543962 3:81612903-81612925 CCTGATATGGATGATGAAGAAGG + Intronic
958094110 3:88919332-88919354 CCTGATTTTGAAAGTGAAGAAGG + Intergenic
959118621 3:102207002-102207024 CCTGAAAGAGACACTGAAGAGGG - Intronic
959800235 3:110485640-110485662 CCTGATCTCCAGCCTGAAGAAGG - Intergenic
962210336 3:133472197-133472219 CCAGTTATGGAGACTGATGGGGG - Intronic
962347094 3:134626206-134626228 CCCGACATGGAGGCTGAAGGTGG - Intronic
962614831 3:137114930-137114952 CCTGATATCAAAACTGAACAGGG - Intergenic
963436752 3:145279117-145279139 CCAGATATAAAGACTGAAGTTGG + Intergenic
964369795 3:155988009-155988031 CCCGATATGGATGATGAAGAAGG + Intergenic
965248556 3:166309786-166309808 ACTGCTCGGGAGACTGAAGAGGG + Intergenic
965839689 3:172889843-172889865 CCTGTAATGGAAACAGAAGAAGG - Intronic
967526968 3:190506229-190506251 CCTACTAGGGAGGCTGAAGAAGG + Intergenic
968264424 3:197351675-197351697 GCTGAGATGGTGTCTGAAGACGG - Intergenic
969030798 4:4211651-4211673 CCTGCTAGGGAGACTGAGGCAGG + Intronic
969837765 4:9857474-9857496 CCTGAGATGGTGAGGGAAGATGG - Intronic
976781901 4:88769461-88769483 CCTCATCTGGAAAATGAAGATGG + Intronic
977020578 4:91754192-91754214 ACTGAGATGGAGGCTGAAGCAGG - Intergenic
977332154 4:95650859-95650881 CCTGATGTGGAGTCAGAATATGG + Intergenic
978181893 4:105808203-105808225 GCTGATAAGGAGACTGATAAGGG - Intronic
978468815 4:109038947-109038969 ACTGAGATGGAGAATAAAGATGG - Intronic
979544741 4:121926892-121926914 CCTGATTTAGAAACTGAGGAAGG + Intronic
981549590 4:145930294-145930316 CCTTCAAAGGAGACTGAAGAAGG - Intronic
981968054 4:150630478-150630500 ACTGATATTCAGACTGAATAAGG - Intronic
982869036 4:160552699-160552721 ACTAGAATGGAGACTGAAGAAGG - Intergenic
983678876 4:170329453-170329475 CATGAAATGGAGAGTGAAGCAGG + Intergenic
984039582 4:174714320-174714342 CCTGATTTTGAAATTGAAGAAGG - Intronic
986219828 5:5758103-5758125 GCAGATATGAGGACTGAAGAAGG - Intergenic
987534967 5:19173346-19173368 TCTGCTATGGAAGCTGAAGAAGG - Intergenic
989985220 5:50689479-50689501 CCTGAAATGGAGATTAAAGAGGG - Intronic
992207786 5:74447776-74447798 CCTTATTTGGATACTGAAAAGGG - Intergenic
992743421 5:79795998-79796020 CCAGAAATGGAGACAGAAGCAGG + Intronic
993850083 5:92997386-92997408 GATGATAAAGAGACTGAAGAAGG - Intergenic
994207905 5:97056537-97056559 CCTGATATGGATAATGAAGAAGG - Intergenic
995315120 5:110761095-110761117 CCTAACATAGTGACTGAAGAGGG - Intronic
995682074 5:114731364-114731386 GAGGATATGGAGACAGAAGAAGG + Intergenic
996535346 5:124571623-124571645 CCAGATATGGAAACTGAGGGAGG + Intergenic
998681500 5:144473016-144473038 CCTTGTATGGAGACTGAAATTGG + Intronic
998711773 5:144834076-144834098 TCTGCATTGGAGACTGAAGAGGG + Intergenic
999903179 5:156109699-156109721 CATGAGATGGAGGCTGAAGGGGG - Intronic
999975011 5:156903630-156903652 CCAGAGAAGGAGACTGCAGACGG + Intergenic
1004607863 6:17210727-17210749 CCTGATATGGCCAGTGATGATGG - Intergenic
1005499249 6:26415639-26415661 GCTGCTTTGAAGACTGAAGAAGG - Intergenic
1005969539 6:30750461-30750483 CCTGATATGGAGAGGGAGGGAGG - Intergenic
1006461500 6:34161887-34161909 CCACATATGGAGAAGGAAGAGGG + Intergenic
1006809769 6:36812305-36812327 GCTGATGTGGAGACTGTACAGGG + Intronic
1007163256 6:39810022-39810044 CCTGGAATGCAGATTGAAGATGG - Intronic
1007388627 6:41536711-41536733 CATGTTATGGATACAGAAGATGG + Intergenic
1008939970 6:57036432-57036454 TTAGATATGGAGCCTGAAGATGG - Intergenic
1010797806 6:80137977-80137999 CCTGCTTTGGAGGCTGAAGCAGG + Intronic
1011237552 6:85234045-85234067 GTTGATATGGAGTCTAAAGAAGG + Intergenic
1012409344 6:98938327-98938349 CCTGATCTGGAGGCTGAATTAGG + Intronic
1014504938 6:122243186-122243208 CCTGAAAGGCACACTGAAGAAGG + Intergenic
1015391962 6:132692521-132692543 TATGATATGAAGACAGAAGAGGG - Exonic
1015500066 6:133922617-133922639 CCAGATGAGGAAACTGAAGACGG + Intergenic
1016808804 6:148239489-148239511 CCAGATTTTGAGAATGAAGAAGG - Intergenic
1017082171 6:150680543-150680565 CCTGCAAAGGAGATTGAAGAGGG + Intronic
1017744107 6:157431503-157431525 TCTGTTTTGGAGACTGAGGATGG + Intronic
1019213535 6:170424835-170424857 CCTGAGCTGGTGTCTGAAGAGGG - Intergenic
1021044341 7:15903679-15903701 TCTGAGATGGAGTCTGAAAATGG + Intergenic
1022270974 7:28807803-28807825 CCTTTTATTGAGAATGAAGAAGG + Intronic
1024665833 7:51546170-51546192 CCTGGTATGGAGTAGGAAGAGGG - Intergenic
1026520711 7:71115628-71115650 CCTAATCGGGAGACTGAAGTGGG + Intergenic
1026558525 7:71428771-71428793 CCAGATATGGAACCTGCAGAAGG - Intronic
1027757625 7:82234843-82234865 CCTGTTTTGGAGACAGAAGTAGG - Intronic
1028963384 7:96774851-96774873 CATGATAGGGAGAGAGAAGAAGG + Intergenic
1031302777 7:120084219-120084241 CCTGATATGACGACTCAAGAAGG + Intergenic
1032144052 7:129362725-129362747 TATGATAAGGAGATTGAAGAAGG + Intronic
1034031961 7:147777324-147777346 CCTTATATGGAAATTAAAGATGG + Intronic
1035147153 7:156830647-156830669 GCTGAGATGAAGACTTAAGATGG - Intronic
1036402912 8:8426339-8426361 CCTTTTTTGGAGACTGAACAGGG + Intergenic
1037256729 8:16963971-16963993 CCTGATATGGATTCTGGGGAGGG - Intergenic
1039306262 8:36266675-36266697 GCTGATATGGAGGCTGTAGAAGG - Intergenic
1041532246 8:58882086-58882108 CCTGAAATGGCTACTGAAGTGGG - Intronic
1041778317 8:61549228-61549250 CCTCATTAGGAGACTGAAGGGGG + Intronic
1042662308 8:71168359-71168381 CGGGATATACAGACTGAAGAAGG - Intergenic
1045751191 8:105485816-105485838 CCAGACAAGGAGACTGAAAAGGG + Intronic
1045857606 8:106782050-106782072 TCTGCAATGGAGACTGAGGAAGG + Intergenic
1048007091 8:130428178-130428200 AGTGAGATGGACACTGAAGAGGG - Intronic
1048941055 8:139401204-139401226 CCTGAAGTGGAGAAAGAAGATGG + Intergenic
1049052026 8:140205766-140205788 GCTGAGATGGAGACTGTAGGAGG - Intronic
1053548045 9:39043733-39043755 CCTGATATGTAGACTCTTGAAGG + Intergenic
1055403947 9:75954619-75954641 CCTGTTAAGGAGATTGAAGTGGG + Intronic
1056815565 9:89798495-89798517 CCTGATACGGAGGCTGCAGAGGG + Intergenic
1058956068 9:109949951-109949973 GCTTATGTGTAGACTGAAGATGG - Intronic
1058973653 9:110106206-110106228 TCTGAGATGGAGACTCAAGTGGG + Intronic
1059117258 9:111610735-111610757 GCTAATTGGGAGACTGAAGAGGG + Intergenic
1061128716 9:128693899-128693921 CCCGATATGGATGATGAAGAAGG + Exonic
1061188336 9:129068112-129068134 CCAGATGGGGAGACTGAAGCTGG - Intronic
1061216395 9:129224384-129224406 CCTGAGCTGGTGACTGAATAGGG + Intergenic
1061606249 9:131713042-131713064 CCTGAAATGTGGACTGGAGATGG - Intronic
1062544712 9:137056221-137056243 TCTGATGTGGAGACTGAGGCAGG - Intergenic
1192178260 X:68899245-68899267 CCTGGTATGGACACTTAGGATGG + Intergenic
1192356635 X:70410281-70410303 ACTGAAAAGGAGACTGAAGCAGG + Intronic
1192577691 X:72255862-72255884 CCTGAATTAGGGACTGAAGAAGG + Intronic
1193219347 X:78904176-78904198 CTTGAGATGGAGATTGATGATGG - Intergenic
1195041775 X:101021275-101021297 GCTGATAGGGAGACTGCTGATGG + Exonic
1195459330 X:105106060-105106082 CCTGAAATCCATACTGAAGAGGG - Intronic
1200267920 X:154655705-154655727 CCAGATGTGGAGGATGAAGACGG + Intergenic
1200559072 Y:4677372-4677394 CTTCATATAGAGACAGAAGAAGG + Intergenic