ID: 918570483

View in Genome Browser
Species Human (GRCh38)
Location 1:185985779-185985801
Sequence ATGGAGACACAGAATGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 583
Summary {0: 1, 1: 0, 2: 7, 3: 76, 4: 499}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918570483_918570485 -1 Left 918570483 1:185985779-185985801 CCTTCATCATTCTGTGTCTCCAT 0: 1
1: 0
2: 7
3: 76
4: 499
Right 918570485 1:185985801-185985823 TTTTTAAGAATACTCATTAAAGG 0: 1
1: 0
2: 1
3: 57
4: 632

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918570483 Original CRISPR ATGGAGACACAGAATGATGA AGG (reversed) Intronic
900993422 1:6108112-6108134 ATGGAGGCATAGAGGGATGATGG + Intronic
900993468 1:6108307-6108329 ATGGAGAGACGGAGGGATGAAGG + Intronic
900993571 1:6108734-6108756 ATGGAGAGACAGAGGGATGGAGG + Intronic
901597024 1:10393361-10393383 ATGGAGCACTAGAATGATGAAGG + Intergenic
902371200 1:16008133-16008155 AGGGCAACACAGAATGATGCTGG + Exonic
902670113 1:17967358-17967380 ATCGAGGCACACAGTGATGAAGG + Intergenic
902992756 1:20200792-20200814 ATGGAATCACAGACTGAGGATGG + Intergenic
903666657 1:25012106-25012128 CTGGGGACAGAGAATGATCAAGG - Intergenic
903858189 1:26349528-26349550 ATGGAGACCCAGAGAGATCAAGG - Intronic
904990990 1:34592448-34592470 ATGGATACTCAGAGTGGTGAGGG - Intergenic
905450029 1:38050217-38050239 ATGCAGACACAGAGTGGTGTGGG + Intergenic
906516867 1:46444574-46444596 ATGGAGGCACAGACAGATTAAGG + Intergenic
906562023 1:46765314-46765336 ATGGAGAGAAGGAATGAAGAGGG - Intronic
906736161 1:48130938-48130960 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
906789516 1:48646267-48646289 AAGGAGGCTCAGAGTGATGACGG + Intronic
907072297 1:51547330-51547352 ATGCATACACAGCAAGATGAAGG + Intergenic
907303498 1:53502060-53502082 GTGGAGACAGAGGAGGATGAAGG + Intergenic
907639400 1:56170932-56170954 CTGGAGGCACAGAAGGATGGAGG + Intergenic
908565719 1:65354193-65354215 ATGGAGGAACAGAATGAGGTGGG + Intronic
910087322 1:83419021-83419043 AGGGAGACACAGGATGAGAAAGG + Intergenic
910118696 1:83760826-83760848 ATGCAGACACATAAGGATGCTGG + Intergenic
911595332 1:99793289-99793311 ATGAAGACACAGCAAGATGGTGG - Intergenic
911620040 1:100056193-100056215 ATGGAGACAGAGCAGAATGATGG - Intronic
911741770 1:101394342-101394364 ATGGAGACAGAGAAACATGTGGG + Intergenic
911769702 1:101724632-101724654 AAGGAGACACACAATTTTGAAGG - Intergenic
912157335 1:106937911-106937933 ATGGAGAGAAAGACTGAGGATGG - Intergenic
912833547 1:112974817-112974839 ATGGAGGCACACATAGATGAAGG + Intergenic
913158302 1:116121884-116121906 ATGGAGATTCAGAATGATTCAGG - Intronic
913473779 1:119217184-119217206 CTGGACAAGCAGAATGATGATGG - Intergenic
914934518 1:151966765-151966787 ATGGTGGCACTGAAGGATGATGG - Intergenic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915177849 1:154031558-154031580 ATGGAGACAGAGTAGAATGATGG - Intronic
915703308 1:157818892-157818914 ATGAAGAAACATATTGATGATGG + Intronic
916249041 1:162718182-162718204 ATGTACACACAAAAAGATGATGG - Intronic
916282389 1:163066148-163066170 ATGGAGCCTCAGAAGGATGAGGG - Intergenic
916636847 1:166680054-166680076 ATGGAGACTGAGAAGGAGGAGGG - Intergenic
916849751 1:168691521-168691543 ATAAAGACACAGAATGCTGAGGG + Intergenic
916964005 1:169916584-169916606 ACGGAGACCCAGGATGAGGAGGG - Intergenic
917639353 1:176968105-176968127 ATGGGGTTACAGAATGATGAAGG - Intronic
918256859 1:182756479-182756501 ATGGGGATAAAGAATGAAGATGG + Intergenic
918570483 1:185985779-185985801 ATGGAGACACAGAATGATGAAGG - Intronic
918725611 1:187918097-187918119 TTGGAGACTCAGAATGGGGAGGG + Intergenic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
918928876 1:190826700-190826722 ATGGAGATTCAGAAGGGTGAGGG + Intergenic
919038986 1:192357411-192357433 AGGGAGACACAGAAAGAGGGAGG + Intronic
919492261 1:198219540-198219562 TTGGAGACTCAGAATGGGGAAGG + Intronic
919739943 1:200975336-200975358 ATGGAGACAGAGGAGGAAGAGGG + Intronic
919856797 1:201711653-201711675 AGGGAGTGACAGAAAGATGATGG - Intronic
920751383 1:208680739-208680761 ATGGAGGCACAGAATGTTCCTGG - Intergenic
921395477 1:214664775-214664797 ATGGGGACACAGAATGTAGGAGG - Intergenic
921588492 1:216976511-216976533 ATGGAGACACTGGGTTATGAAGG - Intronic
922091825 1:222402890-222402912 ATGGACACACAGGATGATTTGGG - Intergenic
923469912 1:234281238-234281260 ATGAAGACACAGAAGGGTGATGG + Intronic
923627219 1:235623771-235623793 CTGGGGAGACAGCATGATGAGGG - Intronic
923744832 1:236690837-236690859 CTGGAGACACAGAGTGGTGATGG - Intronic
924108113 1:240669712-240669734 ATGGAGACTCAGAAGGGTGAAGG - Intergenic
924143377 1:241049008-241049030 ATGAAGACACAGACAGAAGAGGG - Intronic
924153285 1:241150742-241150764 ATGGAGTCACACAATTATGGAGG + Intronic
924197014 1:241618687-241618709 AAAGAGACACAGAACGATGGCGG - Intronic
1063016108 10:2079361-2079383 ATGAAGACACAGAAGGAAGGGGG - Intergenic
1064955500 10:20903856-20903878 ATGGAGACTCAGAAGGGAGAAGG + Intronic
1065712391 10:28531395-28531417 ATGGAGAGATGGAATGATGTAGG - Intergenic
1065747962 10:28859106-28859128 ATGGAGCCACAGGTGGATGAAGG - Intronic
1065954569 10:30682545-30682567 ATGGTGACTCAGAAAGATGGTGG - Intergenic
1066555257 10:36605476-36605498 ATGGTGACTCAGGATGAAGATGG + Intergenic
1066585862 10:36934645-36934667 TTGGAGACACAGGATTGTGAAGG - Intergenic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1067222157 10:44352221-44352243 AGGGAGACAAAGAGTGAGGAGGG - Intergenic
1067935266 10:50605904-50605926 ATGGAGACTCAGAAGGGTGAAGG - Intronic
1068553280 10:58429594-58429616 ATGGAGACTCAGAAGAGTGAAGG - Intergenic
1068640260 10:59396956-59396978 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
1069852681 10:71420376-71420398 ATGCACACACATGATGATGATGG + Intronic
1069866852 10:71509437-71509459 ATGGAGAGACAGATTCCTGATGG - Intronic
1070266930 10:74912318-74912340 ATGGATAGACAGATAGATGAAGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070688913 10:78510467-78510489 ATGAAGACACAAAGAGATGAGGG + Intergenic
1071753868 10:88513531-88513553 ATGGATTCATAGAGTGATGAAGG - Intronic
1072756178 10:98022650-98022672 ATGGAGACACAGTCTTATGTGGG + Intronic
1073431392 10:103489809-103489831 ATGGAGAGAGAGAAAGAGGAAGG + Intergenic
1073688975 10:105786486-105786508 ATGGAGACACAGAGAGAAGGTGG - Intergenic
1074619428 10:115103718-115103740 ATGGAGACAGAGTAGAATGATGG - Intronic
1076802774 10:132839038-132839060 AAGGAGACACTGATTGAAGATGG - Intronic
1077828716 11:5839389-5839411 ATGGAGACAGAGTAGAATGATGG + Intronic
1078255347 11:9653953-9653975 ATGGAGAGAGAGAATAATGCTGG - Intergenic
1079186392 11:18241736-18241758 CTGGAGACTCAGAAAGATGGAGG + Intronic
1080001379 11:27354502-27354524 ATTGAGACACAGAAAGGTTAAGG + Intronic
1080389714 11:31833829-31833851 AAGGAGAGACAGTATGATGAAGG + Intronic
1080536837 11:33230244-33230266 GTGGAGACTCAGAGGGATGAAGG + Intergenic
1081626451 11:44658856-44658878 ATGGAGACATGGATGGATGAAGG + Intergenic
1081626491 11:44659063-44659085 ATGGAGAGATGGAAGGATGAAGG + Intergenic
1083153085 11:60805778-60805800 ATGGAGACGGAGAAGGAAGAGGG - Intergenic
1084445051 11:69198766-69198788 ATGGAGAGATGGAAGGATGAAGG - Intergenic
1084565480 11:69926167-69926189 ATGAAGACACAGAATGAACTGGG + Intergenic
1086806835 11:91254350-91254372 CTGGAGATAGAGAGTGATGATGG - Intergenic
1087745519 11:101941224-101941246 TTGGAGACAGATAATGATGATGG - Intronic
1088006525 11:104947542-104947564 ATAGAAGCACAGAAAGATGAAGG + Intronic
1088447302 11:109945868-109945890 ATGGAGAAACAGAAACATGGAGG - Intergenic
1089990075 11:122850867-122850889 ATGGAGACATAAAATGATCTAGG - Intronic
1090855071 11:130603691-130603713 GTGGAGACTCAGGATGATGGTGG + Intergenic
1090993404 11:131841276-131841298 ATAGTGACACAGCAAGATGATGG + Intronic
1091116335 11:133017123-133017145 GTGAGGACACAGAAAGATGATGG - Intronic
1093000524 12:13990863-13990885 ACAGATACACAGAAGGATGAGGG + Intergenic
1093553758 12:20446812-20446834 AGGGAGACACAAACTGATAAAGG + Intronic
1093666281 12:21817195-21817217 ATGGAGTCAGAGAACTATGAAGG - Exonic
1093705501 12:22270640-22270662 ATGGAGACTCAGAAAGGTAAAGG + Intronic
1094128485 12:27049573-27049595 ACTGAGACACAGAGTGATGATGG - Intronic
1094166887 12:27452350-27452372 ATGGAGACTCAGGAGGGTGAAGG - Intergenic
1094322101 12:29195858-29195880 ATGGGGACTCAGAAGGACGAGGG - Intronic
1094816512 12:34191756-34191778 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1095154971 12:38841857-38841879 AGGGAGAAGCAGAAAGATGAAGG + Intronic
1097257343 12:57689293-57689315 ATGGAGACTCAGAAGGATGATGG + Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1098473417 12:70871445-70871467 ATGGAGAGAAAGAATGATCTAGG - Intronic
1098649336 12:72944557-72944579 AGGGAAGCACAGAAAGATGAGGG - Intergenic
1098992733 12:77082433-77082455 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1099160593 12:79236721-79236743 ATGGATAAACAGCTTGATGATGG + Intronic
1099938035 12:89151387-89151409 ATGAAGACTCAGAATGGGGAGGG + Intergenic
1100657167 12:96659592-96659614 ATGGAGAAATAGACTCATGAAGG + Intronic
1101380212 12:104207836-104207858 CGGGAGACACAGACTAATGAAGG + Intergenic
1101411494 12:104472564-104472586 ATGGAGACTCAGAAGGATTTAGG + Intronic
1102401347 12:112632355-112632377 TTGGAGACTCAGAAAGATGGAGG - Intronic
1102899320 12:116624090-116624112 AAGGAGAAAGAGAATGAAGAAGG + Intergenic
1103241162 12:119414342-119414364 AGGGAGACACACAGTGAGGATGG - Intronic
1104391794 12:128397209-128397231 GTGGAGACACAGTATGCTGGAGG - Intronic
1105603100 13:21904459-21904481 ATGGAGAAACAGAGTCCTGAAGG - Intergenic
1107517573 13:41145958-41145980 ATGGACACACTGAAAGGTGAGGG - Intergenic
1108101790 13:46964814-46964836 ATGAAGACACAGAATAAAGAGGG - Intergenic
1108461273 13:50669858-50669880 ATGGAGACAGAGAAGGCTGCAGG - Intronic
1110012331 13:70352849-70352871 ATGAGGATACAAAATGATGAGGG - Intergenic
1110192911 13:72751937-72751959 AGGGGGACTGAGAATGATGAGGG + Intronic
1111394194 13:87643656-87643678 ATGAAAACACAAAATCATGAAGG - Intergenic
1112443368 13:99441853-99441875 AGAGAGACACAGAGTGAAGACGG + Intergenic
1112559610 13:100501371-100501393 ATGGAGACTCAGAAGGGTGACGG - Intronic
1114928264 14:27432933-27432955 AGAGAGAAACAGAATGATAAAGG + Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116453308 14:45088144-45088166 ATGGAGAAAAAGAATGCTGTTGG + Intronic
1117740135 14:58809526-58809548 ATGGAGTCTCAGAAGGGTGAGGG - Intergenic
1118006343 14:61567546-61567568 ATGGAGAGACATTATGTTGAAGG - Intronic
1118156605 14:63248683-63248705 GTGGAGCCACAGAATGAACAAGG + Intronic
1118636977 14:67756961-67756983 ATGGAGACACAGACTGAGAAAGG - Intronic
1119016952 14:71067464-71067486 ATGGACACAAAAAATGATAAAGG - Intronic
1120191270 14:81441919-81441941 AAGGAGACACAGAAAAATCAGGG + Intergenic
1120299476 14:82688166-82688188 CTGGTGAGACAGAATGAAGAAGG + Intergenic
1120736614 14:88060160-88060182 ATGGAGACAGAGTAGGAGGATGG + Intergenic
1120809259 14:88786330-88786352 GGGGAGACACAGAATAAAGAAGG - Intronic
1120813516 14:88829090-88829112 TTCTAGACACAGAATGGTGAGGG + Intronic
1120852564 14:89184660-89184682 ATGGAGACCCAGGAAGGTGAAGG - Intronic
1121019543 14:90570861-90570883 ATGGAAGCACAGAGAGATGAAGG + Intronic
1121295806 14:92821016-92821038 ATGGAGGCACAGAATGGTGATGG + Intronic
1121323333 14:93005552-93005574 ATGGAGTCACAGAGTGTTGGAGG - Intronic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1123029539 14:105445179-105445201 ATGGAGACACAGGTTGAGGTTGG + Intronic
1125243320 15:37602332-37602354 ATGGAGACACTAAACGATGATGG + Intergenic
1125895692 15:43300086-43300108 ATGGAGACACAAAGAGATTAGGG - Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1127113816 15:55703657-55703679 ATGAAGACAAAGAATGTTGGTGG - Intronic
1127155324 15:56118369-56118391 ATGGAGATACAGTAGGATGATGG - Intronic
1129449735 15:75644431-75644453 ATGCAGACAAAAGATGATGAGGG - Intronic
1129673988 15:77622488-77622510 AGGGAGACTCAGAAAGGTGAGGG + Intronic
1130930065 15:88419387-88419409 ATGGAAACTCAGAATGACAAAGG + Intergenic
1131080837 15:89533476-89533498 ATGGAGACTCAGAATGCTGAGGG - Intergenic
1131216353 15:90539072-90539094 TTAGAGACAGAGAGTGATGAAGG + Intronic
1131307693 15:91259761-91259783 ATGGAGACACAGAGGCATCAGGG - Intronic
1131652179 15:94412062-94412084 ATGGAGCCACAGAATGAGGTAGG + Intronic
1132612256 16:823001-823023 ATGTAGACACAGAAAAGTGATGG + Intergenic
1133595120 16:7283555-7283577 ATGGAGATACAGAATGTCAAGGG - Intronic
1133653855 16:7840174-7840196 ATTGATAAACAGAATGATTAGGG - Intergenic
1133946079 16:10349703-10349725 ATGGAGACACATAGTCAAGAAGG + Intronic
1134268357 16:12711395-12711417 ATGGAGACAGATGGTGATGATGG + Intronic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135495022 16:22943821-22943843 AGGGGGATACAGAAGGATGAGGG + Intergenic
1135871301 16:26153256-26153278 CTGGAGATACAGAAAGATGGCGG + Intergenic
1136318713 16:29468721-29468743 GTGAAGACAAAGAATGAGGAGGG + Intergenic
1136433285 16:30208065-30208087 GTGAAGACAAAGAATGAGGAGGG + Intronic
1136507317 16:30713060-30713082 ATGGAGCGACAGAAAGAGGAGGG - Intronic
1136727055 16:32367260-32367282 ATGAAGACACAAAATTCTGAAGG - Intergenic
1137755998 16:50902739-50902761 GTGGAGACACAGAATGCAAAGGG + Intergenic
1137899573 16:52252337-52252359 ACGGAGACAAACAATGATGATGG + Intergenic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1138137474 16:54535992-54536014 ATGAAAACACAGGATGCTGATGG - Intergenic
1138259685 16:55607271-55607293 ATGGAAACACACAAAGAAGAGGG + Intergenic
1138723764 16:59113140-59113162 ATGGAGAGAAAGAAATATGATGG - Intergenic
1139167552 16:64585954-64585976 ATGGAGACAAAAGATGAAGAAGG - Intergenic
1139296335 16:65904721-65904743 AGGGAGACAGAGACTCATGAAGG - Intergenic
1140070663 16:71646978-71647000 ATGAAGACACATAATTATTATGG + Exonic
1140541984 16:75764638-75764660 AAGAAGACAAAGAATGAAGATGG + Intergenic
1140910355 16:79445641-79445663 ATGGAGTCAGGGAAGGATGAAGG + Intergenic
1141031919 16:80596599-80596621 ATGGAGGAACAGAAGGATGATGG + Intergenic
1141286379 16:82676329-82676351 ATGGTGCCACAGAATGAGGTAGG - Intronic
1141780679 16:86158439-86158461 CTGGGGACACAGCATGAGGATGG + Intergenic
1141866448 16:86753142-86753164 ATGGAGACCCAGCTTGCTGAGGG + Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1202999379 16_KI270728v1_random:150488-150510 ATGAAGACACAAAATTCTGAAGG + Intergenic
1203130977 16_KI270728v1_random:1686898-1686920 ATGAAGACACAAAATTCTGAAGG + Intergenic
1142930719 17:3282022-3282044 ATGGAGAAAAACAATGAAGAGGG - Intergenic
1144042144 17:11421518-11421540 ATGGAGACAGCGAATGGTAATGG - Intronic
1146542442 17:33709093-33709115 ATGGAGACCCAGAAAGATGTAGG - Intronic
1146902547 17:36598085-36598107 ATGGAGCCACAGAATGCTAGGGG - Intronic
1148065838 17:44869104-44869126 ATGGAGACAGAGAAGTCTGAAGG - Intronic
1148446235 17:47739287-47739309 ATGGAGACACAGGAAGAGGCTGG - Intronic
1148530463 17:48385429-48385451 TTGGAGAGACATAATGAAGAAGG + Intronic
1149052163 17:52318637-52318659 ATGAAGCCCCAGAATGATGTGGG + Intergenic
1149444349 17:56702028-56702050 AGGGAGACACTGAGTGATGTTGG - Intergenic
1150440163 17:65184696-65184718 AGGGAGAGACAGAATGAAGGAGG - Intronic
1151404500 17:73877875-73877897 ATGGAGACAAAGGATGACCAGGG - Intergenic
1151540234 17:74761055-74761077 CTGGACACACAGTATGATGGAGG - Intronic
1151560391 17:74866636-74866658 CTGGGGACACAGAGTGGTGAGGG - Intronic
1152334570 17:79693173-79693195 ATGGAGACTCTGAATGATGGTGG + Intergenic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1154083855 18:11282863-11282885 TTGGAGACTCAGAAGGGTGAGGG - Intergenic
1154214961 18:12408739-12408761 ATGGAGACTCTGAAGGGTGAGGG + Intronic
1155127694 18:22895612-22895634 GTGGAGACAAAGGCTGATGAGGG + Intronic
1155315134 18:24563740-24563762 ATGGAGACTCAGAAGGGGGACGG - Intergenic
1157489663 18:48113927-48113949 ATGGAGACACAGAGTGAATGGGG - Intronic
1157569901 18:48705348-48705370 GAGGAGACACAGAGGGATGAAGG - Intronic
1158209883 18:55036686-55036708 ATTCAGACACTGAATGGTGATGG - Intergenic
1158271751 18:55724035-55724057 AGGGACACACAGAATCATCAAGG + Intergenic
1158787630 18:60734895-60734917 GTGAAGACACAGAAAGAAGATGG - Intergenic
1158795381 18:60839546-60839568 AGGGAACCACAGAATGAGGATGG + Intergenic
1159950258 18:74477986-74478008 TTGGAGACACAGAACTATGGGGG - Intergenic
1160361984 18:78291099-78291121 CTGGAGATACATAGTGATGATGG - Intergenic
1162907403 19:13831878-13831900 ATGGAAACAGAGTAAGATGAAGG - Exonic
1163207373 19:15813581-15813603 GTGGAGACACAGAGAGATGTGGG + Intergenic
1163333710 19:16658168-16658190 AGGGAGTCACAGGATGGTGATGG - Intronic
1165076942 19:33284800-33284822 TTGGAAAGACAGAAAGATGAAGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166388432 19:42395467-42395489 ATGGTGACACAGAAAAACGATGG + Intergenic
1166516883 19:43453868-43453890 ACTGAGGCACAGAAAGATGATGG + Intergenic
1166602117 19:44105674-44105696 ATGGAGACTCAAAATGGGGAGGG - Intronic
1166643353 19:44512968-44512990 CTAGAGGCACAGAATAATGAGGG - Intronic
1166991514 19:46695641-46695663 ATGGAGACAGAGAACCAGGAAGG + Intronic
1167014832 19:46834263-46834285 AGAGAGACAGAAAATGATGACGG - Intergenic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1168190339 19:54733823-54733845 ATGGAGATACAGATAGATCATGG + Intronic
1168655621 19:58125513-58125535 ATGGAGGCACGGAGTGAAGAAGG - Intergenic
1168666681 19:58209843-58209865 ATGGAGCCACAGTACGATGCAGG + Intronic
925249896 2:2423143-2423165 ATGGAAATACAGATTGATGCAGG + Intergenic
926995626 2:18732422-18732444 CTGGAGACACAGAAGGATTGGGG + Intergenic
927085320 2:19669432-19669454 ATGGCAACACTGAAGGATGATGG + Intergenic
928031636 2:27784628-27784650 ATAAAGACACAGAAGGAGGAAGG + Intronic
928057355 2:28071157-28071179 ATGAAGACAAAGAATGTCGAGGG - Intronic
928096163 2:28406479-28406501 ACGGAGACCCAGAAAGGTGAAGG + Intronic
928100327 2:28433447-28433469 ATGGAGGGAAAGAATGTTGATGG + Intergenic
928470145 2:31567918-31567940 AGCCAGGCACAGAATGATGAGGG + Intronic
928599084 2:32886252-32886274 AGGTAGACACAGAGTGCTGATGG + Intergenic
930206254 2:48589043-48589065 ATGGTGGCACAGAATTATTAAGG + Intronic
930463176 2:51710059-51710081 GTGGAGACTCAGAAGGGTGAGGG + Intergenic
930892919 2:56412005-56412027 CTGGAGACTCAGAAGGGTGAGGG + Intergenic
931114084 2:59145579-59145601 ATGGACTCAATGAATGATGAAGG + Intergenic
932259203 2:70312991-70313013 ATGGAGCCCCAGAGTGATGTGGG + Intergenic
932884416 2:75535766-75535788 TTGGAGACTCAGAATGGGGAAGG + Intronic
933294827 2:80477515-80477537 ATGGAGACTCAGAATGGGAAAGG - Intronic
933349856 2:81139416-81139438 GTGGAGACTTAGAATGGTGAGGG + Intergenic
933388670 2:81643749-81643771 ATGGAGACAGAGTATAAGGATGG + Intergenic
933447117 2:82395614-82395636 ATGCAGACACACAAAGATTAAGG + Intergenic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
935531284 2:104235179-104235201 ATGAAGACACACAAAGAAGAAGG + Intergenic
935643634 2:105314110-105314132 GTGAAGACACAGAAAGAGGAAGG + Intronic
935914983 2:107939584-107939606 ATGGAGATCCTGAATAATGATGG - Intergenic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936580027 2:113691493-113691515 ATGGAGACTCAGAAGGGGGAGGG - Intergenic
938963209 2:136361485-136361507 ATGGAGAGAGAGAAGGAAGAAGG - Intergenic
939147522 2:138433982-138434004 AAGGAGACAAACAATCATGATGG + Intergenic
939276590 2:140005573-140005595 ATGGAGATAGAGAAGAATGATGG + Intergenic
939717838 2:145607475-145607497 ATGTAGGCAAAGAATAATGATGG + Intergenic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
940733879 2:157427131-157427153 ATAGACACACAGAAGGAGGAAGG + Intronic
941261125 2:163298772-163298794 ATGGACACAGAGAATAATGGTGG - Intergenic
942430450 2:175905825-175905847 ATGGAGATTCAGAAGCATGAGGG - Intergenic
942747504 2:179251783-179251805 ATGAAGACACAGCAAGAAGATGG + Intronic
942978213 2:182044958-182044980 ATAGAGAGACAGAAAGATGAAGG - Intronic
943465696 2:188226636-188226658 GTGAAGACACAGAATGAAAATGG + Intergenic
943762464 2:191624796-191624818 GTGAAGACACAGAAAGAAGATGG - Intergenic
944998113 2:205317652-205317674 ATGTAAACAAAGAATGGTGAGGG - Intronic
945075774 2:206038066-206038088 ATGAAGACTCAGAAGGGTGACGG + Intronic
945454493 2:210034458-210034480 ATGGTGAGAAAGAATCATGAGGG + Intronic
946156320 2:217809104-217809126 ATGGAGATACAGATGGATGAAGG + Intronic
946773920 2:223117877-223117899 ATGGAGACACAGGAAGAAGGAGG + Intronic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
947361834 2:229353299-229353321 ACAGAGATACACAATGATGAAGG + Intergenic
947448877 2:230186660-230186682 ATGGAGACTCAGAAAGGAGAGGG - Intronic
948204381 2:236155341-236155363 AAAGAGACACATAATGAAGAGGG - Intergenic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169314632 20:4579687-4579709 ATTGAGAAACAAAATCATGAAGG - Intergenic
1169502911 20:6178177-6178199 ACAGAGACACAGAAGGAGGATGG + Intergenic
1170075572 20:12415280-12415302 CTGCAGACACAGAATGCTGGAGG - Intergenic
1170442003 20:16388849-16388871 ATGAAGACACACAAGGATGCAGG - Intronic
1170793904 20:19530174-19530196 ATGGAGACACAGCATGAAAGGGG + Intronic
1171778495 20:29394603-29394625 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1171822552 20:29867053-29867075 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1171991765 20:31702274-31702296 AGGGAGAGACAGAATGATGGAGG + Intronic
1172883230 20:38215095-38215117 CTGGACACACAGACAGATGATGG - Intronic
1173532437 20:43780717-43780739 ATGGAGGCTCAGAGAGATGATGG - Intergenic
1174720873 20:52810934-52810956 ATGCAGACAAAGAGAGATGAGGG + Intergenic
1174921978 20:54713098-54713120 ATGGGGACACAGAAAGAAGGTGG + Intergenic
1175817253 20:61889719-61889741 ATGGACAGACAGATGGATGATGG + Intronic
1176231357 20:64034637-64034659 ATGGAGAGACGGAAGCATGAGGG + Intronic
1176245997 20:64097275-64097297 ATGGAGACCGAAAATGGTGACGG - Intronic
1176939314 21:14904550-14904572 ATGGAAACAGAGTATAATGATGG - Intergenic
1177916965 21:27100970-27100992 GTGAAGACATAGAAAGATGATGG - Intergenic
1178024051 21:28444830-28444852 AATGAGGCACAGAAAGATGAAGG + Intergenic
1178791819 21:35707210-35707232 ATCGAGACACAATATGATCAAGG - Intronic
1179057999 21:37953847-37953869 ATGGAGACACAGAGAGCTGAAGG + Intronic
1179149560 21:38798337-38798359 GTGGAGACAGAGAATTATTAAGG + Intergenic
1180307104 22:11137481-11137503 ATGAAGACACAAAATTCTGAAGG + Intergenic
1180324268 22:11354597-11354619 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
1180545624 22:16499664-16499686 ATGAAGACACAAAATTCTGAAGG + Intergenic
1180598296 22:16994439-16994461 ATGTACACACAGAATCGTGAAGG - Intronic
1181349943 22:22247717-22247739 ATGGAATCCCAGAATCATGAAGG - Intergenic
1181885192 22:26016627-26016649 ATGGAGGAACAGAAAGATGGGGG - Intronic
1183292571 22:37011903-37011925 AAGGCCACACAGAAAGATGAAGG + Intronic
1184117340 22:42429923-42429945 ATGGAGTGACAGATAGATGAAGG + Intronic
1184403090 22:44285392-44285414 ATTGAGACCCAGAATGATTTGGG - Intronic
1184442585 22:44526929-44526951 ATGGAGACACCGAGAGCTGAAGG + Intergenic
1184604903 22:45567029-45567051 AGGGAGGCACAGAAAGGTGAAGG + Intronic
1184804767 22:46787319-46787341 ACGGAGACACAGAAAGCTGCTGG - Intronic
1185155388 22:49190653-49190675 AGGGAGGCAGAGAAGGATGAAGG + Intergenic
949160998 3:881790-881812 ATGGAGACCCACAAGGGTGAGGG - Intergenic
949561548 3:5207351-5207373 AAGGAGACAGAGAATGCTCAGGG - Intronic
950109711 3:10411178-10411200 ACACAGACACAGAAGGATGATGG + Intronic
950161465 3:10764183-10764205 ATAGAGACACAGCATCATGAAGG - Intergenic
950344260 3:12277610-12277632 TTGGATACACACAATGTTGATGG + Intergenic
950488277 3:13285582-13285604 ATGGAGACAGAGAATGAGCAAGG + Intergenic
951389018 3:22080061-22080083 ATGAAGACACAAAATGTTCAGGG + Intronic
951869452 3:27344699-27344721 ATGGAGAGAAAGAATGATTGGGG + Intronic
951932645 3:27985921-27985943 ATGAAGACACAGAGAGAAGATGG + Intergenic
952199010 3:31106130-31106152 CTGGAGACTCAGAAGGGTGAAGG - Intergenic
953277297 3:41514762-41514784 ATGGAGACTCAGAAGGGTGAGGG + Intronic
953380464 3:42467520-42467542 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
953419702 3:42744951-42744973 ATGAAGACATAGGAAGATGAAGG + Intronic
953470905 3:43165196-43165218 ATGAAGAAACAGATTTATGAAGG - Intergenic
954005315 3:47585940-47585962 ATGGAGAAAATGAATGAAGAAGG - Exonic
954007777 3:47605904-47605926 AAGGTGACTCAGTATGATGAGGG + Intronic
955168533 3:56539976-56539998 TTGGAGACAGAGAATGAAGGAGG - Intergenic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
955639353 3:61065877-61065899 ATGGAGATACAGTAAGTTGAAGG - Intronic
956031075 3:65038772-65038794 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
956078368 3:65530867-65530889 ATGGAGAGAGAGAAAGAGGAGGG + Intronic
956390480 3:68767628-68767650 TTTGGGACACAGAAAGATGAGGG + Intronic
956459320 3:69454948-69454970 AGCTAGACACAGAATGCTGATGG - Intronic
956695328 3:71914038-71914060 TTAGAGACTCAGAATGAGGAGGG - Intergenic
957086661 3:75685952-75685974 ATGGAGACACAGCAGGGTGAGGG - Intergenic
957768278 3:84655446-84655468 CTAGAGACACAGAAAGGTGAAGG + Intergenic
958461124 3:94397254-94397276 ATGAAGACCCAGAAGGATGAGGG + Intergenic
958608319 3:96389612-96389634 CTGGACACATAGAATGATGTAGG + Intergenic
958746963 3:98148085-98148107 ATGGAGACACAGAAAGGTTTTGG - Intergenic
959563404 3:107808945-107808967 CTGGAGAAACAAAATAATGATGG + Intronic
960072359 3:113445338-113445360 ATTGAGAAACAGAATGAAGAAGG - Exonic
960189404 3:114685070-114685092 ATGGGAAAACAGAATGATGTAGG - Intronic
960275819 3:115728105-115728127 ATGGAGAGACAGCATGAGGGAGG + Intergenic
960509716 3:118534493-118534515 ATGGAGCCTCAGAGAGATGATGG + Intergenic
961235072 3:125359185-125359207 CTGGAGACTCAGAGTGTTGAAGG - Intronic
961414730 3:126749039-126749061 AAGGAGACAAAGAATGAGGAGGG + Intronic
962030270 3:131592298-131592320 ACTGAGGCACAGAAAGATGAAGG + Intronic
962326943 3:134442255-134442277 AAGGAGACAGAGACTGCTGATGG - Intergenic
962704961 3:138034139-138034161 ATGGAGACTCAGAAAGTTTAAGG - Intergenic
962866511 3:139451887-139451909 ATGGTGGGACAGAAGGATGAAGG + Intergenic
963049263 3:141127714-141127736 ATGGAGACACAGGCTGGAGAAGG + Intronic
970182392 4:13413342-13413364 ATGGTGACACAGACTTCTGAAGG + Intronic
970221422 4:13815836-13815858 ATGGAGACTCAGAAGGGTGTGGG - Intergenic
970249602 4:14100316-14100338 ATGGAGACAAAGAGTGAGCAAGG + Intergenic
970497914 4:16645807-16645829 ATTGAGACTTAGAAAGATGAAGG - Intronic
970681259 4:18511198-18511220 ATGGAAACAGAGAAAGAAGAGGG - Intergenic
971542844 4:27842825-27842847 ATGGAGAAACATAATGTGGAGGG + Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
971738891 4:30495450-30495472 ATTCAGACACAGAAGGATTAAGG + Intergenic
972351936 4:38244187-38244209 ATGGAAACACAGCAGGATGAAGG - Intergenic
972408675 4:38769966-38769988 ATGGAGACAAAGCATGGGGAAGG - Intergenic
972594303 4:40516558-40516580 AAGGAGAAATAGAATGATGAGGG - Intronic
974126918 4:57707875-57707897 ATGCATACATAGAATGCTGATGG - Intergenic
975879190 4:78882816-78882838 ATGAAGCCACAGAATGATAATGG + Intronic
975953222 4:79800730-79800752 GTGAAGACACAGAAAGAAGATGG + Intergenic
976366110 4:84234139-84234161 ATGGAGAATAAAAATGATGAAGG + Intergenic
976406661 4:84667046-84667068 ATGGAGACAGAGTAGAATGATGG + Intergenic
977284326 4:95083331-95083353 ATAAAGACACAGAAAGATCATGG + Intronic
977597898 4:98903765-98903787 ATGTTTACACAGAATGATTAAGG + Intronic
977910285 4:102526325-102526347 ATGGAGATTCAGAAAGGTGAGGG + Intronic
977951273 4:102973219-102973241 ATGAAGACACAAAATTCTGAAGG + Intronic
978204462 4:106063803-106063825 ATGAAGACACAGCATAAAGATGG + Intronic
978655557 4:111061676-111061698 CTGGGGACAAAGAATGAGGATGG + Intergenic
978913685 4:114097081-114097103 TTGGAGACTCAGAATGGGGAAGG - Intergenic
979865049 4:125744084-125744106 ATGGAAAGATAGAATGAAGAAGG + Intergenic
980115814 4:128678169-128678191 ATGGAGAGACAGGGAGATGAGGG - Intergenic
980288092 4:130806986-130807008 AGCGAGGCACAGAATAATGAAGG - Intergenic
980848136 4:138348774-138348796 TTAGAGACACAGAAGGAGGAAGG + Intergenic
980999130 4:139811283-139811305 CTGGAAACACAGGATGATGGAGG - Intronic
982130256 4:152222931-152222953 TTGGAGATACAGATTGCTGACGG + Intergenic
982446135 4:155492522-155492544 ATGAAGACATAGAAGGAAGATGG + Intergenic
982873458 4:160613761-160613783 ATGGATACTGAGAATGATGAGGG - Intergenic
982887672 4:160802469-160802491 TTGGAGACTCAGAATGGGGATGG + Intergenic
983680113 4:170343671-170343693 AGGGAAAGAAAGAATGATGATGG - Intergenic
983960169 4:173742831-173742853 GTGAAGACACAGAGAGATGATGG + Intergenic
984005387 4:174299879-174299901 ATGAAGAAACAGAATTATGAAGG - Intronic
984475424 4:180228880-180228902 TTGGAAACACAGTAAGATGAAGG - Intergenic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
986471231 5:8078113-8078135 ATGGATACAGGGAAAGATGAAGG + Intergenic
986681091 5:10233274-10233296 ACTGAGACACAGCTTGATGAAGG + Intronic
986687498 5:10287474-10287496 ATGGAGACTCAGAAGGGGGAGGG + Intronic
986834332 5:11618048-11618070 GAGGAGGCAGAGAATGATGAAGG - Intronic
988000914 5:25347167-25347189 AGGAAGAAAGAGAATGATGAAGG - Intergenic
988935824 5:36082036-36082058 ATGGACACACAGTATGTTTAAGG - Intergenic
989443432 5:41500411-41500433 ATGGATACTCAGAAGGGTGAGGG + Intronic
990014491 5:51043095-51043117 AGAGAAACAAAGAATGATGATGG + Intergenic
990427444 5:55700864-55700886 AAGGAGACAGAGAAGGAGGAGGG - Intronic
990550312 5:56869373-56869395 CTGGAGACACATAGTGGTGATGG + Intronic
990656614 5:57963693-57963715 ATGGAGACACAGAAAGGTAAAGG - Intergenic
990804291 5:59640876-59640898 ATGGAGTTACAGAATGATAATGG - Intronic
991649813 5:68840401-68840423 ATACAGACACACAAAGATGATGG + Intergenic
992062904 5:73074492-73074514 ATGGAAAGACAGAATGGTTAAGG - Intronic
992321223 5:75614904-75614926 ATGGAGGAAAAGAATGGTGAGGG + Intronic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
992489530 5:77228688-77228710 ATGGAGAAAATGAAAGATGAGGG + Intronic
993003878 5:82410566-82410588 GTGAAGACACAGAACGAAGATGG + Intergenic
993045212 5:82858632-82858654 AGGGAGACACTGAAGGAAGAAGG - Intergenic
993165064 5:84342401-84342423 ATGGAGACTCAGAAAGGTGGGGG + Intronic
994979391 5:106854349-106854371 ATTGTGGCACAGAAAGATGAAGG - Intergenic
995469968 5:112490955-112490977 ATAGAGACACAGAGGGAGGAAGG + Intergenic
996077568 5:119214930-119214952 TTGGCGACAGAGAAAGATGATGG - Intronic
998678654 5:144439230-144439252 TTGGAGAAATACAATGATGAGGG + Intronic
998824059 5:146083332-146083354 ATAGAGACACAGAGGGAAGACGG - Intergenic
999412744 5:151366561-151366583 CAGGAGGCACAGGATGATGAGGG + Intergenic
999797406 5:155001467-155001489 ATAGAGACACAGAGGGAAGATGG + Intergenic
1000181966 5:158820279-158820301 GCGGAGACACAGAGGGATGAGGG + Intronic
1000383678 5:160652142-160652164 AAGGAGACACAGCAGGAGGAAGG - Intronic
1000563549 5:162820678-162820700 ATGGAGACACATTATGATTTTGG + Intergenic
1001396944 5:171424471-171424493 ACCGAGGCACAGAATGAGGAAGG + Intronic
1001425399 5:171619141-171619163 TTGGAGACACAGAAAAGTGATGG + Intergenic
1002135892 5:177107326-177107348 AGGGAGACACAGAAAGGTCATGG - Intergenic
1002826397 6:777944-777966 ATGAAGACACAGGAAGATGAAGG + Intergenic
1002899490 6:1399132-1399154 ATGGAGACAGAGAAGAAGGAGGG + Intergenic
1003017314 6:2478489-2478511 AGGGAGAAAGAGAAAGATGAAGG - Intergenic
1003172659 6:3732598-3732620 ATTGGGACAAAGAATGATTAAGG + Intronic
1004568445 6:16821671-16821693 GTAGGGACACAGAATGATGATGG + Intergenic
1004956893 6:20737135-20737157 ATGGAGGCACAGAAAGCTCAGGG - Intronic
1005414162 6:25583546-25583568 CTGGAGACATAGATGGATGAAGG + Intronic
1005849507 6:29810917-29810939 ATGGAGACCCAGAAGGGTAAGGG + Intergenic
1005917601 6:30367036-30367058 ATGGAGACACAGAGAAGTGAAGG + Intergenic
1006152756 6:31998079-31998101 CAAGAGACACAGAATGAAGAAGG - Intronic
1006159064 6:32030816-32030838 CAAGAGACACAGAATGAAGAAGG - Intronic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1006611060 6:35294815-35294837 ACAGAGACACAAAATGATGAAGG - Intronic
1008299674 6:49820138-49820160 AGGGAGACAAAGGAGGATGAAGG + Intergenic
1008441508 6:51536961-51536983 CTGAAGTCACAGAATGTTGAAGG - Intergenic
1009350257 6:62666781-62666803 AGAGAGACACAGAAAGAAGAAGG + Intergenic
1010079273 6:71839707-71839729 TTGGAAACAGATAATGATGATGG - Intergenic
1010828423 6:80501167-80501189 ATAGAGACTCCGAAGGATGAGGG + Intergenic
1011813036 6:91155062-91155084 ATTAAGATACAGTATGATGAGGG + Intergenic
1012823142 6:104114154-104114176 ATGGAAACTCAGAATGATGAGGG - Intergenic
1012902344 6:105020708-105020730 ATAGAGACTCAGAAGGGTGAGGG - Intronic
1013332890 6:109123459-109123481 ATTGAGCCACTGAATCATGAAGG - Intronic
1013851675 6:114523495-114523517 ATGGAAGCATAGAATTATGAAGG + Intergenic
1014675700 6:124362522-124362544 ATGGAGACAGAGAATAAGAAAGG - Intronic
1015003657 6:128251703-128251725 ATGGATACATAGAATTATGTGGG - Intronic
1015060280 6:128956124-128956146 ATGGAGCCACAGGATGAAGATGG + Intronic
1015725381 6:136294160-136294182 ATGGGGCAACAGAATCATGATGG + Intergenic
1016099771 6:140084878-140084900 GTGAAGACACAGAAAGAAGATGG + Intergenic
1016110328 6:140215564-140215586 ATGGAGACTCAGAAGTAAGAGGG - Intergenic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017272315 6:152522213-152522235 TTGGAGACTCAGAAGGATGAGGG - Intronic
1018653680 6:166011826-166011848 AAGCAAACACAGAAGGATGATGG + Intergenic
1018718674 6:166555738-166555760 AAGGTGACACAGAATCATCATGG + Intronic
1019391927 7:793180-793202 GTGGAGACTCAGAAGGGTGAAGG + Intergenic
1020970252 7:14928831-14928853 ATGGAGACTCAGATGGATGAGGG - Intronic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1022327706 7:29347026-29347048 ATGGAGACACAGAACGCTCCTGG - Intronic
1023006184 7:35870161-35870183 ATGGATACACAGAATTTTGTAGG + Intronic
1023332612 7:39134498-39134520 ATGTAAAGACAGAATGAAGAAGG - Intronic
1023670407 7:42570450-42570472 ATCTAGGCACAGAATGATGATGG + Intergenic
1025120088 7:56294529-56294551 ATGGAGAGACAGATGGATAAAGG + Intergenic
1026181997 7:68049735-68049757 ATGGTGAAACAGAATCATGTTGG + Intergenic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1026513046 7:71043412-71043434 ATGGAGACACTGAGTGATTAAGG + Intergenic
1026579144 7:71599487-71599509 AAGAGGACACAGAATGATGCGGG - Intronic
1027304201 7:76875505-76875527 AGGGAGACACAGGATGAGAAAGG + Intergenic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1027918956 7:84365478-84365500 TTGGAGACAAAGAGAGATGAGGG - Intronic
1028123910 7:87089354-87089376 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1028161741 7:87493592-87493614 ATGGAGACATGGAATAAAGAAGG + Intergenic
1029916881 7:104219344-104219366 AAGCAGTCACAGATTGATGATGG - Intergenic
1030671662 7:112344976-112344998 ATGGAGACAATGAATGATAATGG - Intergenic
1030991544 7:116307143-116307165 ATGGAGACTTAGAAGGGTGATGG + Intronic
1031863106 7:127005932-127005954 ATGGAAACATAGAAGGATGCTGG - Intronic
1032143911 7:129361143-129361165 ATTTAGACAGATAATGATGATGG + Intronic
1033454008 7:141486235-141486257 ACGGAGACCCAGAAAGGTGAGGG + Intergenic
1033459092 7:141529222-141529244 ATGGAGACACAGACACACGAGGG - Intergenic
1033502238 7:141963535-141963557 ATAGAGATGCACAATGATGATGG - Intronic
1035794719 8:2344256-2344278 AAGTAGATACAGACTGATGAGGG + Intergenic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1036743799 8:11389997-11390019 ATGGAGAGAGAGAGAGATGAAGG + Intergenic
1037047219 8:14322256-14322278 AGGGAGACAAACAATAATGAAGG + Intronic
1037587995 8:20291170-20291192 ATGGAGATCCAGAGTGATCAAGG + Intronic
1037949696 8:23010846-23010868 ATGAGGACACAGAGTGAAGAAGG + Intronic
1038242476 8:25822634-25822656 ACGGAGACAGAGAAGGGTGAGGG + Intergenic
1038333249 8:26626431-26626453 ATGGAGACACAGAATGGTAAAGG - Intronic
1038916581 8:32031201-32031223 ATGGAGACAGAGCCTGGTGATGG - Intronic
1039098347 8:33911922-33911944 ATGAAGACTCAGAAGGGTGAGGG + Intergenic
1039109623 8:34027641-34027663 ATGGAGAGACAGACTGGTGAGGG - Intergenic
1039439492 8:37584813-37584835 ACCGAGGCACAGAAAGATGAAGG - Intergenic
1040305868 8:46211479-46211501 ATGGGGCCACAGGATGATGTCGG + Intergenic
1040342236 8:46446887-46446909 ATGGGGCCACAGGGTGATGAGGG - Intergenic
1040869696 8:52087971-52087993 ATGTAGACAGAGGATGAAGATGG - Intergenic
1041181754 8:55256609-55256631 ATTGAGAGAGAGAATGCTGATGG + Intronic
1042498205 8:69479615-69479637 ATAGAAACACAGAATGTTGGAGG + Intronic
1042653436 8:71068706-71068728 ATGGAGATAAAGAATGATATTGG + Intergenic
1044218765 8:89645489-89645511 ATGGAAGCCCAGAGTGATGAAGG - Intergenic
1044471592 8:92575511-92575533 ATGGAGACAATGAAGGAAGAAGG - Intergenic
1044927457 8:97221716-97221738 TTGAAGACACACAATGAAGAAGG + Intergenic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1045090187 8:98733982-98734004 ATGGAGACTCACAATCATGACGG + Intronic
1045355920 8:101388996-101389018 ATGGGGACAGAGAAGGAGGATGG - Intergenic
1045559205 8:103244675-103244697 CTGTAAGCACAGAATGATGAAGG + Intergenic
1046042409 8:108921846-108921868 ATGGAGAGACAGAAAAAAGAAGG + Intergenic
1046252908 8:111656314-111656336 GTGGATACACAGAATGCTGAAGG + Intergenic
1047004718 8:120608498-120608520 ATGAAGACACAGAGAGAAGACGG + Intronic
1047028197 8:120847593-120847615 ATGAAGACACAGAAAGAAGCTGG + Intergenic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047504099 8:125465224-125465246 TTGGAGACACAGAGAGGTGATGG - Intergenic
1047601548 8:126430571-126430593 TTGGAGACACAGTCTGATCAAGG - Intergenic
1047834073 8:128669191-128669213 ATTGAGACTCACATTGATGATGG + Intergenic
1047843436 8:128779424-128779446 AGGTAGACACAGACTGATAATGG - Intergenic
1047893787 8:129342995-129343017 ATGGAGACACAGTAGGAAGGAGG + Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048386041 8:133913395-133913417 ATGGAGCCACAGACTGAAGTTGG - Intergenic
1048549180 8:135417697-135417719 CTGGAGACAGAAAATCATGATGG - Intergenic
1049608873 8:143543191-143543213 ATGGTTACACAAAATTATGACGG + Intergenic
1050632127 9:7571274-7571296 AGAGAGAAAGAGAATGATGATGG + Intergenic
1051522458 9:18004450-18004472 GTGAAGGCACAGAATGATGTGGG + Intergenic
1052551488 9:29955834-29955856 ATGGAGACTCAGAATGGGGAGGG - Intergenic
1053373755 9:37586496-37586518 ATGGAGACAGAGTAGAATGATGG + Intronic
1053474458 9:38372066-38372088 TTTGAGACGCAGAGTGATGAAGG - Intergenic
1053750139 9:41245072-41245094 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1054255638 9:62809411-62809433 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1054335673 9:63806196-63806218 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1055485789 9:76755361-76755383 ATGGAGAGAGAGAATGAGGGAGG + Intronic
1056234687 9:84582916-84582938 ACAAAGAGACAGAATGATGATGG + Intergenic
1056713914 9:89013006-89013028 ATAGAAACACAGAATTGTGAGGG - Intergenic
1057164634 9:92916087-92916109 CTGGCTACACAGAATGATGTTGG - Intergenic
1057860138 9:98634480-98634502 ACAGAGACACAAAATGAAGAAGG + Intronic
1058463933 9:105209617-105209639 ATGGAGACTCAGAAGGAGAAGGG - Intergenic
1059266032 9:113031470-113031492 ATGGAGATGGAGAATGGTGATGG + Intergenic
1059636923 9:116180130-116180152 TTGGAGTCACAGAATGTGGATGG + Intronic
1059828225 9:118058118-118058140 ATGGAGACTCAGAAGCCTGAGGG - Intergenic
1060050930 9:120377625-120377647 ATGCAGACACAGCAAGAAGATGG - Intergenic
1060115509 9:120937033-120937055 ATGGAGACACAGAGAGATTTTGG + Intergenic
1060865456 9:126991694-126991716 ACAGAGACACAGAAAGATGAGGG - Intronic
1061727718 9:132590482-132590504 ATGGAGACAGAGGAGGAGGAGGG - Intergenic
1062175452 9:135159605-135159627 ATTGAGGCACAGAAAGATGGGGG + Intergenic
1203371924 Un_KI270442v1:315169-315191 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1185633070 X:1530082-1530104 ATGGATACATAGATGGATGACGG - Intronic
1186632314 X:11363172-11363194 ATGGAGCCACAGTATGCTAAGGG + Intronic
1186650823 X:11558294-11558316 ATGGAAACAGAAAATGATGTCGG + Intronic
1186835861 X:13437159-13437181 TTGGAGACTCAGAAGGGTGAGGG + Intergenic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1188303982 X:28539840-28539862 ATGCAGACACAGAAGGAAGATGG + Intergenic
1189175570 X:38953866-38953888 ATGGAGGCTCAGAAGGATCAAGG + Intergenic
1189575801 X:42351932-42351954 ATGAAGACACAGAAGAGTGAGGG - Intergenic
1189867768 X:45349260-45349282 ATGGAAACACAGAATCAAAAAGG - Intergenic
1189898997 X:45686502-45686524 AGGGAGAGACAGCATGAAGAAGG - Intergenic
1190417446 X:50193953-50193975 ATGGACAGATTGAATGATGAAGG + Exonic
1191834546 X:65449839-65449861 TTGGAGACTCAGAAGCATGAGGG + Intronic
1192065318 X:67879224-67879246 ATGGAGACATGGCATGAAGACGG + Intergenic
1192190182 X:68986347-68986369 ATGAAGACATAGAATCATGGAGG - Intergenic
1192968307 X:76203203-76203225 ATGGAGACTCAGGATCATCAGGG - Intergenic
1193218303 X:78891576-78891598 ATGGAGACTTAGAATGATAAGGG + Intergenic
1193279904 X:79634965-79634987 ATGGAGACAGAGTAGAATGATGG - Intergenic
1193979184 X:88159897-88159919 ATGGAGACTCAGAATGATGGTGG - Intergenic
1195010283 X:100726931-100726953 ATGGAGACTCAGAAGGGTGAGGG - Intronic
1197097561 X:122613545-122613567 ATGGACTCACAGAATGCCGATGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197821169 X:130542333-130542355 AGGGAGACACAGAAGGGAGATGG - Intergenic
1198316762 X:135475526-135475548 GTGGAGTCAGAGGATGATGATGG + Intergenic
1198626089 X:138576661-138576683 ATATAGACAAAGAATGATGAGGG - Intergenic
1199516987 X:148689146-148689168 GTGAAGACACAGAAAGAAGATGG - Intronic
1200392764 X:155960620-155960642 AAGGAGACACCGAATGATCGTGG + Intergenic
1201066423 Y:10099957-10099979 ATGGAGACTCAGGAGGGTGAGGG - Intergenic
1201186478 Y:11408903-11408925 ATGAAGACACAAAATTCTGAAGG + Intergenic
1201516497 Y:14824082-14824104 GTGGAGAGAGAGAATGAAGAAGG + Intronic
1201761461 Y:17543930-17543952 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1201840091 Y:18362060-18362082 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1202384333 Y:24310239-24310261 ATGTAAACTCAGAATGATTAAGG + Intergenic
1202486451 Y:25359883-25359905 ATGTAAACTCAGAATGATTAAGG - Intergenic