ID: 918566070

View in Genome Browser
Species Human (GRCh38)
Location 1:185933705-185933727
Sequence CTCCAATGACAGATTAGCCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918566070_918566071 6 Left 918566070 1:185933705-185933727 CCTTGGCTAATCTGTCATTGGAG 0: 1
1: 0
2: 0
3: 6
4: 117
Right 918566071 1:185933734-185933756 AGTGTGAAATTCAACGATGCTGG 0: 1
1: 0
2: 0
3: 8
4: 76
918566070_918566072 23 Left 918566070 1:185933705-185933727 CCTTGGCTAATCTGTCATTGGAG 0: 1
1: 0
2: 0
3: 6
4: 117
Right 918566072 1:185933751-185933773 TGCTGGAGAGTATCATTGTATGG 0: 1
1: 0
2: 1
3: 11
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918566070 Original CRISPR CTCCAATGACAGATTAGCCA AGG (reversed) Exonic
900739599 1:4322698-4322720 CTCCAAGGACCTTTTAGCCAGGG + Intergenic
902406795 1:16188724-16188746 CTCCCAGGACAGACTGGCCAAGG - Intergenic
903188730 1:21644385-21644407 CTCCAATCTCAGCTTTGCCAAGG + Intronic
908140021 1:61174520-61174542 CTCCAATGCCAGATGAGACCAGG - Intronic
909852876 1:80491068-80491090 CTACAATCACACATTAGACATGG + Intergenic
910451690 1:87353191-87353213 TTCTAATCACATATTAGCCATGG + Intergenic
918566070 1:185933705-185933727 CTCCAATGACAGATTAGCCAAGG - Exonic
918959352 1:191252479-191252501 CTCCCATCAAAGAATAGCCAAGG - Intergenic
919528836 1:198689865-198689887 CTGCAATGACATTTTAGTCATGG - Intronic
923311758 1:232742464-232742486 CTTCAATGACTGACTATCCATGG + Intergenic
923714167 1:236410955-236410977 CTCCAGAGACATATAAGCCATGG - Intronic
1062913682 10:1231166-1231188 CACCAGGGACATATTAGCCAAGG + Intronic
1063946200 10:11178694-11178716 CTCCAAAGACTGATTAGTCTAGG - Intronic
1066262997 10:33747154-33747176 TTTCAATGACAGATAAGGCAAGG + Intergenic
1067271904 10:44798932-44798954 CTCTGATGACATCTTAGCCATGG - Intergenic
1068368654 10:56085599-56085621 CTCCACTGACAGATGAGACTGGG + Intergenic
1069766427 10:70863910-70863932 CTACACTGACAGATGAGCAAAGG - Intronic
1071112556 10:82176813-82176835 CTCAAATGACATAGTAGCCCAGG + Intronic
1071349399 10:84724478-84724500 CTCCACTGAGACATTAGCAATGG - Intergenic
1074429442 10:113381269-113381291 CTCCTCTGACAGGTGAGCCAAGG + Intergenic
1077995365 11:7448112-7448134 CTGCAAGGAGAGAATAGCCATGG + Intronic
1078858207 11:15223808-15223830 CTGGAAAAACAGATTAGCCAAGG - Intronic
1080008947 11:27438344-27438366 CTCCAATGCCAGATCACCCCTGG - Intronic
1080161880 11:29186126-29186148 CTCCAAAGACATATTTTCCAAGG + Intergenic
1082722185 11:56691746-56691768 TGCCCATGACAAATTAGCCATGG - Intergenic
1082932483 11:58623160-58623182 CTACTAGAACAGATTAGCCATGG + Intronic
1088587097 11:111368920-111368942 CTCCGATGACAGATGGGCCATGG - Intronic
1089429042 11:118405802-118405824 GTTCAAAGACAGATTACCCAAGG - Intronic
1091314967 11:134608133-134608155 CTCCCATGACATTTCAGCCACGG + Intergenic
1091372310 11:135071052-135071074 CACAGATGACAGATAAGCCATGG + Intergenic
1095870926 12:47027133-47027155 CTCCATAGACAGAGCAGCCAAGG - Intergenic
1096551294 12:52374164-52374186 AACCAATGACAGTTTAGCCTGGG - Intergenic
1099339332 12:81408863-81408885 CTCCAATAACAAATTATCCTGGG + Intronic
1101529099 12:105558123-105558145 CTCCAATGCCAAGTCAGCCAAGG + Intergenic
1101529210 12:105558946-105558968 CTCCAATGCCAAGTCAGCCAAGG - Intergenic
1104834870 12:131782782-131782804 CTCCAAAGGCAAATTAGTCATGG + Intronic
1104887227 12:132117706-132117728 CTCCAATCACAGAGCAGCCAGGG + Intronic
1107416350 13:40204601-40204623 CTCCCAAGACAGATTAGAAATGG + Intergenic
1108816299 13:54295602-54295624 CTCCAGTGACCGATTCACCACGG - Intergenic
1109533220 13:63681027-63681049 TGCCAATGACAGTTTAGCCAAGG - Intergenic
1110296270 13:73869881-73869903 CTACAAGGACAAGTTAGCCAGGG - Intronic
1111284678 13:86073833-86073855 ATTCATTGACACATTAGCCAGGG - Intergenic
1111523487 13:89435247-89435269 CTCCAATGTCAGTTTTGGCAGGG + Intergenic
1116211180 14:41946840-41946862 CTCCAATGACTGAAAAGCCTAGG - Intergenic
1118837298 14:69485917-69485939 CTCCACTTACAAATTAGCCTGGG + Intronic
1119788637 14:77330314-77330336 CACCAAGCACAGATCAGCCATGG - Exonic
1121689747 14:95868835-95868857 CTCCAGTGACAGGGAAGCCACGG - Intergenic
1124215799 15:27806485-27806507 CTCCACTGAGAAATTAGCCCAGG - Intronic
1126007009 15:44267399-44267421 CTTTAATGACAGATTAGCATGGG + Intergenic
1128793995 15:70451607-70451629 CTACAAAGACAGGTCAGCCATGG + Intergenic
1133663337 16:7940383-7940405 CTCCAAAGAGAGATTGGCAATGG + Intergenic
1139445439 16:66995453-66995475 TTCCCATGACAGATGGGCCAGGG + Intronic
1140587225 16:76307797-76307819 TTCTAATGACAGAACAGCCAGGG - Intronic
1147898726 17:43769629-43769651 GCTCAATGACAGACTAGCCAAGG - Exonic
1149470667 17:56913241-56913263 CTCCAATGTCAGAGTAGAAAGGG - Intronic
1156185865 18:34662483-34662505 CTCTCATGACTGATTACCCAAGG + Intronic
1157693792 18:49704514-49704536 GTCCAATGAGAGATAAGCCCGGG + Intergenic
1159118068 18:64137648-64137670 CTCCAAAGACAGCTTTGCAAAGG - Intergenic
1161201533 19:3017855-3017877 CTCCACTGACAGATTGGGAATGG + Exonic
927429407 2:23014266-23014288 CTCCATGGGCAGTTTAGCCAAGG + Intergenic
927603900 2:24468917-24468939 CATCAATGACAGATTAGACTTGG + Intergenic
928771814 2:34711534-34711556 TTAAAATGACAGACTAGCCAAGG - Intergenic
930516507 2:52414143-52414165 CTCCACTGACAGAGCATCCAGGG + Intergenic
934771392 2:96909868-96909890 CTCCACTCACAGGTTGGCCAGGG - Intronic
935246168 2:101220311-101220333 CTCCATTTACACATTATCCAGGG + Intronic
937014463 2:118591539-118591561 CTCCTAAGACAGTTTTGCCAAGG - Intergenic
939054186 2:137343257-137343279 CTCCCATCACAGAAAAGCCAAGG - Intronic
941762329 2:169258385-169258407 CACCAATGCCTGATTACCCAGGG - Intronic
941800257 2:169651686-169651708 CTCCAATGATAGAGTAAGCAGGG - Intronic
944857335 2:203780669-203780691 CTACAAAGATACATTAGCCATGG + Intergenic
1175954102 20:62599513-62599535 CTCCCATGACAGAGGAGCCTGGG - Intergenic
1182194232 22:28498037-28498059 TTCCAACGACAGAGTAGCCACGG + Intronic
1182350875 22:29698784-29698806 CTCTAATGACACCTTCGCCAGGG + Intergenic
1184252807 22:43270481-43270503 CTCCAACGACAGCTTCTCCAGGG + Intronic
953229406 3:41051218-41051240 CTCAAATGACAGATAAGGAAGGG - Intergenic
953338773 3:42116663-42116685 CTCTCATGACACATTACCCATGG - Intronic
957514472 3:81232778-81232800 CAGCAATGCCAGATTAGCCTTGG + Intergenic
958829535 3:99070780-99070802 TTCCATTGACAGGTTTGCCAAGG - Intergenic
965690811 3:171355132-171355154 CCCCAAGGACAGAGCAGCCATGG + Intronic
967823848 3:193862969-193862991 CTCCAAAGACTGGTTCGCCAAGG + Intergenic
971645203 4:29190594-29190616 CCCCATTGTCATATTAGCCAAGG - Intergenic
979191078 4:117859507-117859529 CATCAATGACAGATTAGATAAGG + Intergenic
982270700 4:153583738-153583760 CTACAACTACAGATTAGGCATGG + Intronic
982416613 4:155140747-155140769 CTGAAATGGCAGCTTAGCCACGG - Intergenic
982582922 4:157202055-157202077 ATTAAATAACAGATTAGCCAAGG + Intergenic
984138567 4:175973681-175973703 CTCCACTGAGAGGCTAGCCAGGG - Intronic
985970575 5:3375126-3375148 CTCCAAGTACAGTTTAACCAAGG - Intergenic
994055095 5:95405988-95406010 CTCTAAAGAAAGATTAGGCAGGG - Intronic
997074495 5:130656287-130656309 CTCCAATCACTCATTAGGCAGGG + Intergenic
997713712 5:136027367-136027389 CTCCAGTGACAGAAGAGCCCAGG - Intergenic
1001448612 5:171806857-171806879 CTCCGATGACAGAGCACCCACGG - Intergenic
1002071998 5:176684520-176684542 CTCAAATCCCAGATTAGCCATGG + Intergenic
1002656301 5:180750938-180750960 CTCAAATAAAAAATTAGCCAGGG + Intergenic
1002895918 6:1380031-1380053 CGCCTATGAGAGATTACCCAGGG + Intergenic
1007124079 6:39410004-39410026 CTCCACTGACTGATTTGCCCAGG - Intronic
1007950657 6:45869211-45869233 CTTCAAGGACAGTTTAGTCAAGG + Intergenic
1011598314 6:89037402-89037424 CCCCAATGAGACATCAGCCAGGG + Intergenic
1012488501 6:99749970-99749992 TTTCAATGACTGAATAGCCAGGG + Intergenic
1013212288 6:107997881-107997903 CTACAATGCCAGTTTAGGCAGGG - Intergenic
1013331791 6:109109922-109109944 CATCAATGACAGATTAGATAAGG - Intronic
1015414869 6:132936882-132936904 CTCCAATCACAGAGTACCCAGGG + Intergenic
1022602428 7:31773919-31773941 CTACAAAGAGAAATTAGCCAAGG + Intronic
1022947886 7:35305740-35305762 CTATAATGGCATATTAGCCATGG + Intergenic
1023034466 7:36118583-36118605 CTCCAAGGAGAGCCTAGCCATGG + Intergenic
1023274710 7:38505910-38505932 CTCCAATGACAGATCTGGTAGGG - Intronic
1024631287 7:51249479-51249501 CTTCAAAGATAGATTAGACAAGG + Intronic
1027698732 7:81442548-81442570 CTTCAATGACAGAGAAACCATGG - Intergenic
1029654075 7:101912978-101913000 CTACAATGACACATTAACAAGGG - Intronic
1033337887 7:140468790-140468812 ATGCAATGACAAATTAGCAAAGG + Intronic
1033737191 7:144234177-144234199 CTCCAATGACAGCTGGACCAGGG - Intergenic
1033745866 7:144316769-144316791 CTCCAATGACAGCTGGACCAGGG + Intergenic
1033956743 7:146858932-146858954 CTCCAATGCCAGATTCTCCCTGG - Intronic
1035257527 7:157640809-157640831 CTTGCATAACAGATTAGCCAAGG - Intronic
1041296136 8:56359149-56359171 CTCCAATGACAGAAGAGCTGAGG + Intergenic
1044016621 8:87054064-87054086 CTCCATTCACAGATAAGACATGG + Intronic
1045222130 8:100209390-100209412 CTCTAATGATATATTAGTCAGGG - Intronic
1051577860 9:18637827-18637849 CTCTAATTAAAGATGAGCCAAGG - Intronic
1061591199 9:131598705-131598727 CTCCAAGGACCGACTTGCCACGG + Intronic
1188283967 X:28305368-28305390 CTCCAAGAACAGTTTGGCCATGG - Intergenic
1190234815 X:48607222-48607244 CTCCAATGAGAGAGAAGCCCTGG - Exonic
1190688538 X:52894976-52894998 CTCCTATTACAGATGAGGCACGG - Intronic
1190697445 X:52960816-52960838 CTCCTATTACAGATGAGGCACGG + Intronic
1196080880 X:111629611-111629633 ATTCAATGTCAGATGAGCCAGGG + Intergenic
1198039635 X:132837227-132837249 ATCCAATGACTCATTACCCAGGG + Intronic