ID: 918569470

View in Genome Browser
Species Human (GRCh38)
Location 1:185971768-185971790
Sequence AGTGTTCACCAGACAGTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 125}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918569470_918569475 6 Left 918569470 1:185971768-185971790 CCCTGAACTGTCTGGTGAACACT 0: 1
1: 0
2: 0
3: 5
4: 125
Right 918569475 1:185971797-185971819 TCTTGGTGATTATGCCCTTGGGG 0: 1
1: 0
2: 1
3: 15
4: 171
918569470_918569474 5 Left 918569470 1:185971768-185971790 CCCTGAACTGTCTGGTGAACACT 0: 1
1: 0
2: 0
3: 5
4: 125
Right 918569474 1:185971796-185971818 TTCTTGGTGATTATGCCCTTGGG 0: 1
1: 0
2: 0
3: 13
4: 156
918569470_918569473 4 Left 918569470 1:185971768-185971790 CCCTGAACTGTCTGGTGAACACT 0: 1
1: 0
2: 0
3: 5
4: 125
Right 918569473 1:185971795-185971817 ATTCTTGGTGATTATGCCCTTGG 0: 1
1: 0
2: 0
3: 6
4: 119
918569470_918569479 24 Left 918569470 1:185971768-185971790 CCCTGAACTGTCTGGTGAACACT 0: 1
1: 0
2: 0
3: 5
4: 125
Right 918569479 1:185971815-185971837 TGGGGGAGAATCAACAAAGCTGG 0: 1
1: 0
2: 0
3: 15
4: 186
918569470_918569476 7 Left 918569470 1:185971768-185971790 CCCTGAACTGTCTGGTGAACACT 0: 1
1: 0
2: 0
3: 5
4: 125
Right 918569476 1:185971798-185971820 CTTGGTGATTATGCCCTTGGGGG 0: 1
1: 0
2: 0
3: 9
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918569470 Original CRISPR AGTGTTCACCAGACAGTTCA GGG (reversed) Intronic
904990701 1:34590374-34590396 AGGTTTCACCTGACACTTCAGGG + Intergenic
906591487 1:47028991-47029013 AGTGTTCTCTGGATAGTTCAAGG - Intronic
908060840 1:60346941-60346963 ACATTTCACCAGAGAGTTCATGG + Intergenic
909135749 1:71798290-71798312 AGTCTTCAGGAGAAAGTTCACGG + Intronic
909919505 1:81363511-81363533 AGTAGTCACCAGAGAATTCAAGG + Intronic
912721552 1:112024692-112024714 AGTGTTCCCAAGAAAGGTCATGG + Intergenic
915627778 1:157126278-157126300 ACTGTACACCTCACAGTTCAGGG + Intronic
915727404 1:158027520-158027542 GGTGTTCACCAGACAAACCAAGG - Intronic
918569470 1:185971768-185971790 AGTGTTCACCAGACAGTTCAGGG - Intronic
920893045 1:210012315-210012337 TGTCTTCACCAGATTGTTCAAGG + Intronic
921600680 1:217103298-217103320 AGGGTTTCCCAGACAGCTCAGGG + Intronic
1064236621 10:13582094-13582116 AATGTTCACAATACAGATCAGGG - Intergenic
1067341484 10:45408742-45408764 AGGGTCCATCAGTCAGTTCAGGG + Intronic
1068808101 10:61223513-61223535 ATTATACAACAGACAGTTCAGGG + Intergenic
1073339512 10:102734314-102734336 AGCGTTCACCATGCATTTCAGGG + Intronic
1073953207 10:108835316-108835338 AGTGTCCACCAGGCAGTGGATGG + Intergenic
1075299041 10:121304263-121304285 AGTGCTCACCAGAGAGCCCACGG + Intergenic
1075397609 10:122139245-122139267 AGAGCTGACCAGCCAGTTCAGGG + Intronic
1078437141 11:11334711-11334733 AGTGTGCAGCAGACAAGTCACGG - Intronic
1080110826 11:28565960-28565982 AGTGGCCACCAAACAGATCATGG + Intergenic
1083739921 11:64703477-64703499 AGTTTTCACCAGACAGATTTGGG - Intronic
1085851141 11:80121681-80121703 AGCATTAACCAGTCAGTTCATGG - Intergenic
1086361595 11:86066140-86066162 AGTCTTCTACGGACAGTTCATGG - Intronic
1087604212 11:100356203-100356225 AGTTTTCACCAGGAAGTTGAAGG - Exonic
1089875447 11:121717085-121717107 AATGTTCACCATACAGTTGCAGG + Intergenic
1090812710 11:130260909-130260931 AGTGATCAGCAGACAGTTCCAGG - Exonic
1091677060 12:2499219-2499241 AGTGAACACCAGTCAGCTCAGGG - Intronic
1092128170 12:6089848-6089870 AGTGTTCTCCAGGCAGATGAAGG - Intronic
1093525670 12:20101796-20101818 ATTGTGCACAGGACAGTTCACGG + Intergenic
1095451867 12:42339549-42339571 AGGCTTCACCAGACAGCTAAAGG - Intronic
1096693189 12:53333511-53333533 AGTGCTCACTAGACATCTCAGGG + Intronic
1107314191 13:39113361-39113383 ACTGTTCACAAGAAAGATCACGG - Intergenic
1107830576 13:44371364-44371386 ACTGGTCACCAGAAAGATCAAGG - Intergenic
1119128687 14:72152189-72152211 AGTGTTCTTCAGATATTTCAAGG + Intronic
1119635327 14:76268759-76268781 CGTGTTCACCTCACAGTGCAAGG + Intergenic
1121817691 14:96941002-96941024 AGTCTTCACCTGACTGTACAGGG + Intergenic
1129733540 15:77945783-77945805 AGTTTTCAAAAGACAGCTCATGG + Intergenic
1131302841 15:91214764-91214786 AGTGTTCCCCAAACAGTTGTGGG + Intronic
1131390305 15:92042683-92042705 GGTGTTCACCAGATAGCTGAGGG + Intronic
1131518943 15:93099059-93099081 AGTGTCCACCTGACAGCTCCAGG + Intergenic
1132157579 15:99507113-99507135 AGTGGTCATCAGAGAGATCAGGG + Intergenic
1137348231 16:47684816-47684838 AGTATTCTTCAGACAGTTCTGGG - Intronic
1141911658 16:87063844-87063866 TGTGTTCACCAAAGCGTTCAGGG - Intergenic
1151908627 17:77066492-77066514 AGTGCTCACCTGTCAGGTCAAGG - Intergenic
1153155693 18:2146384-2146406 AATGTACACCAGCCTGTTCATGG + Intergenic
1154177063 18:12092730-12092752 AGTGATCACCAGGCAGATGAGGG - Intergenic
1155599406 18:27527677-27527699 AGTTTTGGTCAGACAGTTCAGGG + Intergenic
1156906606 18:42360326-42360348 AGTGTTCAGAAAAAAGTTCAGGG + Intergenic
1158532317 18:58274466-58274488 TGTGTAGACCAAACAGTTCAGGG + Intronic
1159387261 18:67742339-67742361 AGTGTTCCCCAGCCAGTGCTAGG + Intergenic
1159520568 18:69516117-69516139 AGGGTGCACCAGACACTCCAGGG - Intronic
1164244072 19:23415639-23415661 AGTGTTTCCCAGATTGTTCAGGG - Intergenic
1166967127 19:46535712-46535734 AGTGGACACCAGACTGGTCACGG - Intronic
925918318 2:8623018-8623040 TGAGTTCACCAGGCAGGTCAGGG - Intergenic
926478379 2:13357059-13357081 AGGGCTCTTCAGACAGTTCATGG - Intergenic
931893190 2:66698383-66698405 AGTGTACACTAGATAGCTCATGG - Intergenic
933099151 2:78229539-78229561 AGTGTTCACCAGAAATATTAGGG - Intergenic
936797981 2:116230357-116230379 AGTGTTAACAGGAAAGTTCATGG + Intergenic
940124858 2:150311644-150311666 AGTTTTCCCCGGACAGTGCAAGG + Intergenic
941198213 2:162476213-162476235 AATTTTCACCAGAAAGTTTAAGG - Intronic
942237218 2:173922449-173922471 GGTGTTCATCAGACAGTCAATGG + Intronic
942451451 2:176110291-176110313 GGTGTTGTCTAGACAGTTCAAGG - Intronic
945150640 2:206786721-206786743 TTTGTTCCCCAGACAGTTCGTGG + Exonic
946002437 2:216493812-216493834 AATGTTCACTAGACACTTCATGG + Intergenic
1170460436 20:16572863-16572885 GGGGTTCACCTGACAGTTCGTGG + Intronic
1172361327 20:34314669-34314691 AATGTTCACGACACAGATCATGG + Intergenic
1172836883 20:37878844-37878866 AGCGTGCACCAGACACTTCTTGG - Intergenic
1173890235 20:46502392-46502414 ATTGTACACCAGAAAATTCATGG - Exonic
1175153621 20:56954613-56954635 AGTTTTCACCAGGACGTTCACGG - Intergenic
1176175500 20:63721430-63721452 AGTGTCCGCCAGGCTGTTCACGG + Intronic
1180713273 22:17854509-17854531 CCTGTTCACCAGGCAGTTCTCGG - Intronic
1185413070 22:50696132-50696154 AGTGTTCAGCAGAGGGCTCAGGG + Intergenic
949977605 3:9475418-9475440 AATGTTCACCAGCCATTTAAGGG + Intronic
950652456 3:14415809-14415831 GGTATTCACCAACCAGTTCAGGG - Intronic
952051069 3:29385288-29385310 AGTGCTAACCAGACAGTCCTGGG - Intronic
957762409 3:84574612-84574634 AGTCATTGCCAGACAGTTCATGG - Intergenic
959446929 3:106451868-106451890 ACTGTTCACCAGACTATTCCTGG + Intergenic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
964990962 3:162812155-162812177 AATGTTCAGAAGACAGTTCTTGG + Intergenic
972297743 4:37756389-37756411 AGTGCTCACAAGCCAGTTCATGG + Intergenic
974994955 4:69143943-69143965 AGTGATCACCACACAGATCTTGG - Intronic
977094424 4:92721836-92721858 TGTGTTCACCATATAGTTTAGGG - Intronic
979435247 4:120680550-120680572 AGTGTTCATCAGCCAGTGAATGG + Intergenic
986040332 5:3988049-3988071 AGTGTTCAGCAGAGAGGTAATGG + Intergenic
987999602 5:25331195-25331217 AGTGTTCACCAGTTGGTCCATGG - Intergenic
988950427 5:36252966-36252988 AGTCTTCTCCAGTCAGTCCATGG + Intronic
989177268 5:38540335-38540357 AGTATTCACCGGACAGGTCGGGG - Intronic
990443045 5:55865948-55865970 AGACCACACCAGACAGTTCAGGG - Intronic
993042037 5:82825148-82825170 AGGCTTCCCCAGACAGGTCATGG - Intergenic
995570421 5:113474359-113474381 GGTGCTCACCAGACAGGTAAGGG + Intronic
996748790 5:126868707-126868729 CGGGTTCACCTGACAGCTCAGGG + Exonic
1000268681 5:159662054-159662076 AGAGTTGACCAGGCAGTTCTAGG - Intergenic
1001131211 5:169065242-169065264 AATGTTCATCAGACAGTTGGAGG - Intronic
1001802487 5:174556339-174556361 GGTGTTCAGCAGAGAGTTCTTGG + Intergenic
1004991372 6:21142085-21142107 AGTGTGCACCAGACTGGTCTAGG + Intronic
1010434399 6:75813368-75813390 AGAGTTCTCCAGTCAGTTCGTGG + Intronic
1011663366 6:89613060-89613082 AGTGTTCTCCAGACAGAGCTAGG + Intronic
1013533160 6:111038864-111038886 AGTTGTCACCAGACATTTGAAGG + Intergenic
1015205102 6:130628745-130628767 AGTGTGCACCAGAGTGTGCAGGG + Intergenic
1015789362 6:136951050-136951072 AGTGTACAGTAGACAGTTAAGGG + Intergenic
1021649375 7:22818802-22818824 AGGTTTCACTATACAGTTCAAGG + Intronic
1023518927 7:41031479-41031501 AGTCTTTTCCAGACAGGTCAAGG + Intergenic
1026288968 7:68988675-68988697 AGTTTCCACCATACAGTTCTTGG + Intergenic
1031353769 7:120765854-120765876 AGTGTTCCCCAGAGAGGGCATGG - Intergenic
1032107957 7:129050711-129050733 AGTGTTCTAAAGCCAGTTCAGGG - Intronic
1034430201 7:151037465-151037487 GCTGATCACCAGACAGCTCAAGG + Intronic
1036430544 8:8685763-8685785 AGACTTCACCAGGCAGTTAAAGG - Intergenic
1038659969 8:29488829-29488851 ATTATTAAGCAGACAGTTCAAGG - Intergenic
1040698734 8:50035391-50035413 AGTGTTCACAAGCCAGATGAGGG - Intronic
1043578974 8:81689877-81689899 AGTGTACACAAGAGAGTTCTAGG + Intergenic
1045043984 8:98257042-98257064 AGGGTCCACCAGTCAGTTGAGGG - Intronic
1045893047 8:107180898-107180920 AGTCCTCACCTGAGAGTTCAAGG + Intergenic
1047612548 8:126535239-126535261 AATGTTCACCAAACATTTGATGG - Intergenic
1049571661 8:143372742-143372764 GGTGTCCAGCAGACAGTACAGGG + Intronic
1049984389 9:934914-934936 AATATTCACCAGAGAGATCAAGG - Intronic
1051827156 9:21233515-21233537 ACTGTTCTCCATACAGTTCCTGG + Intronic
1053425059 9:38004996-38005018 ATTCTTCACCAGAAAGTTCCAGG + Intronic
1058655676 9:107218438-107218460 CCTGTTCACCAGAGAGCTCAAGG + Intergenic
1060985556 9:127817140-127817162 GGAGCTCACCAGACAGGTCAGGG + Exonic
1061771166 9:132923211-132923233 GGTTTTCACCAGACAGATGAGGG - Intronic
1062675393 9:137740216-137740238 AGTGTGGAACAGACAGTTCCAGG - Intronic
1186706665 X:12146913-12146935 AGTGTTCAGCTGACAGATGAGGG + Intronic
1187360069 X:18617738-18617760 AGTTTTCACCCACCAGTTCAAGG + Intronic
1188402783 X:29768363-29768385 AGTGTTCAGTACACAGCTCAGGG + Intronic
1188979772 X:36716588-36716610 AGGATTCAGCAGACAGTGCAAGG + Intergenic
1189161278 X:38811673-38811695 AGTGTTCTCTAGACAGTCCAAGG - Intergenic
1189801801 X:44698474-44698496 AGTGTTTACCATACAGTTCTTGG + Intergenic
1194288553 X:92039868-92039890 AGTGATAACCAGATAGTACATGG - Intronic
1195548438 X:106139077-106139099 AGGGTTCACCAGACCACTCAGGG - Intergenic
1196267244 X:113664893-113664915 ATTGTTCACCTAACAGTTCCAGG - Intergenic
1200606072 Y:5264433-5264455 AGTGATAACCAGATAGTACATGG - Intronic