ID: 918564690

View in Genome Browser
Species Human (GRCh38)
Location 1:185914934-185914956
Sequence CTGAGGATATCCAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1318
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 1279}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918564686_918564690 28 Left 918564686 1:185914883-185914905 CCTGAGAAAGAACTATATAAATA 0: 1
1: 0
2: 1
3: 49
4: 653
Right 918564690 1:185914934-185914956 CTGAGGATATCCAGGGAAGCAGG 0: 1
1: 0
2: 2
3: 36
4: 1279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918564690 Original CRISPR CTGAGGATATCCAGGGAAGC AGG Intronic
900543991 1:3218388-3218410 CTGGGGATACCTGGGGAAGCTGG - Intronic
900898040 1:5497529-5497551 TTGAGGATGTCCAAGGAGGCTGG - Intergenic
901224449 1:7604953-7604975 CTGCTGATATCCAGGCAAACAGG - Intronic
901392910 1:8958836-8958858 CTTAAGATTTCCAGGGAAGGAGG - Intronic
902218097 1:14947324-14947346 GTGAGGATGTGGAGGGAAGCAGG + Intronic
904279004 1:29405330-29405352 CTGAGGCTGTGCAGGGCAGCGGG - Intergenic
906605466 1:47166772-47166794 CTGCTGATATCCAGGCAAACAGG + Intergenic
906634552 1:47400169-47400191 GGGAGGCTATCCAGGGTAGCGGG - Intergenic
906662137 1:47590573-47590595 CTGAGGATAGAGAGGGAGGCTGG + Intergenic
906725442 1:48041010-48041032 CTGAGGAAGCCCAGGGAAGAAGG - Intergenic
906739860 1:48172522-48172544 CTGGTGATATCCAGGCAAACAGG - Intergenic
907876114 1:58489810-58489832 CTGCTGATATCCAGGCAAACAGG + Intronic
907926451 1:58958989-58959011 CTGCTGATATCCAGGCAAACAGG + Intergenic
907953644 1:59207323-59207345 CTGGTGATATCCAGGTAAGCAGG + Intergenic
907958204 1:59251666-59251688 CTGCTGATACCCAGGCAAGCAGG + Intergenic
909261196 1:73491454-73491476 CTGGTGATACCCAGGCAAGCAGG - Intergenic
909457027 1:75861567-75861589 CTGGTGATATCCAGGCAAACAGG - Intronic
910291057 1:85600795-85600817 ATTAAGTTATCCAGGGAAGCTGG - Intergenic
910617754 1:89218149-89218171 ATGAGGATTGCCAGGGAAGAAGG + Intergenic
910722901 1:90307009-90307031 ATGAGGATTTCCAAGGAACCTGG - Intergenic
911583236 1:99659509-99659531 CTGGGGAAATTTAGGGAAGCAGG + Intronic
911733095 1:101309967-101309989 ATGAGGGACTCCAGGGAAGCTGG - Intergenic
911968529 1:104399213-104399235 CTGAGGATAGGGAGAGAAGCAGG + Intergenic
912270933 1:108208746-108208768 CTGGGGATACCCAGGCAAACAGG - Intergenic
912615694 1:111097501-111097523 CTGAGGCTGTGCAGGGCAGCAGG + Intergenic
912952928 1:114133038-114133060 CTGAGGGTATGCAGGGAGGAAGG - Intronic
913722476 1:121612223-121612245 CTGAGGATATCGTTGGAAACGGG - Intergenic
913729024 1:121689226-121689248 CTGAGGATTTCGTTGGAAGCGGG - Intergenic
913729172 1:121691091-121691113 CTGAGGATTTCGTTGGAAGCGGG - Intergenic
913729469 1:121694820-121694842 CTGAGGATTTCGTTGGAAGCGGG - Intergenic
913735736 1:121781729-121781751 CTGAGGATTTCGTTGGAAGCGGG - Intergenic
913736718 1:121793245-121793267 CTGAGGATTTCGTTGGAAGCGGG - Intergenic
913742236 1:121859481-121859503 CTGAGGATATCGTTGGAAACGGG - Intergenic
913748287 1:121931925-121931947 CTGAGGATTTCGTTGGAAGCGGG - Intergenic
913748679 1:121936726-121936748 CTGAGGATTTCGTTGGAAGCGGG - Intergenic
913749172 1:121942600-121942622 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
913751261 1:121970034-121970056 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
913751870 1:122027086-122027108 CTGAGGATTTCGTAGGAAGCGGG + Intergenic
913754306 1:122055424-122055446 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
913763762 1:122165054-122165076 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
913768237 1:122217186-122217208 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
913769858 1:122237908-122237930 CTGAGGATTTCCTTGGAAACGGG + Intergenic
913770840 1:122250970-122250992 CTGAGGATTTCCTTGGAAACGGG + Intergenic
913772693 1:122275902-122275924 CTGAGGATTTCCTTGGAAACGGG + Intergenic
913773112 1:122281501-122281523 CTGAGGATTTCCTTGGAAACGGG + Intergenic
913774505 1:122300160-122300182 CTGAGGATTTCCTTGGAAACGGG + Intergenic
913775755 1:122316954-122316976 CTGAGGATTTCCTTGGAAACGGG + Intergenic
913778281 1:122350530-122350552 CTGAGGATTTCCTTGGAAACGGG + Intergenic
913778563 1:122354261-122354283 CTGAGGATTTCCTTGGAAACGGG + Intergenic
913779261 1:122363591-122363613 CTGAGGATTTCCTTGGAAACGGG + Intergenic
913786521 1:122460466-122460488 CTGAGGATTTCCTTGGAAACGGG + Intergenic
913788892 1:122492381-122492403 CTGAGGATTTCCTTGGAAACGGG + Intergenic
913917045 1:124786338-124786360 CTGAGGATTTCCTTGGAAACGGG + Intergenic
913918617 1:124804702-124804724 CTGAGGATTTCCTTGGAAACGGG + Intergenic
913919276 1:124812352-124812374 CTGAGGATTTCCTTGGAAACGGG + Intergenic
913919802 1:124818474-124818496 CTGAGGATTTCCTTGGAAACGGG + Intergenic
913920326 1:124824596-124824618 CTGAGGATTTCCTTGGAAACGGG + Intergenic
913920464 1:124826127-124826149 CTGAGGATATCGTTGGAAACGGG + Intergenic
913920870 1:124830718-124830740 CTGAGGATTTCCTTGGAAACGGG + Intergenic
913921003 1:124832248-124832270 CTGAGGATTTCCTTGGAAACGGG + Intergenic
913921133 1:124833778-124833800 CTGAGGATTTCCTTGGAAACGGG + Intergenic
913921525 1:124838368-124838390 CTGAGGATATCGTTGGAAACGGG + Intergenic
913921658 1:124839901-124839923 CTGAGGATTTCCTTGGAAACGGG + Intergenic
913922183 1:124846022-124846044 CTGAGGATTTCCTTGGAAACGGG + Intergenic
913927343 1:124910567-124910589 CTGAGGATTTCCTTGGAAACGGG + Intergenic
913929344 1:124935950-124935972 CTGAGGATTTCCTTGGAAACGGG - Intergenic
914007313 1:143743614-143743636 CAGAGGGTATCCTGGGAAGATGG - Intergenic
914646129 1:149654096-149654118 CAGAGGGTATCCTGGGAAGATGG - Intergenic
914997025 1:152553061-152553083 CTGCTGATACCCAGGCAAGCAGG - Intronic
915763307 1:158336938-158336960 CTGCTGATATCCAGGCAAACAGG + Intergenic
915978409 1:160405593-160405615 CTGAGGATATCCTGGTAATCAGG + Intronic
916524526 1:165597405-165597427 CTGAGGATACCCAAGAATGCCGG + Intergenic
916982502 1:170154002-170154024 CTGAGGCTACACAGGGTAGCAGG - Intronic
917096538 1:171404203-171404225 CTGTGGATACCCAGTGAAGGTGG - Intergenic
917355642 1:174124086-174124108 GTGATGATATCCAGGGTATCTGG + Intergenic
917357853 1:174144703-174144725 CTGATGATACCCAGGCAAACAGG + Intergenic
917718338 1:177760252-177760274 CTGCTGATACCCAGGGAAACAGG + Intergenic
917900701 1:179540494-179540516 CTGATGATACCCAGGCAAACAGG - Intronic
918564690 1:185914934-185914956 CTGAGGATATCCAGGGAAGCAGG + Intronic
919504362 1:198379556-198379578 CTGAGGATATAAAGTGAAGAAGG + Intergenic
919857568 1:201716173-201716195 GCGGGGATCTCCAGGGAAGCTGG - Intronic
921220483 1:212970186-212970208 CTGACCTTTTCCAGGGAAGCGGG - Intronic
921220741 1:212972039-212972061 CTGAGCTTTTCCAGGGAAGGGGG - Intronic
921621458 1:217330323-217330345 CTGAGGTTGTGCAGGGCAGCAGG + Intergenic
921749053 1:218771460-218771482 CAGAGGAAAGCCAGGAAAGCCGG + Intergenic
922197396 1:223371814-223371836 CTGCGGATAGCCAGGCAAACAGG - Intergenic
922253328 1:223870430-223870452 CTGGTGATATCCAGGCAAACAGG - Intergenic
922666633 1:227474738-227474760 CTGGTGATATCCAGGCAAACAGG + Intergenic
923081308 1:230658353-230658375 CTGATGAAATCCAGGCAAACAGG - Intronic
1062848817 10:727810-727832 CTGAGCATATCCTGGGCAGCCGG + Intergenic
1063515277 10:6688932-6688954 CTGTGGGAATCCAGGGCAGCGGG + Intergenic
1064255858 10:13742298-13742320 CTGGGGAATCCCAGGGAAGCAGG + Intronic
1064584160 10:16822947-16822969 TTGAGCCTATGCAGGGAAGCAGG - Intergenic
1064914478 10:20441477-20441499 CTGCTGATATCCAGGCAAACAGG - Intergenic
1067322004 10:45230018-45230040 TTGAGGCTGTGCAGGGAAGCAGG - Intergenic
1068085998 10:52374531-52374553 CTGGTGATATCCAGGCAAACAGG - Intergenic
1068646271 10:59471191-59471213 CTGGTGATACCCAGGGAAACAGG + Intergenic
1069057177 10:63856966-63856988 CTGATGATACCCAGGCAAACAGG - Intergenic
1069227115 10:65958666-65958688 CTGGTGATATCCAGGCAAACTGG - Intronic
1069734491 10:70644783-70644805 CTGGTGATATCCAGGCAAACAGG - Intergenic
1071193907 10:83134764-83134786 CTGATGATACCCAGGCAAACAGG - Intergenic
1072373768 10:94793633-94793655 CTGGTGATATCCAGGCAAACAGG - Intronic
1073977367 10:109116730-109116752 ATGAGTATTTCCAGGGAAGAAGG + Intergenic
1074016664 10:109541872-109541894 CTGGGGATACCCAGGAAAACAGG - Intergenic
1076609115 10:131710104-131710126 CTGTGCATATCCAATGAAGCTGG + Intergenic
1076690149 10:132219674-132219696 CTGAGGACACCCAGGGCTGCCGG + Intronic
1077043543 11:534932-534954 CAGAGGAGCTCCTGGGAAGCAGG + Intronic
1077608348 11:3627329-3627351 CTGAGGATTCCCAGGGAGGCAGG - Intergenic
1077798191 11:5512969-5512991 TAGAGGAAAACCAGGGAAGCAGG - Intronic
1077946507 11:6905441-6905463 CTGCTGATATCCAGGCAAACAGG + Intergenic
1079518022 11:21290682-21290704 CTGGTGATACCCAGGGAAACAGG + Intronic
1080118031 11:28642118-28642140 CTGGTGATACCCAGGCAAGCAGG + Intergenic
1080291333 11:30674455-30674477 CTGCTGATACCCAGGCAAGCAGG + Intergenic
1080710058 11:34738113-34738135 CTGAGGTCAACCTGGGAAGCTGG + Intergenic
1081338062 11:41892121-41892143 CTGAGGATATACAGAGAGGTTGG - Intergenic
1081377581 11:42377672-42377694 CTGGGGATACCCAGGCAAACAGG + Intergenic
1082253340 11:50005814-50005836 CTGAGGATACCCAGGCAAACAGG + Intergenic
1082326826 11:51155206-51155228 CTGAGGATTTCGTTGGAAGCAGG + Intergenic
1082327950 11:51171360-51171382 CTGAGGATTTCCTTGGAAACGGG + Intergenic
1082333582 11:51253467-51253489 CTGAGGATTTCCTTGGAAACGGG + Intergenic
1082337048 11:51303632-51303654 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
1082338977 11:51331683-51331705 CTGAGGATATCTTTGGAAACGGG + Intergenic
1082345806 11:51431140-51431162 CTGAGGATTTCGATGGAAACGGG + Intergenic
1082351020 11:51506619-51506641 CTGAGGATATCGTTGGAAACGGG + Intergenic
1082351663 11:51515973-51515995 CTGAGGATATCGTTGGAAACGGG + Intergenic
1082353131 11:51537233-51537255 CTGAGGATTTCCATGGAAACGGG + Intergenic
1082353603 11:51544036-51544058 CTGAGGATTTCGATGGAAACGGG + Intergenic
1082358198 11:51611188-51611210 CTGAGGATTTCGATGGAAACGGG + Intergenic
1082359530 11:51630930-51630952 CTGAGGATTTCGATGGAAACGGG + Intergenic
1082368007 11:51754015-51754037 CTGAGGATATCGTTGGAAACGGG + Intergenic
1082380251 11:51931684-51931706 CTGAGGATTTCGATGGAAACGGG + Intergenic
1082387429 11:52036373-52036395 CTGAGGATATCGTTGGAAACGGG + Intergenic
1082390676 11:52083979-52084001 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
1082393013 11:52117983-52118005 CTGAGGATATCGTAGGAAACGGG + Intergenic
1082396307 11:52165732-52165754 CTGAGGATTTCGATGGAAACGGG + Intergenic
1082398762 11:52201430-52201452 CTGAGGATTTCTTTGGAAGCGGG + Intergenic
1082402483 11:52255151-52255173 CTGAGGATTTCCTTGGAAACGGG + Intergenic
1082407638 11:52329594-52329616 CTGAGGATATCGTTGGAAACGGG + Intergenic
1082408933 11:52348303-52348325 CTGAGGATATCGTTGGAAACGGG + Intergenic
1082412484 11:52399506-52399528 CTGAGGATATCGTTGGAAACGGG + Intergenic
1082414721 11:52431810-52431832 CTGAGGATATCTTTGGAAACGGG + Intergenic
1082415791 11:52447110-52447132 CTGAGGATATCGTTGGAAACGGG + Intergenic
1082415849 11:52447960-52447982 CTGAGGATATCGTTGGAAACGGG + Intergenic
1082416852 11:52462409-52462431 CTGAGGATATCGTTGGAAACGGG + Intergenic
1082419612 11:52502362-52502384 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
1082419731 11:52504062-52504084 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
1082428629 11:52633279-52633301 CTGAGGATATCTTTGGAAACGGG + Intergenic
1082431527 11:52674908-52674930 CTGAGGATATCGTAGGAAACGGG + Intergenic
1082433838 11:52708061-52708083 CTGAGGATTTCCTTGGAAACGGG + Intergenic
1082434257 11:52714012-52714034 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
1082444208 11:52857638-52857660 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
1082447889 11:52911197-52911219 CTGAGGATATCTTTGGAAACGGG + Intergenic
1082453058 11:52986010-52986032 CTGAGGATTTCGATGGAAACGGG + Intergenic
1082457815 11:53055722-53055744 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
1082457991 11:53058271-53058293 CTGAGGATTTCGATGGAAACGGG + Intergenic
1082458586 11:53066771-53066793 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1082464597 11:53153473-53153495 CTGAGGATATCGTTGGAAACGGG + Intergenic
1082465015 11:53159425-53159447 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
1082465796 11:53170475-53170497 CTGAGGATATCGTTGGAAACGGG + Intergenic
1082469202 11:53219993-53220015 CTGAGGATATCGTAGGAAACGGG + Intergenic
1082469320 11:53221693-53221715 CTGAGGATTTCCTTGGAAACGGG + Intergenic
1082470451 11:53237853-53237875 CTGAGGATTTCGATGGAAACGGG + Intergenic
1082471032 11:53246353-53246375 CTGAGGATTTCGATGGAAACGGG + Intergenic
1082482968 11:53418949-53418971 CTGAGGATATCGTTGGAAACGGG + Intergenic
1082483511 11:53426600-53426622 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1082487869 11:53489482-53489504 CTGAGGATATCGTTGGAAACGGG + Intergenic
1082492089 11:53549440-53549462 CTGAGGATATCGTTGGAAACGGG + Intergenic
1082493382 11:53568142-53568164 CTGAGGATTTCGATGGAAACGGG + Intergenic
1082496895 11:53619161-53619183 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
1082501225 11:53681723-53681745 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
1082505130 11:53738682-53738704 CTGAGGATTTCCTTGGAAACGGG + Intergenic
1082507176 11:53768435-53768457 CTGAGGATTTCCATGGAAACGGG + Intergenic
1082509823 11:53806696-53806718 CTGAGGATTTCGATGGAAACGGG + Intergenic
1082511472 11:53830506-53830528 CTGAGGATTTCGATGGAAACGGG + Intergenic
1082518490 11:53931696-53931718 CTGAGGATATCGTTGGAAACGGG + Intergenic
1082519542 11:53947000-53947022 CTGAGGATATCGTTGGAAACGGG + Intergenic
1082521734 11:53978470-53978492 CTGAGGATTTCGATGGAAACGGG + Intergenic
1082521907 11:53981024-53981046 CTGAGGATATCGTTGGAAACGGG + Intergenic
1082526027 11:54040697-54040719 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
1082527429 11:54061083-54061105 CTGAGGATTTCTTTGGAAGCGGG + Intergenic
1082527608 11:54063634-54063656 CTGAGGATTTCGATGGAAACGGG + Intergenic
1082534407 11:54162269-54162291 CTGAGGATATCGTAGGAAACGGG + Intergenic
1082535755 11:54181824-54181846 CTGAGGATTTCGATGGAAACGGG + Intergenic
1082538177 11:54216687-54216709 CTGAGGATTTCCTTGGAAACGGG + Intergenic
1082539954 11:54242360-54242382 CTGAGGATATCGTTGGAAACGGG + Intergenic
1082543887 11:54299332-54299354 CTGAGGATATCGTTGGAAACGGG + Intergenic
1082554701 11:54549419-54549441 CTGAGGATTTCATGGGAAACTGG + Intergenic
1082771728 11:57213217-57213239 GGGAGGATATCCAGGAAAGTAGG + Intergenic
1082780474 11:57283830-57283852 CTGAGGCTGTGCAGGGCAGCAGG - Intergenic
1083510313 11:63202995-63203017 CTGGTGATACCCAGGGAAACAGG + Intronic
1084796852 11:71511894-71511916 CTGCTGATACCCAGGCAAGCAGG + Intronic
1084963615 11:72731754-72731776 AGGTGGATTTCCAGGGAAGCTGG - Intronic
1085003473 11:73062147-73062169 CTGATGATACCCAGGCAAACAGG + Intronic
1086422011 11:86645889-86645911 CTGGTGATATCCAGGCAAACAGG + Intronic
1087072854 11:94099286-94099308 CTGCTGATATCCAGGCAAACAGG - Intronic
1088034528 11:105296037-105296059 CTGGGGATACCCAGGGAAAGGGG - Intergenic
1088197786 11:107294555-107294577 CTGATGATACCCAGGCAAACAGG + Intergenic
1088211850 11:107465838-107465860 CTGATGATACCCAGGCAAACAGG - Intergenic
1088262730 11:107959622-107959644 CTGAGGAGAAACAGGGAAGCAGG + Intronic
1089282617 11:117384991-117385013 GTGAGGATTTCCAGAGAAGAGGG + Intronic
1090097056 11:123752651-123752673 CTGAGCATTGCCAGGGAAGAAGG - Intergenic
1090731351 11:129575572-129575594 CTGAGAATCTCCATGGAGGCTGG + Intergenic
1091089925 11:132762112-132762134 CTGATGATACCCAGGGAAACAGG - Intronic
1091453141 12:586215-586237 CTGAGCAGATCCTGGGAAGCTGG + Intronic
1092517072 12:9226006-9226028 CTGATGATACCCAGGCAAACAGG - Intergenic
1092853113 12:12648429-12648451 CTGAGGCTATTCAGGGCAACAGG + Intergenic
1094757950 12:33493409-33493431 CTGGTGATATCCAGGCAAACAGG + Intergenic
1094810632 12:34134188-34134210 CTGCTGATATCCAGGCAAACAGG + Intergenic
1094858465 12:34431854-34431876 CTGCGGATATCCAGGCAAACAGG + Intergenic
1095083380 12:38032286-38032308 CTGCTGATACCCAGGAAAGCAGG + Intergenic
1095151094 12:38797417-38797439 CTGCGGATACCCAGGCAAACAGG + Intronic
1095547269 12:43387291-43387313 CTGGTGATACCCAGGCAAGCAGG - Intronic
1095674327 12:44898443-44898465 CTGATGATACCCAGGCAAACAGG + Intronic
1096076847 12:48811242-48811264 CAGAGGTTAGTCAGGGAAGCTGG - Intergenic
1096194947 12:49643806-49643828 CTGTGGATAGCCTGGGAGGCAGG - Exonic
1097365656 12:58709655-58709677 CTGATGATACCCAGGCAAACAGG - Intronic
1097488529 12:60235495-60235517 CTGATGATACCCAGGCAAGCAGG + Intergenic
1097526715 12:60746276-60746298 CTGATGATACCCAGGCAAACAGG + Intergenic
1097635106 12:62113286-62113308 CTGGTGATACCCAGGGAAACGGG - Intronic
1098559128 12:71852265-71852287 CTGAGGTTGTGCAGGGCAGCAGG + Intronic
1098638430 12:72812845-72812867 CTGGGGATACCCAGGCAAACAGG - Intergenic
1099025542 12:77460122-77460144 CTGGGGATACCCAGGCAAACAGG + Intergenic
1099489988 12:83276535-83276557 CTGATGATAACCAGGCAAACAGG - Intergenic
1100768642 12:97897608-97897630 CTGATGATACCCAGGCAAACAGG - Intergenic
1101211751 12:102542010-102542032 CTGAGGTTATCCAGCTATGCTGG + Intergenic
1101545971 12:105713118-105713140 TTGGGGATATTCGGGGAAGCAGG + Intergenic
1101555849 12:105808471-105808493 CTCAGGATAACCAGGGCAGTCGG + Intergenic
1101595894 12:106164028-106164050 CTGATGATACCCAGGTAAACAGG + Intergenic
1102254447 12:111407443-111407465 CTGTGGGTCTCCAGGGATGCAGG + Intronic
1102440280 12:112958618-112958640 CTGGTGATATCCAGGCAAACAGG - Intronic
1103245609 12:119454478-119454500 CTGAGCGTGTCCAGGGCAGCTGG - Intronic
1104206265 12:126642001-126642023 CTGATGATACCCAGGCAAACAGG - Intergenic
1104375104 12:128258982-128259004 CGCAGGAGATCCAGGGAGGCGGG - Intergenic
1104378800 12:128288855-128288877 CTGGGGAAATCAAGGGAAGGAGG - Intronic
1104472605 12:129042818-129042840 CTGCTGATATCCAGGCAAACAGG - Intergenic
1105164653 13:17490631-17490653 TTGAGGATATCGTTGGAAGCGGG + Intergenic
1105737285 13:23284910-23284932 CTGGTGATATCCAGGCAAACAGG - Intronic
1107714429 13:43185695-43185717 CTGAGAATAACCAGAGAAGCAGG - Intergenic
1108001704 13:45910445-45910467 CTGAGGGCATCCAAGGAAGTGGG - Intergenic
1108471679 13:50773573-50773595 CTGGTGATATCCAGGCAAACAGG - Intronic
1109465757 13:62729501-62729523 CTGATGATACCCAGGCAAACAGG - Intergenic
1110050726 13:70895094-70895116 TTGAGGATATCATGGGAAGATGG + Intergenic
1110199631 13:72833550-72833572 CTGGTGATATCCAGGCAAACAGG - Intronic
1110411189 13:75205168-75205190 CTGAGGCTGTGCAGGGCAGCAGG + Intergenic
1110868604 13:80424214-80424236 CTGAGGCTATGAAGGGCAGCAGG + Intergenic
1110961365 13:81630510-81630532 CTGATGATACCCAGGCAAACAGG + Intergenic
1111375073 13:87368007-87368029 CTGGTGATATCCAGGCAAACAGG - Intergenic
1111442917 13:88304301-88304323 CTGAGGATGCACAGGGCAGCAGG - Intergenic
1112471462 13:99693510-99693532 CTGAGGAAATCCCAGGATGCTGG - Intronic
1112749883 13:102571382-102571404 CTGAGGATACCAAGGTAAGGTGG + Intergenic
1113288634 13:108881156-108881178 CTGGTGATATCCAGGCAAACAGG + Intronic
1114433889 14:22686848-22686870 CTGGTGATACCCAGGGAAACAGG + Intergenic
1114685481 14:24526796-24526818 CTGATGATACCCAGGCAAACAGG + Intergenic
1114807909 14:25858996-25859018 CTGAGGGTATCCATAGAAACAGG - Intergenic
1114844984 14:26309751-26309773 CTGATGATACCCAGGCAAACAGG + Intergenic
1116704964 14:48284979-48285001 CTGCTGATACCCAGGGAAACAGG - Intergenic
1117193794 14:53318894-53318916 CTGCTGATATCCAGGCAAACAGG + Intergenic
1117930449 14:60836540-60836562 CTGGGGATACCCAGGCAAACAGG - Intronic
1118494721 14:66296630-66296652 CTGATGATACCCAGGCAAACAGG + Intergenic
1119007026 14:70941404-70941426 CTGGTGATATCCAGGCAAACAGG - Intronic
1120064820 14:80028439-80028461 CTGCTGATATCCAGGCAAACAGG + Intergenic
1120515447 14:85464834-85464856 CTGAGGCTAAGCAGGGAAGTGGG - Intergenic
1121662073 14:95642493-95642515 CTGTGGACGCCCAGGGAAGCGGG - Intergenic
1121890858 14:97589089-97589111 CTGAGGTTAAGCAGGGCAGCAGG + Intergenic
1121899089 14:97675469-97675491 CTGATGATACCCAGGCAAACAGG + Intergenic
1122234228 14:100323011-100323033 CTGAGCAAATCCAGGGGAGTCGG + Intergenic
1122341403 14:101030866-101030888 CTGAGGGCATCCAGGGCATCTGG - Intergenic
1122411657 14:101528850-101528872 CTGAGGATGCCCAGGGAGCCTGG - Intergenic
1122807901 14:104269925-104269947 CCGCGGAGACCCAGGGAAGCTGG + Intergenic
1123196022 14:106617460-106617482 CTGAGCACACACAGGGAAGCAGG + Intergenic
1202883256 14_KI270722v1_random:81658-81680 CTGCTGATATCCAGGCAAACAGG - Intergenic
1123302053 15:18358134-18358156 CTGAGGATTTCGATGGAAACGGG + Intergenic
1123303176 15:18376707-18376729 CTGAGGATTTCCTTGGAAACGGG + Intergenic
1123328806 15:18802840-18802862 CTGAGGATATCGTTGGAAACGGG + Intergenic
1123352409 15:19194501-19194523 CTGAGGATTTCCTTGGAAACGGG + Intergenic
1123385147 15:19788973-19788995 CTGAGGATTTCCTTGGAAACGGG - Intergenic
1124095358 15:26644023-26644045 CTGAGGGTACCCAGGGCAGGAGG + Intronic
1125339948 15:38665273-38665295 CTGAAGATGTCCAGGGCTGCTGG - Intergenic
1125419218 15:39487415-39487437 CTGAGAAGTTCCAGGGGAGCAGG - Intergenic
1125501916 15:40245189-40245211 CTCTGGGTGTCCAGGGAAGCAGG + Intronic
1125762399 15:42105498-42105520 CTGAGGACACCCAGGGAGGATGG + Intergenic
1125879097 15:43176553-43176575 CTGATGATACCCAGGCAAACAGG + Intronic
1126952106 15:53893155-53893177 CTGGTGATATCCAGGCAAACAGG - Intergenic
1127057222 15:55144033-55144055 CTGCTGATATCCAGGCAAACAGG + Intergenic
1127193795 15:56562250-56562272 CTGGGGATACCCAGGCAAACAGG + Intergenic
1128231240 15:66036921-66036943 GGGAGGATCCCCAGGGAAGCAGG - Intronic
1128523843 15:68395014-68395036 CTGGTGATATCCAGGCAAACAGG + Intronic
1132287869 15:100678868-100678890 CTGGTGATACCCAGGGAAACAGG - Intergenic
1132930950 16:2459061-2459083 CAGAGAATCTCCAGGGAGGCAGG + Intergenic
1133223622 16:4329545-4329567 CAGAGGATCTCCAGTGAAGGGGG + Intronic
1134045271 16:11096391-11096413 CTGTGGTTATCCAGGGAAGTGGG - Intronic
1135865090 16:26093450-26093472 CTGATGATACCCAGGCAAACAGG + Intronic
1136239068 16:28933127-28933149 CTGGGGAGATGCCGGGAAGCGGG + Intronic
1137239329 16:46641331-46641353 CTGGTGATATCCAGGCAAACAGG + Intergenic
1137335642 16:47546389-47546411 CTGGTGATACCCAGGGAAACAGG - Intronic
1137343272 16:47631055-47631077 CTCAGGATATGCAGGTGAGCTGG - Intronic
1137437190 16:48465495-48465517 CTGCTGATACCCAGGCAAGCAGG - Intergenic
1137471145 16:48759552-48759574 CTGTTGATACCCAGGGAAACAGG + Intergenic
1138249017 16:55488345-55488367 ATTGGGATAACCAGGGAAGCAGG + Intronic
1138273007 16:55709737-55709759 CTGAGGGCTTACAGGGAAGCCGG - Intergenic
1140657438 16:77155304-77155326 CTGGGGCTCTTCAGGGAAGCTGG + Intergenic
1141188531 16:81806850-81806872 CTGGGGATAGCCAGCCAAGCAGG + Intronic
1141558855 16:84853673-84853695 CTGATGCTTTCCAGGGAAGATGG - Intronic
1143039607 17:4024034-4024056 CAGAGGATATCCATGAAAGGAGG - Intronic
1145418956 17:22751439-22751461 CTGAGGATTTCCTTGGAAACGGG + Intergenic
1145420730 17:22826241-22826263 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1145421423 17:22835757-22835779 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1145423686 17:22866683-22866705 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1145424724 17:22880957-22880979 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1145427459 17:22919022-22919044 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1145429363 17:22945194-22945216 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1145429708 17:22949952-22949974 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1145431098 17:22968987-22969009 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1145431624 17:22976127-22976149 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1145433779 17:23005864-23005886 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1145436188 17:23039175-23039197 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1145436538 17:23043935-23043957 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1145437572 17:23058213-23058235 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1145439616 17:23086766-23086788 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1145440040 17:23092716-23092738 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1145442556 17:23127218-23127240 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1145444444 17:23153403-23153425 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1145444530 17:23154591-23154613 CTGAGGATTTCGATGGAAACGGG + Intergenic
1145444971 17:23160542-23160564 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1145449824 17:23229779-23229801 CTGAGGATATCGTTGGAAACGGG + Intergenic
1145452117 17:23263364-23263386 CTGAGGATTTCGATGGAAACGGG + Intergenic
1145456142 17:23322072-23322094 CTGAGGATTTCGATGGAAACGGG + Intergenic
1145458190 17:23351936-23351958 CTGAGGATTTCGATGGAAACGGG + Intergenic
1145458929 17:23362802-23362824 CTGAGGATTTCGATGGAAACGGG + Intergenic
1145460085 17:23379589-23379611 CTGAGGATTTCGATGGAAACGGG + Intergenic
1145494559 17:23880387-23880409 CTGAGGATTTCCTTGGAAACGGG + Intergenic
1145498772 17:23941973-23941995 CTGAGGATTTCGATGGAAACGGG + Intergenic
1145500177 17:23962508-23962530 CTGAGGATTTCGATGGAAACGGG + Intergenic
1145528469 17:24374086-24374108 CTGAGGATTTCCTTGGAAACGGG + Intergenic
1145531110 17:24412424-24412446 CTGAGGATATCGTTGGAAACGGG + Intergenic
1145549062 17:24673800-24673822 CTGAGGATATCGTTGGAAACGGG + Intergenic
1145550182 17:24690078-24690100 CTGAGGATTTCGATGGAAACGGG + Intergenic
1145558449 17:24810007-24810029 CTGAGGATTTCCTTGGAAACGGG + Intergenic
1145559970 17:24832232-24832254 CTGAGGATTTCGATGGAAACGGG + Intergenic
1145565871 17:24917899-24917921 CTGAGGATTTCCTTGGAAACGGG + Intergenic
1145574796 17:25047802-25047824 CTGAGGATTTCGATGGAAACGGG + Intergenic
1145575287 17:25054927-25054949 CTGAGGATTTCCTTGGAAACGGG + Intergenic
1145575369 17:25056120-25056142 CTGAGGATATCGTTGGAAACGGG + Intergenic
1145592880 17:25310432-25310454 CTGAGGATATCGTTGGAAACGGG + Intergenic
1145616735 17:25658627-25658649 CTGAGGATTTCGATGGAAACGGG + Intergenic
1145616985 17:25662202-25662224 CTGAGGATATCGTTGGAAACGGG + Intergenic
1145618043 17:25677804-25677826 CTGAGGATATCGTTGGAAACGGG + Intergenic
1145621967 17:25735057-25735079 CTGAGGATTTCGATGGAAACGGG + Intergenic
1145623665 17:25759584-25759606 CTGAGGATTTCGATGGAAACGGG + Intergenic
1145628987 17:25836794-25836816 CTGAGGATTTCGATGGAAACGGG + Intergenic
1145642999 17:26039799-26039821 CTGAGGATTTCCTTGGAAACGGG + Intergenic
1145644725 17:26065081-26065103 CTGAGGATTTCGATGGAAACGGG + Intergenic
1145658293 17:26261726-26261748 CTGAGGATTTCGATGGAAACGGG + Intergenic
1145659600 17:26280724-26280746 CTGAGGATTTCGATGGAAACGGG + Intergenic
1145662584 17:26324025-26324047 CTGAGGATTTCGATGGAAACGGG + Intergenic
1145662828 17:26327595-26327617 CTGAGGATATCGTTGGAAACGGG + Intergenic
1145664756 17:26355765-26355787 CTGAGGATTTCGATGGAAACGGG + Intergenic
1145678270 17:26552490-26552512 CTGAGGATTTCGATGGAAACGGG + Intergenic
1145731221 17:27188199-27188221 CTGTGGATACCCAGGCAAACAGG - Intergenic
1146312668 17:31781250-31781272 CTGATGATACCCAGGCAAACAGG + Intergenic
1146580290 17:34031230-34031252 CTGTGGATACCCAGGCAAACAGG + Intronic
1146600873 17:34215024-34215046 CTGATGATACCCAGGCAAACAGG - Intergenic
1146746233 17:35333221-35333243 CTGGTGATACCCAGGGAAACAGG - Intergenic
1147265002 17:39229296-39229318 CCGAGGAAAGCCAGGGAAGTTGG + Intergenic
1147675770 17:42204277-42204299 CTATGGAAATCCAGGTAAGCAGG + Intronic
1148952645 17:51327239-51327261 CTGGTGATATCCAGGCAAACAGG + Intergenic
1149193041 17:54086472-54086494 CTGATGATATCCTGGCAAACAGG + Intergenic
1150285452 17:63951415-63951437 CTGAGGATAGCAAGGTGAGCCGG - Exonic
1150963551 17:69940876-69940898 CTGAGGCTGTGCAGGGAAGCAGG - Intergenic
1152417872 17:80174766-80174788 CTGAGGACTCCCAGGGAAGCTGG + Intronic
1153343654 18:4003289-4003311 CTGAGGATGTCCAGGTGATCTGG - Intronic
1153614519 18:6921849-6921871 ATCAGGAGCTCCAGGGAAGCTGG + Intergenic
1153838929 18:8989051-8989073 CTGGGGAAATCAAGGGATGCTGG - Intergenic
1154288502 18:13083921-13083943 CTGATGATACCCAGGCAAACAGG - Intronic
1154562712 18:15851757-15851779 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154563830 18:15867037-15867059 CTGAGGATTTCATGGGAAACGGG + Intergenic
1154566899 18:15909431-15909453 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154574476 18:16012622-16012644 TTGAGGATTTCCTTGGAAGCGGG + Intergenic
1154579979 18:16087973-16087995 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154586505 18:16177718-16177740 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154600666 18:16370967-16370989 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154608783 18:16482170-16482192 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154617738 18:16605492-16605514 TTGAGGATTTCCTTGGAAGCGGG + Intergenic
1154646497 18:17000567-17000589 TTGAGGATTTCCTTGGAAGCGGG + Intergenic
1154650530 18:17055706-17055728 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154653996 18:17103384-17103406 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154657905 18:17156978-17157000 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154666963 18:17280952-17280974 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154667315 18:17285695-17285717 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154679148 18:17447376-17447398 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154679299 18:17449410-17449432 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154681812 18:17483685-17483707 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154687102 18:17556425-17556447 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154688827 18:17580020-17580042 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154688976 18:17582055-17582077 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154702913 18:17773080-17773102 TTGAGGATTTCGATGGAAGCGGG + Intergenic
1154705451 18:17807671-17807693 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154705676 18:17810729-17810751 TTGAGGATTTCCTTGGAAGCGGG + Intergenic
1154711106 18:17885706-17885728 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154711357 18:17889102-17889124 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154714012 18:17925561-17925583 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154714804 18:17936410-17936432 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154715424 18:17944898-17944920 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154722593 18:18042736-18042758 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154723613 18:18056971-18056993 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154728747 18:18127193-18127215 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154733175 18:18187917-18187939 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154733442 18:18191644-18191666 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154745386 18:18355162-18355184 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154747254 18:18380598-18380620 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154748642 18:18399763-18399785 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154750151 18:18420438-18420460 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154752247 18:18449430-18449452 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154753844 18:18471483-18471505 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154756151 18:18503185-18503207 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154759697 18:18551438-18551460 TTGAGGATTTCCTTGGAAGCGGG + Intergenic
1154759928 18:18554486-18554508 TTGAGGATTTCCTGGGAAACGGG + Intergenic
1154770741 18:18702890-18702912 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154776803 18:18786181-18786203 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154777226 18:18791947-18791969 TTGAGGATTTCCTGGGAAACGGG + Intergenic
1154778512 18:18809582-18809604 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154782549 18:18865222-18865244 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154785747 18:18908990-18909012 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154792142 18:18996980-18997002 TTGAGGATTTCCTTGGAAGCGGG + Intergenic
1154794105 18:19024116-19024138 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154802672 18:19141822-19141844 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154810518 18:19249468-19249490 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154819952 18:19379434-19379456 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154820384 18:19385372-19385394 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154820530 18:19387410-19387432 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154822505 18:19414550-19414572 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154828500 18:19497971-19497993 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154830231 18:19521882-19521904 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154831068 18:19533419-19533441 TTGAGGATTTCCTTGGAAGCGGG + Intergenic
1154833398 18:19565304-19565326 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154837917 18:19627731-19627753 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154841851 18:19681824-19681846 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154846280 18:19742530-19742552 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154848722 18:19776280-19776302 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154850256 18:19797309-19797331 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154850858 18:19805451-19805473 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154854458 18:19855479-19855501 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154855785 18:19873971-19873993 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154857411 18:19896349-19896371 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154857910 18:19903129-19903151 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154858062 18:19905164-19905186 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154859350 18:19923299-19923321 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154862441 18:19966022-19966044 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154866313 18:20019438-20019460 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154867198 18:20031479-20031501 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154871187 18:20086596-20086618 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154876203 18:20155968-20155990 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154879523 18:20201572-20201594 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154880224 18:20211079-20211101 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154883294 18:20253477-20253499 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154884161 18:20265511-20265533 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154886933 18:20303680-20303702 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154891197 18:20362317-20362339 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154895818 18:20426055-20426077 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154900507 18:20490326-20490348 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154900654 18:20492365-20492387 CTGAGGATTTCGTGGGAAACGGG + Intergenic
1154908337 18:20608811-20608833 CTGAGGATTTCCTTGGAAACGGG + Intergenic
1154908858 18:20616978-20617000 CTGAGGATTTCCTTGGAAACGGG + Intergenic
1154909842 18:20632404-20632426 CTGAGGATTTCCTTGGAAACGGG + Intergenic
1154910136 18:20636999-20637021 CTGAGGATTTCCTTGGAAACGGG + Intergenic
1154910487 18:20642495-20642517 CTGAGGATTTCCTTGGAAACGGG + Intergenic
1154911259 18:20654695-20654717 CTGAGGATTTCCTTGGAAACGGG + Intergenic
1154911627 18:20660651-20660673 CTGAGGATTTCCTTGGAAACGGG + Intergenic
1154912112 18:20668139-20668161 CTGAGGATTTCCTTGGAAACGGG + Intergenic
1154912588 18:20675628-20675650 CTGAGGATTTCCTTGGAAACGGG + Intergenic
1154912778 18:20678693-20678715 CTGAGGATTTCCTTGGAAACGGG + Intergenic
1154913625 18:20691986-20692008 CTGAGGATTTCCTTGGAAACGGG + Intergenic
1154925679 18:20929746-20929768 CTGAGGATTTCCTTGGAAACGGG + Intergenic
1154925995 18:20935000-20935022 CTGAGGATTTCCTTGGAAACGGG + Intergenic
1155504568 18:26520769-26520791 CTCAGTATCTCCAGGCAAGCTGG - Intronic
1155582329 18:27323844-27323866 CTGGGGAGATGCAGAGAAGCTGG - Intergenic
1155653078 18:28163952-28163974 CTGGGGATGTCCAAGGAAGTAGG + Intronic
1156116029 18:33787740-33787762 CTGCGGATACCCAGGCAAACAGG + Intergenic
1156151624 18:34250076-34250098 CTGAGATTATGCAGGGGAGCAGG + Intergenic
1156506372 18:37597576-37597598 CAGAGGATCTCCAGGGAAAGAGG - Intergenic
1156622003 18:38864039-38864061 CTGAGGCTGTGCTGGGAAGCAGG - Intergenic
1157268603 18:46250910-46250932 TTGAGGGTAATCAGGGAAGCTGG - Intronic
1159387358 18:67742859-67742881 CTGATGATACCCAGGCAAACGGG + Intergenic
1160311459 18:77794837-77794859 TTGAGGTGATCCTGGGAAGCAGG + Intergenic
1160612108 18:80096621-80096643 CTGTGGATCACCAGGGAAACTGG + Exonic
1160658878 19:289115-289137 CTGAGGGTGGCCAGGGAAGCAGG + Intronic
1162177562 19:8842516-8842538 CTGATGATGTCCCAGGAAGCAGG + Intronic
1162463373 19:10826443-10826465 CTGAGAGTCTCCAGGGAACCCGG - Intronic
1162554524 19:11378507-11378529 GAGAGGACTTCCAGGGAAGCAGG + Exonic
1164495596 19:28757699-28757721 CTGGTGATATCCAGGCAAACAGG + Intergenic
1164568445 19:29349203-29349225 CTGCTGATATCCAGGAAAACAGG + Intergenic
1165544713 19:36525350-36525372 CTGTGGATATACAAGGAAGCAGG + Exonic
1166903094 19:46081728-46081750 CTGAGGGCATTCAGGGCAGCTGG - Intergenic
1202658668 1_KI270708v1_random:48802-48824 CTGCTGATATCCAGGCAAACAGG - Intergenic
925472774 2:4180718-4180740 CTGAGGGCATCCAGTGAAGAAGG - Intergenic
925673093 2:6332804-6332826 CTGGTGATACCCAGGGAAACAGG - Intergenic
926709817 2:15869953-15869975 CCGAGGAGATGCAGGTAAGCCGG - Intergenic
927221290 2:20712223-20712245 CTGGTGATACCCAGGCAAGCAGG + Intronic
927462917 2:23314440-23314462 CTAAGGTTATCCAGGCAAGATGG - Intergenic
927920940 2:26971189-26971211 CTGGGGAGATCCAGAGAGGCCGG - Intronic
927968561 2:27288306-27288328 CTCTGGATAGCCAGGGAAGAGGG + Intronic
928864898 2:35906165-35906187 CTGGTGATACCCAGGCAAGCAGG - Intergenic
930598054 2:53411753-53411775 CTGATGATACCCAGGCAAACAGG + Intergenic
930908842 2:56606119-56606141 CTGGTGATATCCAGGCAAACAGG - Intergenic
931004186 2:57828793-57828815 CTGGTGATATCCAGGCAAACAGG + Intergenic
931895673 2:66726942-66726964 ATGTGGATATCCTGGGAAGCAGG + Intergenic
931984950 2:67732703-67732725 TTGAGGATATCAAGGCAAGAAGG - Intergenic
932669275 2:73722264-73722286 CTGCTGATACCCAGGGAAACAGG + Intergenic
935812515 2:106812629-106812651 CTGAGGATAAGCAGTCAAGCTGG + Intronic
935822710 2:106910033-106910055 CTGATGATACCCAGGCAAACAGG + Intergenic
936259688 2:110948051-110948073 CTGAGGAGAAACAGGGCAGCTGG - Intronic
936628275 2:114172350-114172372 GGCAGGAGATCCAGGGAAGCTGG - Intergenic
936857924 2:116982373-116982395 CTGGTGATACCCAGGGAAACAGG + Intergenic
937031066 2:118741056-118741078 CAGAGTATAGCCAGGGAAGGAGG + Intergenic
937540059 2:122938333-122938355 CTCATGACATACAGGGAAGCAGG + Intergenic
938389763 2:130895512-130895534 CTGAGGATACCAAGTGAGGCAGG - Intronic
938442262 2:131346772-131346794 CTGCTGATATCCAGGCAAACAGG - Intronic
938880476 2:135581271-135581293 CTGTGGATCTACAGGGAAACAGG - Intronic
940552984 2:155185335-155185357 CTCAGGATAGTCAAGGAAGCAGG - Intergenic
940616445 2:156054636-156054658 CAGAGGATCTCCAGGGAAACTGG - Intergenic
941767419 2:169313484-169313506 CTGATGATACCCAGGCAAACAGG - Intronic
942056859 2:172192541-172192563 CTGCTGATATCCAGGCAAACAGG - Intergenic
942731566 2:179066445-179066467 CTGTGGATACCCAGGCAAACAGG - Intergenic
943098018 2:183453583-183453605 CTGATGATACCCAGGCAAACAGG - Intergenic
943549398 2:189320033-189320055 CTGCTGATATCCAGGCAAACAGG + Intergenic
944033806 2:195268997-195269019 CTGGTGATATCCAGGCAAACAGG - Intergenic
944454896 2:199883276-199883298 CAGAGGATATGTAGGAAAGCTGG + Intergenic
944570101 2:201035875-201035897 CTGCTGATATCCAGGCAAACAGG - Intronic
945355288 2:208832439-208832461 CTGCTGATACCCAGGCAAGCAGG + Intronic
945672205 2:212815867-212815889 CTATGGATTTCAAGGGAAGCAGG + Intergenic
946026456 2:216674623-216674645 CTGAAGATATCCAGGAAAGGGGG - Exonic
946688543 2:222294439-222294461 ATGAGGATGTCCAGAGATGCAGG - Intronic
946891194 2:224278838-224278860 CTCAGAATCTCCAGGGAAACAGG - Intergenic
947168041 2:227282492-227282514 AAGAGGATATCCAGGAAATCCGG + Exonic
947797501 2:232904224-232904246 GTGAGGCTCTCCAGGGGAGCAGG - Intronic
947952034 2:234156404-234156426 ATGAGGATAGTCAGGGAGGCAGG + Intergenic
948209852 2:236184932-236184954 CTGAGGCTGTGCAGGGCAGCAGG - Intergenic
948606451 2:239138869-239138891 CGGAGGCTTTCCAGGGCAGCAGG - Intronic
1169659005 20:7957809-7957831 CTGATGATACCCAGGAAAACAGG - Intergenic
1169669219 20:8076519-8076541 CTCTGGATCTCCTGGGAAGCAGG - Intergenic
1170085959 20:12531824-12531846 CTGAGGATGTAAAGGAAAGCAGG + Intergenic
1170660452 20:18333784-18333806 CTGCTGATATCCAGGCAAACAGG + Intergenic
1171606900 20:26840287-26840309 CTGAGGATTTCTTGGGAAACGGG + Intergenic
1171609500 20:26879380-26879402 CTGAGGATTTCTTGGGAAACGGG + Intergenic
1171609978 20:26886519-26886541 TTGAGGATTTCCTGGGAAACGGG + Intergenic
1171610957 20:26901133-26901155 TTGAGGATTTCCTGGGAAACGGG + Intergenic
1171670810 20:27798502-27798524 TTGAGGATTTCCTGGGAAACGGG + Intergenic
1171690576 20:28094794-28094816 TTGAGGATTTCCTGGGAAACGGG + Intergenic
1171695212 20:28163811-28163833 TTGAGGATTTCCTGGGAAACGGG + Intergenic
1171706537 20:28334958-28334980 TTGAGGATTTCCTGGGAAACGGG + Intergenic
1173575938 20:44113046-44113068 CTGAGGCCTCCCAGGGAAGCTGG - Exonic
1174503371 20:51001546-51001568 CTGGGGTTGTGCAGGGAAGCCGG - Intergenic
1174537222 20:51260594-51260616 CATAGGTAATCCAGGGAAGCGGG - Intergenic
1174568979 20:51487658-51487680 CTGAGGAAATGCAGGACAGCCGG + Intronic
1175222492 20:57425472-57425494 CTGAGGAACTGCAGGGAGGCCGG + Intergenic
1175603015 20:60290067-60290089 CTGAGGCTGTGCAGGGTAGCGGG + Intergenic
1176480403 21:7281099-7281121 CTGCTGATATCCAGGCAAACAGG + Intergenic
1176944831 21:14966802-14966824 GTGAAGTTATCCAGGGAAACAGG + Exonic
1177087513 21:16725362-16725384 ATAAGGAAAGCCAGGGAAGCAGG + Intergenic
1177232824 21:18344409-18344431 ATGAGGATATCTAGAGATGCTGG + Intronic
1177406333 21:20673219-20673241 CTGAGGCTATGCAGGATAGCAGG - Intergenic
1178473055 21:32911872-32911894 CTGAGGTTTCCCAGGGAAGAAGG - Intergenic
1179011760 21:37561883-37561905 CTGATGTGATCCAGGGAAGGCGG - Intergenic
1179393075 21:41011346-41011368 CTGGGGATCTCCCCGGAAGCAGG - Intergenic
1180326134 22:11432321-11432343 CTGCTGATATCCAGGCAAACAGG - Intergenic
1180767466 22:18353774-18353796 CTGAGGTTTCCCAGAGAAGCAGG + Intergenic
1180778840 22:18508608-18508630 CTGAGGTTTCCCAGAGAAGCAGG - Intergenic
1180811562 22:18765929-18765951 CTGAGGTTTCCCAGAGAAGCAGG - Intergenic
1181197715 22:21200177-21200199 CTGAGGTTTCCCAGAGAAGCAGG - Intergenic
1181395860 22:22621109-22621131 CTGAGGTTTCCCAGAGAAGCAGG + Intergenic
1181583893 22:23842487-23842509 CTGAGGATATCCCGGGGCTCCGG - Intergenic
1181647518 22:24241459-24241481 CTGAGGTTTCCCAGAGAAGCAGG - Intronic
1181703986 22:24636724-24636746 CTGAGGTTTCCCAGAGAAGCAGG + Intergenic
1182023250 22:27098543-27098565 CAGAGGATATCCAAGGACCCTGG + Intergenic
1182162231 22:28134078-28134100 CTGCTGATATCCAGGCAAACAGG + Intronic
1182232138 22:28846391-28846413 CTCAGGAAAGCCAGGGAAGGTGG + Intergenic
1184547306 22:45180016-45180038 CTGAGGATATACTTGAAAGCAGG - Intronic
1203229088 22_KI270731v1_random:94658-94680 CTGAGGTTTCCCAGAGAAGCAGG + Intergenic
949109287 3:239140-239162 TTGATGATGTCCAGTGAAGCCGG - Intronic
949683316 3:6540789-6540811 CTGATGATACCCAGGCAAACAGG - Intergenic
949738341 3:7200330-7200352 ATCAGAATATCCAGGGAAGGGGG + Intronic
949743999 3:7267598-7267620 ATGAGTATAACCAGGGAAGAAGG + Intronic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
951469028 3:23035707-23035729 CTGGTGATATCCAGGCAAACAGG - Intergenic
951474648 3:23092581-23092603 CTGCTGATATCCAGGCAAACAGG - Intergenic
951503570 3:23417351-23417373 CTGATGATACCCAGGCAAACAGG - Intronic
952289717 3:32003460-32003482 CTGAGGACATTTAGGGAACCAGG + Intronic
953315958 3:41926188-41926210 CTGGTGATATCCAGGCAAACAGG + Intronic
953972699 3:47359518-47359540 CTGAGGGTGTGCAGGGCAGCAGG - Intergenic
954794168 3:53153101-53153123 CTGGGGATAGCCAGGGGACCTGG + Intergenic
954850012 3:53592293-53592315 GTGAGGATAGCCAGGGCAGAGGG + Intronic
955048916 3:55389576-55389598 CTGCTGATATCCAGGCAAACAGG + Intergenic
955099463 3:55832476-55832498 CTGCGGATACCCAGGCAAACAGG + Intronic
956268865 3:67428310-67428332 CTGGTGATATCCAGGCAAACAGG + Intronic
957604075 3:82375573-82375595 CTGATGATACCCAGGCAAACAGG - Intergenic
957747589 3:84365566-84365588 CTGGTGATACCCAGGGAAACAGG - Intergenic
959823890 3:110769683-110769705 CTGGTGATATCCAGGCAAACAGG + Intergenic
960278262 3:115751710-115751732 CTGGTGATATCCAGGCAAACAGG + Intergenic
960508164 3:118517581-118517603 CTGTTGATATCCAGGCAAACAGG + Intergenic
961160348 3:124718902-124718924 CTGCAGAGATCCAAGGAAGCAGG - Intronic
961171199 3:124799019-124799041 CTGAGGATAGCTAGGGGAGCAGG + Intronic
961314962 3:126028288-126028310 CTGAGGCTGTGCAGGGCAGCAGG - Intronic
961992990 3:131212269-131212291 CTGGTGATACCCAGGGAAACAGG - Intronic
961995251 3:131235309-131235331 CTGATGATAGCTAGGGAAACAGG - Intronic
962177967 3:133174545-133174567 CTGCTGATACCCAGGGAAACAGG + Intronic
962642271 3:137400125-137400147 CTGGTGATATCCAGGCAAACAGG - Intergenic
962699293 3:137980697-137980719 CTGCGGATACCCAGGCAAACAGG + Intergenic
963233138 3:142929350-142929372 CTGAGGATCTGCAAGGAAGCAGG + Intergenic
963281581 3:143389783-143389805 CTGGGAATATTCATGGAAGCTGG + Intronic
963401640 3:144806296-144806318 CTGATGATACCCAGGCAAGAAGG - Intergenic
963898762 3:150712982-150713004 CTGATGATATCCAGGGAAACAGG + Intergenic
964896226 3:161599595-161599617 CTGAGGAGTCCCAGGGATGCAGG - Intergenic
964904928 3:161707913-161707935 CTGGTGATATCCAGGTAAACAGG + Intergenic
965290481 3:166872778-166872800 CTGAGGCTGTGCAGGGCAGCGGG - Intergenic
966361222 3:179131982-179132004 CTGTGGATACCCAGGCAAACAGG - Intergenic
967094473 3:186165521-186165543 CTGAGGACGTCCAAGGAGGCTGG - Intronic
967181401 3:186908839-186908861 CTGGTGATATCCAGGCAAACAGG - Intergenic
968512616 4:1002246-1002268 CTGCGGGTGTCCAGGGCAGCTGG - Intronic
969000401 4:3976176-3976198 CTGAGAAAATGCAGGGAAGGTGG - Intergenic
969151706 4:5175575-5175597 CTGCTGATACCCAGGGAAACGGG - Intronic
969323033 4:6424541-6424563 CTGTGGATACACAGGGAGGCCGG + Intronic
969510219 4:7613408-7613430 CTGAGAATGTCAAGGGAAGCAGG + Intronic
969572138 4:8015374-8015396 CTGAGGCTCCCCAGGGGAGCCGG - Intronic
972685684 4:41350280-41350302 CTGGTGATACCCAGGGAAACAGG + Intergenic
972976607 4:44643668-44643690 CTGAGGCTATGAAGGGAAGAGGG - Intronic
973013796 4:45110408-45110430 CTGGTGATATCCAGGCAAACAGG - Intergenic
973404486 4:49712521-49712543 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973404994 4:49720856-49720878 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973405386 4:49727320-49727342 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973406257 4:49741450-49741472 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973406455 4:49744682-49744704 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973406653 4:49747913-49747935 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973406854 4:49751145-49751167 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973407000 4:49753529-49753551 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973407203 4:49756760-49756782 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973407400 4:49759995-49760017 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973407793 4:49766455-49766477 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973407986 4:49769687-49769709 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973408381 4:49776148-49776170 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973408575 4:49779382-49779404 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973408770 4:49782616-49782638 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973409117 4:49788393-49788415 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973409425 4:49793492-49793514 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973409618 4:49796723-49796745 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973409854 4:49800633-49800655 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973410024 4:49803351-49803373 CTGAGGATTTCGTTGGAAGCAGG + Intergenic
973410445 4:49810326-49810348 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973410562 4:49812368-49812390 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973410760 4:49815600-49815622 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973410958 4:49818830-49818852 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973411155 4:49822061-49822083 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973411352 4:49825292-49825314 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973411670 4:49830565-49830587 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973411866 4:49833797-49833819 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973411917 4:49834646-49834668 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973412063 4:49837030-49837052 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973412212 4:49839415-49839437 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973413183 4:49855558-49855580 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973413378 4:49858788-49858810 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973413574 4:49862017-49862039 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973413768 4:49865247-49865269 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973413966 4:49868476-49868498 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973414163 4:49871709-49871731 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973414361 4:49874941-49874963 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973414519 4:49877495-49877517 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973414719 4:49880725-49880747 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973414920 4:49883957-49883979 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973415767 4:49898058-49898080 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973416183 4:49905028-49905050 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973416382 4:49908260-49908282 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973416578 4:49911488-49911510 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973416724 4:49913871-49913893 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973416923 4:49917101-49917123 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973417071 4:49919481-49919503 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973417350 4:49924071-49924093 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973417546 4:49927300-49927322 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973417725 4:49930349-49930371 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973417921 4:49933584-49933606 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973418121 4:49936813-49936835 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973418309 4:49940039-49940061 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973418507 4:49943271-49943293 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973419221 4:49955328-49955350 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973419419 4:49958561-49958583 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973419817 4:49965019-49965041 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973420011 4:49968250-49968272 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973420212 4:49971484-49971506 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973420409 4:49974713-49974735 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973420907 4:49983035-49983057 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973421057 4:49985421-49985443 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973421255 4:49988653-49988675 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973421450 4:49991883-49991905 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973421648 4:49995114-49995136 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973421848 4:49998347-49998369 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973421997 4:50000893-50000915 CTGAGGATTTCGTTGGAAGCAGG + Intergenic
973422295 4:50005825-50005847 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973422565 4:50010411-50010433 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973422799 4:50014325-50014347 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973422997 4:50017555-50017577 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973423199 4:50020786-50020808 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973423392 4:50024016-50024038 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973423897 4:50032349-50032371 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973424554 4:50043225-50043247 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973424705 4:50045770-50045792 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973424861 4:50048322-50048344 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973425199 4:50053936-50053958 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973425472 4:50058361-50058383 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973425665 4:50061593-50061615 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973425857 4:50064821-50064843 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973426053 4:50068051-50068073 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973426445 4:50074513-50074535 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973426793 4:50080299-50080321 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973427184 4:50086761-50086783 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973427459 4:50091355-50091377 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973427652 4:50094585-50094607 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973428151 4:50102918-50102940 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973428352 4:50106148-50106170 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973428551 4:50109380-50109402 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973429176 4:50119751-50119773 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973429372 4:50122980-50123002 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973429571 4:50126213-50126235 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973430062 4:50134542-50134564 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973430219 4:50137095-50137117 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973430416 4:50140327-50140349 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973430612 4:50143556-50143578 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973430811 4:50146790-50146812 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973431805 4:50163453-50163475 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973432002 4:50166686-50166708 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973432201 4:50169918-50169940 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973432394 4:50173149-50173171 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973432592 4:50176379-50176401 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973432789 4:50179611-50179633 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973432869 4:50180968-50180990 TTGAGGATATCGTTGGAAGCGGG + Intergenic
973433463 4:50191173-50191195 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973433657 4:50194403-50194425 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973434163 4:50202736-50202758 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973434743 4:50212428-50212450 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973434935 4:50215656-50215678 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973435441 4:50223985-50224007 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973435638 4:50227216-50227238 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973435838 4:50230447-50230469 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973436043 4:50233680-50233702 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973436201 4:50236233-50236255 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973436398 4:50239464-50239486 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973436599 4:50242695-50242717 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973436998 4:50249164-50249186 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973437448 4:50256813-50256835 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973437645 4:50260044-50260066 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973437842 4:50263275-50263297 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973438039 4:50266507-50266529 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973438485 4:50274144-50274166 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973438764 4:50278730-50278752 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973438961 4:50281960-50281982 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973439158 4:50285190-50285212 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973439357 4:50288424-50288446 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973439558 4:50291658-50291680 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973439756 4:50294890-50294912 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973439950 4:50298120-50298142 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973440095 4:50300504-50300526 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973440294 4:50303733-50303755 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973440567 4:50308326-50308348 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973440916 4:50314108-50314130 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973441418 4:50322274-50322296 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973441610 4:50325508-50325530 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973441808 4:50328740-50328762 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973442002 4:50331969-50331991 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973442255 4:50336050-50336072 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973442455 4:50339282-50339304 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973443026 4:50348797-50348819 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973443226 4:50352026-50352048 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973443421 4:50355256-50355278 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973443617 4:50358492-50358514 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973443817 4:50361722-50361744 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973444205 4:50368182-50368204 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973444400 4:50371412-50371434 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973444893 4:50379738-50379760 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973445090 4:50382969-50382991 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973445235 4:50385354-50385376 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973445379 4:50387906-50387928 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973445718 4:50393683-50393705 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973446279 4:50403199-50403221 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973446476 4:50406431-50406453 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973446863 4:50412889-50412911 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973447444 4:50422583-50422605 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973447640 4:50425812-50425834 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973447784 4:50428190-50428212 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973448088 4:50433285-50433307 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973448244 4:50435835-50435857 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973448436 4:50439065-50439087 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973448631 4:50442298-50442320 CTGAGGATTTCGTTGGAAGCAGG + Intergenic
973448829 4:50445530-50445552 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973449026 4:50448759-50448781 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973449187 4:50451312-50451334 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973449469 4:50455905-50455927 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973449669 4:50459139-50459161 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973450083 4:50466110-50466132 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973450895 4:50479355-50479377 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973451538 4:50490236-50490258 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973451736 4:50493466-50493488 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973452439 4:50505201-50505223 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973452637 4:50508431-50508453 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973452910 4:50513024-50513046 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973453110 4:50516255-50516277 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973453307 4:50519486-50519508 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973453506 4:50522716-50522738 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973453742 4:50526459-50526481 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973454088 4:50532240-50532262 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973454279 4:50535468-50535490 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973454427 4:50538018-50538040 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973454919 4:50546345-50546367 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973455223 4:50551440-50551462 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973455610 4:50557907-50557929 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973456276 4:50568793-50568815 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973456480 4:50572024-50572046 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973456685 4:50575257-50575279 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973457045 4:50581208-50581230 CTGAGGATTTCGTTGGAAGCAGG + Intergenic
973457167 4:50583248-50583270 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973457368 4:50586477-50586499 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973457566 4:50589706-50589728 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973457715 4:50592088-50592110 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973457797 4:50593447-50593469 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973457994 4:50596680-50596702 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973458389 4:50603144-50603166 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973458746 4:50608928-50608950 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973458938 4:50612161-50612183 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973459335 4:50618627-50618649 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973459530 4:50621857-50621879 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973459842 4:50626959-50626981 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973460045 4:50630191-50630213 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973460550 4:50638524-50638546 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973460691 4:50640906-50640928 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973461173 4:50648734-50648756 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973461370 4:50651962-50651984 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973461568 4:50655195-50655217 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973461765 4:50658426-50658448 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973461953 4:50661650-50661672 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973462109 4:50664202-50664224 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973462306 4:50667433-50667455 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973462659 4:50673211-50673233 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973462859 4:50676447-50676469 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973463163 4:50681543-50681565 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973463750 4:50691237-50691259 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973463894 4:50693619-50693641 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973464091 4:50696848-50696870 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973464249 4:50699398-50699420 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973464403 4:50701953-50701975 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973464609 4:50705185-50705207 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973464807 4:50708420-50708442 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973465002 4:50711650-50711672 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973465198 4:50714879-50714901 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973465428 4:50718788-50718810 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973465581 4:50721170-50721192 CTGAGGATTTCGTAGGAAGCGGG + Intergenic
973466122 4:50730182-50730204 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973466280 4:50732736-50732758 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973466518 4:50736650-50736672 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973466717 4:50739880-50739902 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973467111 4:50746342-50746364 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973467372 4:50750766-50750788 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973467525 4:50753312-50753334 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973467676 4:50755863-50755885 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973467727 4:50756710-50756732 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973467856 4:50758894-50758916 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973468053 4:50762122-50762144 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973468251 4:50765352-50765374 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973468530 4:50769942-50769964 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973468729 4:50773175-50773197 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973468925 4:50776404-50776426 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973469071 4:50778951-50778973 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973469274 4:50782178-50782200 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973469554 4:50786771-50786793 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973469749 4:50790001-50790023 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973470146 4:50796457-50796479 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973470342 4:50799688-50799710 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973470675 4:50805305-50805327 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973470937 4:50809732-50809754 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973471133 4:50812964-50812986 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973471405 4:50817386-50817408 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973471599 4:50820615-50820637 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973471913 4:50825714-50825736 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973472494 4:50835412-50835434 CTGAGGATTTCTTTGGAAGCGGG + Intergenic
973472928 4:50842548-50842570 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973473078 4:50844929-50844951 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973473278 4:50848159-50848181 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973473559 4:50852748-50852770 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973473643 4:50854106-50854128 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973474031 4:50860554-50860576 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973474227 4:50863784-50863806 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973474380 4:50866332-50866354 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973474538 4:50868881-50868903 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973474739 4:50872111-50872133 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973475181 4:50879759-50879781 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973475689 4:50888094-50888116 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973476036 4:50893874-50893896 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973476232 4:50897107-50897129 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973476429 4:50900343-50900365 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973476627 4:50903572-50903594 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973476815 4:50906801-50906823 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973476964 4:50909348-50909370 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973477162 4:50912585-50912607 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973477307 4:50915131-50915153 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973477614 4:50920395-50920417 TTGAGGATATCGTTGGAAGCGGG + Intergenic
973477773 4:50922945-50922967 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973478202 4:50929916-50929938 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973478409 4:50933315-50933337 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973478557 4:50935696-50935718 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973478709 4:50938246-50938268 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973478788 4:50939605-50939627 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973478985 4:50942836-50942858 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973479189 4:50946069-50946091 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973479583 4:50952528-50952550 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973479778 4:50955758-50955780 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973479899 4:50957801-50957823 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973480163 4:50962224-50962246 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973480313 4:50964768-50964790 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973480822 4:50973103-50973125 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973481015 4:50976333-50976355 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973481211 4:50979565-50979587 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973481709 4:50987901-50987923 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973481910 4:50991132-50991154 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973482338 4:50998269-50998291 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973482545 4:51001843-51001865 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973482701 4:51004391-51004413 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973482901 4:51007620-51007642 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973483514 4:51017825-51017847 CTGAGGATTTCATTGGAAGCGGG + Intergenic
973483947 4:51024967-51024989 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973484529 4:51034653-51034675 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973484625 4:51036183-51036205 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973484777 4:51038733-51038755 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973485172 4:51045199-51045221 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973485521 4:51050984-51051006 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973485717 4:51054213-51054235 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973485920 4:51057446-51057468 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973486264 4:51063229-51063251 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973486465 4:51066463-51066485 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973486661 4:51069693-51069715 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973486853 4:51072925-51072947 CTGAGGATTTCGTTGGAAGCTGG + Intergenic
973487081 4:51076668-51076690 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973487279 4:51079899-51079921 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973487665 4:51086358-51086380 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973487864 4:51089590-51089612 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973488007 4:51091971-51091993 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973488208 4:51095206-51095228 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973488360 4:51097753-51097775 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973488439 4:51099112-51099134 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973488987 4:51108313-51108335 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973489141 4:51110863-51110885 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973489331 4:51114092-51114114 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973489595 4:51118510-51118532 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973489745 4:51120892-51120914 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973490152 4:51127360-51127382 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973490305 4:51129909-51129931 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973490499 4:51133139-51133161 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973490896 4:51139596-51139618 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973491186 4:51144188-51144210 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973491390 4:51147419-51147441 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973491704 4:51152523-51152545 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973491818 4:51154398-51154420 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973492138 4:51159668-51159690 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973492328 4:51162898-51162920 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973492869 4:51171919-51171941 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973493261 4:51178383-51178405 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973493454 4:51181616-51181638 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973493648 4:51184851-51184873 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973493915 4:51189270-51189292 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973494044 4:51191310-51191332 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973494309 4:51195729-51195751 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973494697 4:51202193-51202215 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973494891 4:51205419-51205441 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973495743 4:51219538-51219560 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973496132 4:51226001-51226023 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973496686 4:51235023-51235045 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973497283 4:51244719-51244741 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973497836 4:51253739-51253761 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973498035 4:51256970-51256992 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973498383 4:51262746-51262768 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973498754 4:51269039-51269061 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973498881 4:51271079-51271101 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973499074 4:51274311-51274333 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973499574 4:51282637-51282659 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973499919 4:51288419-51288441 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973500460 4:51297423-51297445 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973500631 4:51300144-51300166 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973500976 4:51305927-51305949 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973501173 4:51309157-51309179 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973501448 4:51313578-51313600 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973502986 4:51339090-51339112 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973503184 4:51342322-51342344 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973503381 4:51345550-51345572 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973503581 4:51348779-51348801 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973503778 4:51352013-51352035 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973504124 4:51357791-51357813 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973504318 4:51361023-51361045 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973504519 4:51364255-51364277 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973504716 4:51367486-51367508 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973504996 4:51371909-51371931 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973505348 4:51377695-51377717 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973505810 4:51385345-51385367 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973506008 4:51388574-51388596 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973506213 4:51391808-51391830 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973506412 4:51395042-51395064 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973506678 4:51399463-51399485 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973506878 4:51402695-51402717 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973507077 4:51406099-51406121 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973507419 4:51411716-51411738 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973507572 4:51414265-51414287 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973508320 4:51426661-51426683 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973508517 4:51429897-51429919 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973508679 4:51432449-51432471 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973509148 4:51440112-51440134 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973509495 4:51445901-51445923 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973509758 4:51450320-51450342 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973510110 4:51456102-51456124 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973510304 4:51459335-51459357 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973510499 4:51462563-51462585 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973510724 4:51466304-51466326 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973511122 4:51472772-51472794 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973511251 4:51474811-51474833 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973511403 4:51477364-51477386 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973511590 4:51480597-51480619 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973512321 4:51492843-51492865 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973512524 4:51496078-51496100 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973512726 4:51499309-51499331 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973512811 4:51500667-51500689 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973512938 4:51502705-51502727 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973513340 4:51509168-51509190 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973514060 4:51520905-51520927 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973514261 4:51524142-51524164 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973514413 4:51526693-51526715 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973514750 4:51532305-51532327 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973515140 4:51538773-51538795 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973515489 4:51544557-51544579 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973515682 4:51547791-51547813 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973516137 4:51555276-51555298 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973516333 4:51558506-51558528 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973516690 4:51564284-51564306 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973516882 4:51567511-51567533 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973517076 4:51570743-51570765 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973517276 4:51573972-51573994 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973517467 4:51577201-51577223 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973517666 4:51580427-51580449 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973517867 4:51583659-51583681 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973518195 4:51588939-51588961 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973518319 4:51590981-51591003 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973518897 4:51600506-51600528 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973519049 4:51603056-51603078 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973519336 4:51607646-51607668 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973519530 4:51610881-51610903 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973519729 4:51614114-51614136 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973519856 4:51616157-51616179 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973519983 4:51618194-51618216 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973520177 4:51621422-51621444 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973520654 4:51629242-51629264 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973520850 4:51632476-51632498 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973521043 4:51635710-51635732 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973521452 4:51642526-51642548 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973521649 4:51645755-51645777 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973521921 4:51650177-51650199 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973522120 4:51653411-51653433 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973522267 4:51655962-51655984 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973522472 4:51659193-51659215 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973522663 4:51662424-51662446 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973522866 4:51665661-51665683 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973523287 4:51672472-51672494 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973523679 4:51678936-51678958 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973523832 4:51681481-51681503 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973524031 4:51684717-51684739 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973524418 4:51691175-51691197 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973524556 4:51693215-51693237 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973524876 4:51698486-51698508 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973525418 4:51707333-51707355 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973525621 4:51710556-51710578 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973525700 4:51711915-51711937 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973526023 4:51717194-51717216 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973526292 4:51721619-51721641 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973526497 4:51724850-51724872 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973526690 4:51728083-51728105 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973526886 4:51731314-51731336 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973527214 4:51736588-51736610 CTGAGGATTTCGTTGGAAGCGGG + Intergenic
973667610 4:53178367-53178389 CTGATGATACCCAGGCAAACAGG + Intronic
973715129 4:53669118-53669140 CTGATGATACCCAGGCAAACAGG - Intronic
973806758 4:54534210-54534232 CTGCTGATATCCAGGCAAACAGG - Intergenic
973883618 4:55297971-55297993 CTGGTGATACCCAGGGAAACAGG + Intergenic
974280117 4:59780972-59780994 CTGGTGATACCCAGGGAAACAGG + Intergenic
974302157 4:60082126-60082148 CTGGGGATATCCAGACAAACAGG + Intergenic
974350369 4:60736500-60736522 CTGCTGATATCCAGGCAAACAGG - Intergenic
974560175 4:63506792-63506814 CTGGTGATATCCAGGAAAACAGG + Intergenic
975076228 4:70212508-70212530 CTGATGATACCCAGGCAAACAGG - Intergenic
975187283 4:71418965-71418987 CTGCGGATACCCAGGCAAACAGG - Intronic
976445882 4:85129425-85129447 CTGGTGATATCCAGGTAAACAGG - Intergenic
976477876 4:85506026-85506048 CTGATGATACCCAGGCAAACAGG - Intronic
977210173 4:94209051-94209073 CTGAGGACATCCAGGAAGTCAGG - Intronic
977452759 4:97219930-97219952 ATGAGTATTTCCAGGAAAGCAGG + Intronic
978041183 4:104064705-104064727 CTGAGGATATGCAGTGAACTCGG - Intergenic
978206898 4:106090321-106090343 CTGAGGCTGTGCAGGGAAGTGGG + Intronic
978278236 4:106978041-106978063 CTGGTGATATCCAGGCAAACAGG - Intronic
979043771 4:115835086-115835108 CTGGTGATATCCAGGCAAACAGG + Intergenic
979934137 4:126670575-126670597 CTGGGGATACCCAGGCAAACAGG + Intergenic
980260517 4:130442174-130442196 CTGGTGATATCCAGGCAAACAGG - Intergenic
980542119 4:134208632-134208654 CTGCTGATATCCAGGCAAACAGG + Intergenic
981441873 4:144792448-144792470 CTGCTGATATCCAGGCAAACAGG + Intergenic
981859759 4:149340851-149340873 CTGATGATACCCAGGCAAACAGG - Intergenic
982087591 4:151852042-151852064 CTGAGGAGATGCACAGAAGCTGG + Intergenic
982479547 4:155892454-155892476 CTGCTGATATCCAGGCAAACAGG + Intronic
982625383 4:157760115-157760137 CTGGTGATACCCAGGTAAGCAGG - Intergenic
982733512 4:158980543-158980565 CTGGTGATATCCAGGCAAACAGG + Intronic
983044415 4:162969166-162969188 CTGGTGATATCCAGGCAAACAGG - Intergenic
983181094 4:164649912-164649934 CTGCAGATACCCAGGGAAACAGG + Intergenic
983377568 4:166949613-166949635 CTGTGGATACCCAGGCAAACAGG - Intronic
983668374 4:170207939-170207961 CTGGTGATACCCAGGCAAGCAGG + Intergenic
984372490 4:178884751-178884773 CTGGTGATACCCAGGCAAGCAGG + Intergenic
985362044 4:189185922-189185944 CTAAGGTTCTCCAGGGAGGCAGG + Intergenic
986385739 5:7231453-7231475 CTGCTGATACCCAGGGAAACAGG + Intergenic
986879680 5:12154338-12154360 CTGGTGATACCCAGGCAAGCAGG + Intergenic
987184053 5:15396984-15397006 CTGCGGATACCCAGGCAAACAGG + Intergenic
987188577 5:15450507-15450529 CTGAGGATACCCATAGAAGATGG + Intergenic
987445063 5:18006852-18006874 CTGGTGATACCCAGGCAAGCAGG + Intergenic
987656625 5:20815468-20815490 CTGGTGATATCCAGGCAAACAGG + Intergenic
988375330 5:30428626-30428648 CTGCGGATACCCAGGCAAACAGG - Intergenic
988766927 5:34388477-34388499 CTGGTGATATCCAGGCAAACAGG - Intergenic
988775069 5:34469929-34469951 CTGATGATATCCAGGCAAATAGG + Intergenic
989337606 5:40336730-40336752 CTGGTGATACCCAGGGAAACAGG + Intergenic
989345216 5:40422492-40422514 CTGGTGATATCCAGGCAAACAGG - Intergenic
989623065 5:43403378-43403400 CTGGTGATATCCAGGCAAACAGG + Intronic
989779051 5:45243108-45243130 CTGCGGATACCCAGGCAAACAGG - Intergenic
990084051 5:51952598-51952620 CTGCTGATATCCAGGCAAACAGG + Intergenic
990443549 5:55870642-55870664 CTGAGGCCATCAAGGGGAGCTGG - Intronic
990692249 5:58377135-58377157 CTGCTGATATCCAGGCAAGCAGG - Intergenic
990748852 5:58990077-58990099 CTGAGAAGATCCAGGGACTCTGG + Intronic
990860306 5:60319756-60319778 CTGCTGATACCCAGGGAAACAGG - Intronic
991973641 5:72164716-72164738 CTGAGGATATGCAGAGGAGCTGG - Intronic
992199377 5:74368716-74368738 ATTAGGATTTCCAGGGAAACTGG + Intergenic
992911364 5:81398906-81398928 CTGGGGAAAGCCAGGGAGGCAGG - Intergenic
993674052 5:90795836-90795858 CTGGTGATATCCAGGCAAACAGG + Intronic
993861868 5:93145987-93146009 CTGAGTGTATGCAGGGGAGCTGG - Intergenic
994255051 5:97582590-97582612 CTGAGGATAACCAAGGAAAGTGG - Intergenic
995093829 5:108212615-108212637 CTGGTGATATCCAGGCAAACAGG - Intronic
995132726 5:108647523-108647545 CTGAGGCTGCTCAGGGAAGCAGG - Intergenic
995489767 5:112678800-112678822 CTGATGATACCCAGGCAAACTGG - Intergenic
995564158 5:113416073-113416095 CTGGTGATATCCAGGCAAACAGG - Intronic
996187111 5:120490926-120490948 CTGCTGATATCCAGGCAAACAGG - Intronic
996910788 5:128655273-128655295 CTGGTGATATCCAGGCAAACAGG - Intronic
996964352 5:129290504-129290526 CTGCTGATATCCAGGCAAACAGG - Intergenic
997115597 5:131122907-131122929 CTGAGATTGTCCTGGGAAGCGGG - Intergenic
999485382 5:151989760-151989782 CTGCTGATATCCAGGCAAACAGG + Intergenic
999491450 5:152055431-152055453 CTGGGTATATCCAGGGCAGAAGG + Intergenic
999492143 5:152061630-152061652 CTGGCCATATCCAGGGAAGGGGG + Intergenic
999775780 5:154812087-154812109 CTGGGTATATCAAGGGAAGTTGG + Intronic
999963575 5:156783651-156783673 CTGATGATACCCAGGCAAACAGG + Intergenic
1000069046 5:157721779-157721801 CTGGTGATATCCAGGCAAACAGG + Intergenic
1000376038 5:160583372-160583394 CTGGTGATATCCAGGCAAACAGG - Intronic
1000595761 5:163212820-163212842 CTGGTGATATCCAGGCAAACAGG + Intergenic
1001359090 5:171063433-171063455 CTGCTGATACCCAGGCAAGCAGG - Intronic
1001591809 5:172870769-172870791 CAGAGGAGATCCAGGCAGGCAGG - Intronic
1002542677 5:179916641-179916663 CTGAGGACCACCAGGGGAGCTGG + Intronic
1002640789 5:180629695-180629717 CTGGGACTACCCAGGGAAGCAGG - Exonic
1005908214 6:30284168-30284190 CTGAGGTTGTGCAGGGCAGCAGG + Intergenic
1006093035 6:31639423-31639445 CTGAAGGGATCCAGGGAAGAGGG + Intronic
1007134664 6:39509069-39509091 CTGATGATACCCAGGCAAGCAGG + Intronic
1007361510 6:41360101-41360123 CTGAGGCTGTGCAGGGCAGCAGG - Intergenic
1007700382 6:43762981-43763003 CTCGAGATATTCAGGGAAGCAGG - Intergenic
1007962965 6:45977779-45977801 AAGAGGATTTCCAGGGAAGATGG - Intronic
1008865512 6:56204818-56204840 CTGGTGATATCCAGGCAAACAGG + Intronic
1009290192 6:61870712-61870734 CTGGTGATACCCAGGGAAACAGG + Intronic
1009361308 6:62818063-62818085 CTGGTGATATCCAGGCAAACAGG - Intergenic
1009397229 6:63213543-63213565 ATGAGAATTTCCAGGGAAGAAGG - Intergenic
1009613088 6:65971860-65971882 CTGCTGATACCCAGGGAAACAGG + Intergenic
1009709524 6:67299946-67299968 CTGGTGATATCCAGGCAAACAGG - Intergenic
1009727774 6:67557655-67557677 CTGATGATACCCAGGCAAACAGG - Intergenic
1010105559 6:72163656-72163678 CTGATGATACCCAGGCAAACAGG - Intronic
1010987115 6:82437466-82437488 CTGAGGTTGTCCAAGGCAGCTGG + Intergenic
1011208907 6:84933338-84933360 CTGAGCATATCTAGGGAGGCTGG - Intergenic
1011209249 6:84936850-84936872 CTGATGATACCCAGGCAAACAGG + Intergenic
1011318604 6:86065094-86065116 CTGGTGATATCCAGGCAAACAGG - Intergenic
1011364879 6:86570434-86570456 CTGTGGATACCCAGGCAAACAGG + Intergenic
1011408191 6:87038463-87038485 CTGCTGATATCCAGGCAAACAGG - Intergenic
1012043503 6:94239522-94239544 CTGGTGATATCCAGGCAAACAGG + Intergenic
1012128055 6:95454978-95455000 CTGGTGATATCCAGGCAAACAGG + Intergenic
1012207373 6:96478205-96478227 CCGGTGATATCCAGGGAAACAGG - Intergenic
1012459806 6:99447913-99447935 CTGCTGATATCCAGGCAAACAGG + Intronic
1013068365 6:106705323-106705345 CTGAGTATTGCCAGGGAAGAAGG + Intergenic
1013448962 6:110259833-110259855 CTGTGGATACCCAGGCAAACAGG + Intronic
1016005937 6:139089725-139089747 CTGATGATACCCAGGCAAACAGG - Intergenic
1016483404 6:144507565-144507587 CTGATGATACCCAGGCAAACAGG - Intronic
1017090719 6:150756280-150756302 TTGAGGATCTGCAGGGGAGCAGG - Intronic
1017302954 6:152883483-152883505 CTGATGATACCCAGGCAAACAGG + Intergenic
1018329730 6:162714351-162714373 CTGAGGAGATGCAGGGACACTGG + Intronic
1018776683 6:167023651-167023673 CAGAGGATCACCAAGGAAGCAGG + Intronic
1020331096 7:7017679-7017701 CTGAGGCTCTTCAGTGAAGCAGG + Intergenic
1020344106 7:7144901-7144923 CTGATGATACCCAGGCAAACAGG - Intergenic
1020428712 7:8096979-8097001 CTGATGATACCCAGGCAAGCAGG + Intergenic
1020645599 7:10811175-10811197 CTGCTGATATCCAGGCAAACAGG - Intergenic
1020810059 7:12840348-12840370 CTGGTGATACCCAGGCAAGCAGG + Intergenic
1021604333 7:22395111-22395133 CTGAGTATTGCCAGGGAAGAAGG - Intergenic
1022330135 7:29370877-29370899 CTTAGCAAATCCAGGAAAGCAGG + Intronic
1023455938 7:40339020-40339042 CTGCTGATACCCAGGCAAGCAGG - Intronic
1023651127 7:42370724-42370746 CTGATGATACCCAGGCAAACAGG - Intergenic
1024373344 7:48610852-48610874 CTGAGGTTATGCAGGGCAGTGGG + Intronic
1024729190 7:52235710-52235732 CTGAGGTTGTGCAGGGTAGCAGG - Intergenic
1026534359 7:71227967-71227989 CTATGCATATCCAGGGAAGAAGG - Intronic
1027358276 7:77381623-77381645 CTGAGGGAACCCAGGGAAGCAGG - Intronic
1028200453 7:87955407-87955429 CTGCTGATATCCAGGCAAACAGG - Intronic
1030202544 7:106919631-106919653 CTGGTGATATCCAGGCAAACAGG + Intergenic
1031182145 7:118432774-118432796 CTGAGCTCATGCAGGGAAGCAGG - Intergenic
1034680540 7:152924901-152924923 CTCAGGATATCCACGCATGCTGG - Intergenic
1035352960 7:158259308-158259330 CGGAGAAGAGCCAGGGAAGCAGG + Intronic
1037050071 8:14361985-14362007 CTGGTGATACCCAGGCAAGCAGG - Intronic
1038107596 8:24453923-24453945 CTGCGGATACCCAGGCAAACAGG - Intronic
1038870526 8:31489085-31489107 CTGCTGATATCCAGGCAAACAGG - Intergenic
1039283065 8:36007250-36007272 CTGATGATACCCAGGCAAACAGG + Intergenic
1039488448 8:37929351-37929373 CTGAGTACCTCCAGAGAAGCTGG + Intergenic
1039545761 8:38410052-38410074 CTGAGGAGAGCCAGGGAAGAAGG - Intergenic
1039676698 8:39675929-39675951 CTGGTGATACCCAGGGAAACAGG - Intronic
1039836205 8:41258348-41258370 CTCAGGCACTCCAGGGAAGCGGG + Intergenic
1040175853 8:44487088-44487110 TTGAGGATTTCCATGGAAACGGG + Intergenic
1040446883 8:47504905-47504927 CTGCTGATATCCAGGCAAACAGG - Intronic
1040520006 8:48168668-48168690 CTGATGATACCCAGGCAAACAGG - Intergenic
1040984677 8:53280740-53280762 CTGAGGTTGGCCAGGCAAGCCGG + Intergenic
1041123076 8:54607317-54607339 CTGCGGATACCCAGGCAAACAGG - Intergenic
1041387534 8:57319965-57319987 CTGCTGATACCCAGGCAAGCAGG + Intergenic
1041574818 8:59381676-59381698 CTGGTGATATCCAGGCAAACAGG + Intergenic
1041618316 8:59934358-59934380 CTGTGGATATCTGGGGAAGAGGG + Intergenic
1041855422 8:62447753-62447775 CTTTGGATATCCAAGGAAGGGGG - Intronic
1041999326 8:64103100-64103122 CTACTGATATCCAGGGAAACAGG + Intergenic
1042627393 8:70773269-70773291 ATATGGATATGCAGGGAAGCAGG + Intronic
1042969221 8:74390482-74390504 CTGGTGATACCCAGGGAAACAGG - Intronic
1044028888 8:87210535-87210557 CTGAGGCTATGCAGGGCAGCAGG - Intronic
1044402505 8:91788652-91788674 CTGCTGATACCCAGGGAAACAGG + Intergenic
1044767585 8:95593348-95593370 CTGGTGATATCCAGGCAAACAGG - Intergenic
1045033263 8:98157664-98157686 CTGAGGATAGTCGGGGAGGCCGG + Exonic
1045185080 8:99829900-99829922 CTGGTGATATCCAGGCAAACAGG - Intronic
1046160510 8:110357014-110357036 CTGATGATAACCAGAGTAGCTGG - Intergenic
1046295958 8:112218956-112218978 CTGGTGATACCCAGGGAAACAGG + Intergenic
1046524897 8:115371185-115371207 CTGGTGATATCCAGGCAAACAGG + Intergenic
1046880971 8:119307603-119307625 CTGGTGATATCCAGGCAAACAGG + Intergenic
1047557897 8:125952323-125952345 CTGAGGATTGCCAGGGAAACAGG + Intergenic
1048508670 8:135043070-135043092 CTGAGGACCTCCAGGGCAGCAGG + Intergenic
1048583988 8:135755785-135755807 CTCAGGTTACCCAGAGAAGCAGG - Intergenic
1049082145 8:140451783-140451805 CTGAGGAGTTCCAGGGAGCCCGG - Intronic
1049513881 8:143043495-143043517 CTGAGGCCACCCAGGGAACCAGG + Intronic
1050065041 9:1750395-1750417 CTGCTGATACCCAGGGAAACAGG + Intergenic
1050396643 9:5204886-5204908 CGGAAGATATGCAGGGAAGACGG + Intergenic
1050587511 9:7128223-7128245 CTGAGGATATCGTGGTAAGTAGG + Intergenic
1051223540 9:14875948-14875970 CTGTGGATACCCAGGCAAACAGG - Intronic
1051230560 9:14950566-14950588 CTGGTGATACCCAGGAAAGCAGG + Intergenic
1051674491 9:19546004-19546026 CTGGTGATATCCAGGCAAACAGG - Intronic
1051879327 9:21824375-21824397 CTGCTGATATCCAGGCAAACAGG - Intronic
1052134177 9:24889618-24889640 CTGGAGATATCCAGGCAAACAGG + Intergenic
1052145640 9:25045248-25045270 CTGCTGATATCCAGGCAAACAGG - Intergenic
1052821166 9:33138837-33138859 CTGAGGGAATCCTGAGAAGCAGG - Intronic
1053066787 9:35074712-35074734 CTGAGGATATCGGGGAAACCAGG + Intronic
1053379317 9:37636080-37636102 CTGAGTATATCGAGGGCGGCTGG - Intronic
1053454673 9:38225042-38225064 CTGAGGCTTTCATGGGAAGCAGG - Intergenic
1053714073 9:40864649-40864671 TTGAGGATTTCCATGGAAACGGG + Intergenic
1053965960 9:43644852-43644874 CTGAGGATATCGTTGGAAACGGG + Intergenic
1054424461 9:64994998-64995020 TTGAGGATTTCCATGGAAACGGG + Intergenic
1055537782 9:77267468-77267490 CTGGTGATACCCAGGGAAACAGG - Intronic
1055924467 9:81495575-81495597 CTGAGAATCTACAGGGAAGGGGG + Intergenic
1056021248 9:82440640-82440662 CTGAGGCTGTGCAGGGAAGCTGG - Intergenic
1056552471 9:87663511-87663533 CTGGGGATATCCAGTGAAAGAGG - Intronic
1057281187 9:93712832-93712854 AAGAGAATAGCCAGGGAAGCTGG - Intergenic
1057324639 9:94050487-94050509 CTGCTGATATCCAGGCAAACAGG - Intronic
1057747079 9:97760989-97761011 CTGAGCATATAGAGGTAAGCAGG + Intergenic
1060212989 9:121721865-121721887 CTGAGCATTTTCAGGGCAGCTGG + Intronic
1060334521 9:122709454-122709476 CTGGTGATACCCAGGGAAACAGG + Intergenic
1060447166 9:123700586-123700608 CTGAGGTTTTCCAGAGAAGAAGG - Intronic
1061814242 9:133184347-133184369 CTGAGGATATCCAGTTCTGCTGG - Intergenic
1061872484 9:133528264-133528286 CTGAGGCTACACAGGGAACCAGG - Intronic
1062297704 9:135841688-135841710 CTGGTGATATCCAGGCAAACAGG + Intronic
1203407215 Un_KI270538v1:40795-40817 CTGAGGATTTCCTTGGAAACGGG + Intergenic
1185806298 X:3060149-3060171 CTGGTGATATCCAGGCAAACAGG + Intronic
1186176845 X:6933354-6933376 CTGCGGATACCCAGGCAAACAGG + Intergenic
1186488597 X:9953319-9953341 CTGAGAATATGTAGGGCAGCAGG + Intergenic
1186773218 X:12838658-12838680 CTGGGGATACCCAGGCAAACAGG - Intergenic
1187595873 X:20772002-20772024 CTGGTGATACCCAGGGAAACAGG + Intergenic
1188187486 X:27132044-27132066 ATGAGTATTTCCAGGGAAGAAGG - Intergenic
1188893198 X:35635676-35635698 CTGATGATACCCAGGCAAACAGG - Intergenic
1189899427 X:45690586-45690608 CTGAGGCTGTGCAGGGCAGCAGG - Intergenic
1190505980 X:51126064-51126086 CTGGTGATATCCAGGTAAACAGG + Intergenic
1191155843 X:57271603-57271625 CTGGTGATACCCAGGGAAACAGG + Intergenic
1191296383 X:58870896-58870918 CTGAGGATTTCCTTGGAAACGGG + Intergenic
1191306851 X:59010020-59010042 CTGAGGATTTCCTTGGAAACGGG + Intergenic
1191313769 X:59102452-59102474 CTGAGGATTTCCTTGGAAACGGG + Intergenic
1191333800 X:59370879-59370901 CTGAGGATATCGTTGGAAACGGG + Intergenic
1191379255 X:59978112-59978134 CTGAGGATTTCCTTGGAAACGGG + Intergenic
1191396816 X:60212943-60212965 CTGAGGATTTCCTTGGAAACGGG + Intergenic
1191482637 X:61362205-61362227 CTGAGGATTTCCTTGGAAACGGG + Intergenic
1191505009 X:61661372-61661394 CTGAGGATTTCGATGGAAACGGG + Intergenic
1191513035 X:61768988-61769010 CTGAGGATTTCCTTGGAAACGGG + Intergenic
1191527862 X:61967349-61967371 CTGAGGATATCGATGGAAACGGG + Intergenic
1191628158 X:63291204-63291226 CTGCTGATATCCAGGCAAACAGG - Intergenic
1192243284 X:69351611-69351633 CTGCGGATACCCAGGCAAACAGG + Intergenic
1192454730 X:71267267-71267289 CTGGGAATAGTCAGGGAAGCAGG - Intergenic
1192674672 X:73183216-73183238 CTGGTGATATCCAGGCAAACAGG + Intergenic
1192685879 X:73304856-73304878 CTGCGGATACCCAGGTAAACAGG - Intergenic
1192741105 X:73893354-73893376 CTGGTGATATCCAGGCAAACAGG + Intergenic
1192755078 X:74039210-74039232 CTGCTGATATCCAGGCAAACAGG - Intergenic
1192854924 X:74999279-74999301 CTGTGGATACCCAGGCAAACAGG - Intergenic
1192910731 X:75601769-75601791 CTGAGGATATCCAGGCAAACAGG - Intergenic
1192915961 X:75651771-75651793 CTGATGATACCCAGGCAAACAGG - Intergenic
1193029607 X:76883060-76883082 CTGATGATACCCAGGCAAACAGG + Intergenic
1193244301 X:79210962-79210984 CTGATGATACCCAGGCAAACAGG - Intergenic
1193394569 X:80968442-80968464 CTGGTGATATCCAGGCAAACAGG + Intergenic
1193510108 X:82388916-82388938 CTGGTGATACCCAGGGAAACAGG + Intergenic
1193516985 X:82478261-82478283 CTGAGGATCTGGAGGGAGGCAGG - Intergenic
1193735149 X:85147691-85147713 CTGCTGATACCCAGGGAAACAGG + Intergenic
1194541432 X:95177565-95177587 CTGAGGCTGTCCAGAGCAGCAGG - Intergenic
1195434600 X:104828430-104828452 CTGGTGATATCCAGGCAAACAGG - Intronic
1195856131 X:109335094-109335116 CTGGTGATACCCAGGGAAACAGG - Intergenic
1196180934 X:112688663-112688685 TTGAGGAAATACAGGGAGGCTGG + Intergenic
1198042149 X:132863937-132863959 CTGATGATACCCAGGCAAACAGG + Intronic
1198519095 X:137434207-137434229 CTGGTGATACCCAGGGAAACAGG + Intergenic
1198757131 X:139994281-139994303 CTGCTGATACCCAGGGAAACAGG - Intergenic
1199012088 X:142770075-142770097 CTGATGATACCCAGGCAAACGGG - Intergenic
1199134445 X:144234210-144234232 CTGAGGCTGCCCAGGGAAGTGGG - Intergenic
1199996372 X:153029101-153029123 CTGGGGCTATGCAGGGAAACTGG - Intergenic
1200405852 Y:2810921-2810943 CTGGTGATACCCAGGGAAACAGG - Intergenic
1201633809 Y:16099436-16099458 CTGGTGATACCCAGGGAAACAGG + Intergenic
1201913661 Y:19158877-19158899 CTGGTGATATCCAGGCAAACAGG + Intergenic
1202040281 Y:20675327-20675349 CTGGTGATACCCAGGGAAACAGG + Intergenic