ID: 918566793

View in Genome Browser
Species Human (GRCh38)
Location 1:185943514-185943536
Sequence CTGAGTCATATCTACAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 136}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918566793_918566800 25 Left 918566793 1:185943514-185943536 CCTTCCTTGTAGATATGACTCAG 0: 1
1: 0
2: 1
3: 13
4: 136
Right 918566800 1:185943562-185943584 TGTACAAAGTATATGGGAGGTGG 0: 1
1: 0
2: 1
3: 19
4: 170
918566793_918566798 19 Left 918566793 1:185943514-185943536 CCTTCCTTGTAGATATGACTCAG 0: 1
1: 0
2: 1
3: 13
4: 136
Right 918566798 1:185943556-185943578 GTGCATTGTACAAAGTATATGGG 0: 1
1: 0
2: 0
3: 12
4: 131
918566793_918566797 18 Left 918566793 1:185943514-185943536 CCTTCCTTGTAGATATGACTCAG 0: 1
1: 0
2: 1
3: 13
4: 136
Right 918566797 1:185943555-185943577 CGTGCATTGTACAAAGTATATGG 0: 1
1: 0
2: 0
3: 3
4: 81
918566793_918566801 26 Left 918566793 1:185943514-185943536 CCTTCCTTGTAGATATGACTCAG 0: 1
1: 0
2: 1
3: 13
4: 136
Right 918566801 1:185943563-185943585 GTACAAAGTATATGGGAGGTGGG 0: 1
1: 0
2: 3
3: 15
4: 151
918566793_918566799 22 Left 918566793 1:185943514-185943536 CCTTCCTTGTAGATATGACTCAG 0: 1
1: 0
2: 1
3: 13
4: 136
Right 918566799 1:185943559-185943581 CATTGTACAAAGTATATGGGAGG 0: 1
1: 0
2: 0
3: 15
4: 185
918566793_918566796 -9 Left 918566793 1:185943514-185943536 CCTTCCTTGTAGATATGACTCAG 0: 1
1: 0
2: 1
3: 13
4: 136
Right 918566796 1:185943528-185943550 ATGACTCAGGTACAGTCAGATGG 0: 1
1: 0
2: 1
3: 13
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918566793 Original CRISPR CTGAGTCATATCTACAAGGA AGG (reversed) Intronic
906124211 1:43416766-43416788 AGGAGTCATATCTAGAAGGTAGG + Intronic
906137556 1:43510188-43510210 CTGAGTCATCTCCAGAAGGGCGG + Intergenic
907781743 1:57573207-57573229 CTGAGTCCTAGCTACTTGGAAGG - Intronic
911781051 1:101879002-101879024 CTGAGGAATATCAACAAGGGAGG + Intronic
913255739 1:116951694-116951716 CTGAGTCATAGGCACAGGGAAGG - Intronic
913373661 1:118128507-118128529 CTGAGTCATTTCTACGAAGCAGG - Intronic
917705313 1:177627153-177627175 CTAATTCACATCTACTAGGATGG + Intergenic
918345546 1:183604369-183604391 CTGACTCAGCTCTTCAAGGAGGG + Intergenic
918566793 1:185943514-185943536 CTGAGTCATATCTACAAGGAAGG - Intronic
919405074 1:197169621-197169643 CTGAGTCATGACTACATTGATGG + Intronic
920113898 1:203606335-203606357 CTGAGTAATTTCTACAAGCTAGG - Intergenic
921560488 1:216652646-216652668 ATCAGTAATATCTCCAAGGAAGG - Intronic
923009000 1:230073509-230073531 CTTAGTCATGTCTACTAGTATGG + Intronic
1067663757 10:48256087-48256109 CTGAGTATTAACTAGAAGGAAGG + Intronic
1068655388 10:59569564-59569586 GTGAGTCCTAGCTACCAGGAAGG + Intergenic
1070529778 10:77326377-77326399 CTGAACCTCATCTACAAGGATGG + Intronic
1076111118 10:127860619-127860641 CTGGGGCATTGCTACAAGGACGG - Intergenic
1078278280 11:9872610-9872632 CTACTTCATATCTACAAGAATGG + Intronic
1079283837 11:19111252-19111274 CTGAGCCATGTCTACAAAGTGGG + Intergenic
1080049019 11:27839428-27839450 ATGATTCACATCAACAAGGAAGG + Intergenic
1080760499 11:35244495-35244517 CTGACTGATACCTGCAAGGATGG + Intergenic
1080768667 11:35320507-35320529 CTGAGTCAGCTCTTGAAGGATGG + Intronic
1081432034 11:42986933-42986955 CTGAGGAAAATGTACAAGGAAGG + Intergenic
1081855245 11:46299244-46299266 CTGAATCATAGCTAGAAGGATGG + Intronic
1083870728 11:65486870-65486892 CTGAGTCCTTTCTACATGGCAGG - Intergenic
1085135957 11:74088497-74088519 CTGTGTCATATATTCAAGGAGGG - Intronic
1088488722 11:110366370-110366392 CTGAGGCATGTTTTCAAGGAGGG + Intergenic
1089219733 11:116860534-116860556 CGGAGGCATGTCTATAAGGAAGG + Intronic
1090530686 11:127588549-127588571 CTAAGGCATCTCTAGAAGGAAGG + Intergenic
1092615882 12:10215073-10215095 CTGCGTCATAACTAGAAAGAAGG - Intronic
1093949172 12:25144942-25144964 CTGAGTAATATCAACATTGAAGG - Intronic
1095784014 12:46090518-46090540 CTGAGCTATGTCTAGAAGGAGGG + Intergenic
1096554893 12:52397331-52397353 CAGAGGCATATCTAAAAGGGAGG - Intronic
1096829230 12:54301349-54301371 CTGAGTCATATCAAGGTGGAAGG + Intronic
1098165208 12:67689758-67689780 ATGAGTTATATGTAAAAGGATGG - Intergenic
1099028420 12:77494641-77494663 CTTAGCCATATCTACAATGAAGG + Intergenic
1099056354 12:77846043-77846065 CTGAGTCATATCTCCAATTCCGG + Intronic
1099926926 12:89030005-89030027 CTGAGTAATATATAAAAGAATGG + Intergenic
1102712622 12:114941486-114941508 CTTACTCATTACTACAAGGAGGG + Intergenic
1105518010 13:21107813-21107835 CTGAGTCCCATCAACAAGGATGG - Intergenic
1106559799 13:30838405-30838427 CTCACTCATTACTACAAGGAGGG + Intergenic
1106819388 13:33446345-33446367 CTGACTCTTAGCTAGAAGGAGGG + Intergenic
1106832398 13:33599000-33599022 GGGAGTGATATCTACAAGGAGGG + Intergenic
1109343079 13:61086394-61086416 CTGCCTCATACCCACAAGGAAGG + Intergenic
1113022684 13:105905820-105905842 CTTGGTAATATCTCCAAGGAGGG + Intergenic
1113491895 13:110698888-110698910 CTGAGTCCCAGCTACCAGGAGGG + Intronic
1114682630 14:24499166-24499188 CTGAATCAAATCTGCAATGATGG + Intergenic
1114875129 14:26707173-26707195 CTGAGTCTTTTTTCCAAGGAAGG - Intergenic
1117067537 14:52025523-52025545 CTGAGTCATTTCTAAAGGAAAGG + Intronic
1120027902 14:79606511-79606533 CTGACTCATTTCAACCAGGATGG + Intronic
1124434778 15:29638099-29638121 CTCAGTCCTTTCTGCAAGGAAGG + Intergenic
1124458345 15:29865451-29865473 CAGAGTGATTTTTACAAGGAAGG + Intronic
1134625239 16:15718496-15718518 CTGAGGCATGACTCCAAGGAGGG - Intronic
1138066464 16:53946622-53946644 TGAAGTCATATCTACAAGGAAGG + Intronic
1141204580 16:81923643-81923665 CTGAGTCTTATCACCAAGAAGGG - Intronic
1143692246 17:8578627-8578649 ATGATTCATATTTACAAGCAAGG + Intronic
1154299322 18:13179323-13179345 CTAATTCATATCCACCAGGATGG + Intergenic
1156169673 18:34467212-34467234 ATGACTCATACCTACTAGGATGG + Intergenic
1159369280 18:67510904-67510926 CTGATTCATATCCACAAAGTGGG + Exonic
1161184684 19:2909050-2909072 CTGAGTCATATCTACTGTGTGGG + Intronic
1162604813 19:11698361-11698383 CTGTCTCATACCTAGAAGGAAGG + Intergenic
928898418 2:36292147-36292169 CTGAGTTATATCTACATGCCTGG + Intergenic
932099724 2:68887424-68887446 CAGAGTCACATCTACAATTAAGG - Intergenic
937000931 2:118466859-118466881 CTGAGTCAGATCTCCCAGAAAGG - Intergenic
938834284 2:135083800-135083822 CTACTTCATATCTACTAGGATGG - Intronic
939171880 2:138705493-138705515 CTGAGTAAAATCTACTAAGAGGG - Intronic
940487509 2:154314729-154314751 CTCAGTCATTACTGCAAGGATGG + Intronic
940976655 2:159953596-159953618 CTGAAGCTTATCTACAAAGAAGG + Intronic
941982943 2:171479584-171479606 CACAGTCATTTCTAGAAGGACGG - Intronic
942745714 2:179229605-179229627 CTGAGTAATACAAACAAGGACGG + Intronic
943769558 2:191701796-191701818 CTCACTCATTTCCACAAGGACGG - Intergenic
944542687 2:200768443-200768465 CTGGTTCATATCTACACAGATGG + Intergenic
945282515 2:208049012-208049034 CTAAATCTTATCTAGAAGGAGGG + Intergenic
945775962 2:214106386-214106408 CTGAGCCATAATAACAAGGATGG + Intronic
947155633 2:227160412-227160434 CTGTGTCACATCTAGGAGGAAGG + Intronic
948867812 2:240784326-240784348 CTGAGCCATAGCTACAGGGCAGG + Intronic
1170960975 20:21025754-21025776 CTAAATAATATCTACAAGGTAGG - Intergenic
1171238287 20:23545583-23545605 CTGAGTCATTTATATAAAGATGG - Intergenic
1173351792 20:42252341-42252363 GTGAGTCATATGTACACAGATGG + Intronic
1174690889 20:52503522-52503544 CTGAGTCACATCTTTAAGCAAGG - Intergenic
1174760561 20:53203026-53203048 ATGATTCATATCGAGAAGGATGG - Intronic
1175514730 20:59561783-59561805 GTGAGTCATGTCTGCCAGGATGG - Intergenic
1177777373 21:25583197-25583219 CTGAGCCACAGCTGCAAGGAAGG + Intergenic
1178179320 21:30141806-30141828 TTGAGACATATTTACAATGAAGG + Intergenic
1179405890 21:41125413-41125435 CTGAGTTTTATTTCCAAGGAGGG + Intergenic
1179530715 21:42017208-42017230 TTGAGTCACATTTAAAAGGAGGG - Intergenic
1181457055 22:23065794-23065816 CTGAGTCCCAGCTACAAGCAAGG + Intronic
949100529 3:138934-138956 CTGAGGCCTAGGTACAAGGAGGG - Intergenic
949400540 3:3661182-3661204 CCTGGTCATAGCTACAAGGAAGG - Intergenic
954332486 3:49898395-49898417 GTCCTTCATATCTACAAGGAGGG - Intronic
956780759 3:72601367-72601389 CTGAGTGATTTCTCCAATGAAGG - Intergenic
959902732 3:111678019-111678041 CTGGGTCAGATCTATCAGGATGG + Intronic
970433592 4:16011567-16011589 CTGTGTCAGACTTACAAGGAAGG + Intronic
976275475 4:83272746-83272768 CTGCATCATATATATAAGGAGGG - Intronic
980136118 4:128860459-128860481 CTGAATCACATCACCAAGGATGG - Intronic
982283798 4:153713987-153714009 ATGAGTCATATTAACAAGGATGG - Intronic
982429493 4:155306105-155306127 TTTTCTCATATCTACAAGGAAGG - Intergenic
983584159 4:169338107-169338129 TTGAGTGATACCTACAAGAAAGG + Intergenic
987810740 5:22832094-22832116 ATAAATCATATCTAAAAGGATGG + Intronic
988886753 5:35566165-35566187 CTAAGTCATATGAAGAAGGATGG + Intergenic
989124185 5:38035358-38035380 ATGAGTCAGATGTCCAAGGAAGG + Intergenic
989333063 5:40282126-40282148 CAGAGTCATAAGTACCAGGAGGG + Intergenic
990033574 5:51291955-51291977 CAGACTCAGATCTACAAGGAGGG + Intergenic
990820925 5:59839370-59839392 CTGAGTAATATCAACCAGGCAGG - Intronic
993954398 5:94214628-94214650 CAGGGTTATATTTACAAGGAGGG - Intronic
1001086009 5:168700588-168700610 CTGAGTGACAGCCACAAGGATGG - Exonic
1001430232 5:171655081-171655103 CTGAGTCATAGCCACAAGGCTGG + Intergenic
1003075562 6:2981062-2981084 CTGTGTCTCCTCTACAAGGACGG + Intergenic
1003844931 6:10163295-10163317 CTGAGGCTTATCCAAAAGGAGGG - Intronic
1004785166 6:18960497-18960519 TTGAGTTGTATCTACAATGAAGG - Intergenic
1005941772 6:30565790-30565812 CTTAATCTTATCTAGAAGGAGGG + Intergenic
1008143570 6:47861200-47861222 CTAAGACATATTTAGAAGGATGG - Intergenic
1008619949 6:53261973-53261995 CTGGGTCTCCTCTACAAGGAGGG - Intergenic
1009777920 6:68229814-68229836 CTGTGTCACATCTAAGAGGATGG - Intergenic
1010179703 6:73071719-73071741 CTCAGTCATTACTTCAAGGACGG + Intronic
1012596274 6:101044616-101044638 CTGAATCATATCTACCAACATGG - Intergenic
1018182623 6:161237450-161237472 CTGAGTCATTCGTATAAGGATGG + Intronic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1023757146 7:43430625-43430647 CTGAGTCATGTGGACAAGGATGG + Intronic
1028799557 7:94947417-94947439 CTAAGTCCTAGCTACAAGGAAGG + Intronic
1035312972 7:157981991-157982013 CTGAGTCATAGAGACAAGGAGGG + Intronic
1035313054 7:157982308-157982330 CTGAGTCATAGAGCCAAGGAGGG + Intronic
1035313108 7:157982517-157982539 CTGAGTCATAGAGACGAGGAGGG + Intronic
1037525419 8:19719710-19719732 CTGAGTCATTTCTACGTGGGAGG + Intronic
1038376229 8:27042817-27042839 ATGAGTCATATTCACAGGGAAGG - Intergenic
1038739947 8:30208296-30208318 CTCATTCATTACTACAAGGAGGG - Intergenic
1039147615 8:34466376-34466398 CTGATCCATAAGTACAAGGAAGG - Intergenic
1039534516 8:38296076-38296098 CTGAGTCATATCTACAGTGATGG + Intronic
1040578187 8:48672767-48672789 GTGGATCATATCTTCAAGGAAGG + Intergenic
1044304646 8:90624764-90624786 CTGAGTGACATCTTCAATGATGG + Exonic
1045246585 8:100446836-100446858 CCACTTCATATCTACAAGGATGG - Intergenic
1045745063 8:105408758-105408780 CTGTGTCAAACCCACAAGGAGGG + Intronic
1045835150 8:106511733-106511755 CTAAGTCTTATCTACAATAATGG - Intronic
1051876264 9:21797016-21797038 CTGACTCATACCCATAAGGAAGG - Intergenic
1053530023 9:38871277-38871299 CTGAGTATTATCTACAAGTTAGG + Intergenic
1054202248 9:62095704-62095726 CTGAGTATTATCTACAAGTTAGG + Intergenic
1054636110 9:67492656-67492678 CTGAGTATTATCTACAAGTTAGG - Intergenic
1055254803 9:74356338-74356360 CAGAATAATATCTTCAAGGAAGG + Intergenic
1055729958 9:79270376-79270398 CTGAGCTATATCTTGAAGGATGG + Intergenic
1056071445 9:82991282-82991304 CTGAATCTTAACTGCAAGGAAGG - Intronic
1056182221 9:84096211-84096233 CAAAGTAATTTCTACAAGGAGGG - Intergenic
1057827208 9:98380394-98380416 CTGCCTCAGATCCACAAGGAAGG + Intronic
1060629711 9:125144401-125144423 CTGAGTCTTATTTTCAAGGATGG - Intergenic
1188310754 X:28613625-28613647 CTGAGTTATTTCTCCAGGGAAGG + Intronic
1188785547 X:34341818-34341840 CTGAATCTTATCTACTGGGAAGG - Intergenic
1190282568 X:48940658-48940680 CTGAGTCAAAGCCACATGGAGGG + Intronic
1195309025 X:103612095-103612117 CTGAATGATATCTACAGAGATGG - Intronic
1198466674 X:136909896-136909918 CTGAGACATACCCACAGGGAAGG - Intergenic
1199785056 X:151097923-151097945 CTCACTAATCTCTACAAGGAAGG - Intergenic
1201900595 Y:19043563-19043585 ATGAGTCAATTCCACAAGGACGG + Intergenic