ID: 918573163

View in Genome Browser
Species Human (GRCh38)
Location 1:186022983-186023005
Sequence GGATTTTTGTATCTTATACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 223}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918573163_918573166 15 Left 918573163 1:186022983-186023005 CCAAGTATAAGATACAAAAATCC 0: 1
1: 0
2: 1
3: 15
4: 223
Right 918573166 1:186023021-186023043 CCCAATTAGATACAGTCTTCTGG 0: 1
1: 0
2: 0
3: 6
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918573163 Original CRISPR GGATTTTTGTATCTTATACT TGG (reversed) Intronic
903094893 1:20961997-20962019 GGATTTGTTTACATTATACTAGG + Intronic
903841554 1:26245336-26245358 GGTTTTTGGTTTCTGATACTGGG + Intronic
905414975 1:37797643-37797665 GTATTTTTGTATCTTTAGCTGGG + Intronic
908281855 1:62547863-62547885 GGAGTTCTGTATTTTATACTGGG + Intronic
908566349 1:65360407-65360429 GGATATTTATATCTTTTAATAGG + Intronic
908611836 1:65869817-65869839 GCACTTTTGTATCTTTTAGTAGG + Intronic
911307470 1:96248426-96248448 GGATCTTAGTATCTTCTACAGGG + Intergenic
911810133 1:102265582-102265604 GGGTTTTTCTCTCTTATACATGG - Intergenic
911935580 1:103966052-103966074 TTATTTTTGTATATTAGACTTGG + Intergenic
912313215 1:108643657-108643679 TGTTTTTTGAATCTTATATTGGG + Intronic
912787882 1:112621628-112621650 GGATTTTTGTCTTTGATACCAGG + Intronic
916856804 1:168758343-168758365 GAATTTTTGTCTCTAAGACTTGG - Intergenic
918573163 1:186022983-186023005 GGATTTTTGTATCTTATACTTGG - Intronic
918873670 1:190010076-190010098 GCATTTCTGTATCTTTTACGTGG - Intergenic
919539833 1:198832543-198832565 TGATTTTTGTATGCTATAGTTGG - Intergenic
920629833 1:207641248-207641270 GGATTTTTTTTTCTTGTAATGGG - Intergenic
922943383 1:229489077-229489099 GGATTTTTCTATAGTATACAAGG + Intronic
923145965 1:231198226-231198248 TGATCTTTGTATCTTGTGCTGGG - Intronic
923764675 1:236882146-236882168 CAATTTTTGTTTCTTATTCTTGG + Intronic
924699366 1:246435710-246435732 GAATTCTTGTATCTTCTCCTTGG - Intronic
924699369 1:246435741-246435763 GAATTCTTGTATCTTCTCCTTGG - Intronic
924699372 1:246435772-246435794 GAATTCTTGTATCTTCTCCTTGG - Intronic
1063004740 10:1958356-1958378 GTATTTTTTTTTCTTTTACTTGG + Intergenic
1064460900 10:15534380-15534402 GCATCTTTGTATCATATAGTTGG - Intronic
1064728467 10:18305009-18305031 ATATTTTTGTGTCTTATACAAGG + Intronic
1066319501 10:34287192-34287214 GGATTTGTACATCTTATACTTGG - Intronic
1067246189 10:44547868-44547890 CGATTTTTCTATCTTATAATGGG - Intergenic
1070869442 10:79737397-79737419 GGTTGTTTTGATCTTATACTAGG - Intergenic
1070936642 10:80303673-80303695 GGATTTCTGTATTTTTTAATAGG - Intergenic
1071636360 10:87259603-87259625 GGTTGTTTTGATCTTATACTAGG - Intergenic
1071658881 10:87478348-87478370 GGTTGTTTTGATCTTATACTAGG + Intergenic
1073905096 10:108269871-108269893 GGCTTTTTTTATTTTTTACTGGG + Intergenic
1076627078 10:131828438-131828460 GGATTTTTTTTTCTAATTCTGGG + Intergenic
1077683621 11:4270370-4270392 TTATTTTTGTATTTTAAACTTGG - Intergenic
1077686421 11:4296394-4296416 TTATTTTTGTATTTTAAACTTGG + Intergenic
1077691573 11:4347582-4347604 TTATTTTTGTATTTTAAACTTGG + Intergenic
1078442016 11:11376213-11376235 TGATTTTTGTATTTTTTACTAGG - Intronic
1079973913 11:27069090-27069112 GGATTTTTTTTTCTAATTCTGGG + Intronic
1080375304 11:31702786-31702808 GGAGTTAAGTATCTTATACAAGG - Intronic
1083635656 11:64119577-64119599 GAATTTTTGTGTCTTTTTCTGGG - Intronic
1086405120 11:86493020-86493042 GGATCTTTGTATCTTACCCCAGG - Intronic
1087498756 11:98923822-98923844 AGATTATTTTATGTTATACTAGG + Intergenic
1088160706 11:106866594-106866616 GCATTTTTGTACCTTTTATTTGG + Intronic
1088959508 11:114648709-114648731 GGATAGTTGTATCATATATTAGG - Intergenic
1090089960 11:123687475-123687497 GGATTTACTTATCTTATACTGGG + Intergenic
1090444245 11:126749672-126749694 GGACTTTTGTATTTTCTTCTCGG - Intronic
1092784049 12:12011767-12011789 GGACTTTTGTTTCTAAAACTGGG + Intergenic
1095359784 12:41322367-41322389 GTAATTTTGGATCTCATACTGGG + Intronic
1095555797 12:43502706-43502728 GGATATTTTTATTTTCTACTTGG - Intronic
1096821885 12:54242756-54242778 AGATTTTTTTTTGTTATACTTGG - Intronic
1097092856 12:56521261-56521283 TGATTTTTGTATTTTTTAGTAGG - Intergenic
1099713592 12:86262564-86262586 AGATGTTTGTATCTTCCACTAGG + Intronic
1100733085 12:97495569-97495591 GGATTTTAGTATAGTATACAGGG - Intergenic
1101646897 12:106639577-106639599 GAATTTTTGTATTTTATTTTAGG + Intronic
1105734379 13:23252773-23252795 GGATTTTCGTATATTATGCAAGG + Intronic
1106911435 13:34467397-34467419 GGCTTTTTATATTTTATATTTGG + Intergenic
1109399996 13:61813906-61813928 AGATTATTCTATTTTATACTTGG + Intergenic
1109807466 13:67462349-67462371 GGATTTTCTTATTTTATACTAGG - Intergenic
1109987348 13:70006382-70006404 GGATTTTTGTATCTTTATTTGGG + Intronic
1110380892 13:74849281-74849303 GGATTTTTGTAAGCTCTACTTGG - Intergenic
1110404992 13:75140637-75140659 GGATTTTGGTAGCCTGTACTTGG - Intergenic
1111535098 13:89593262-89593284 GGATTATTGTTTATAATACTAGG + Intergenic
1113500731 13:110771924-110771946 TTATTTTTGTATATTATACCTGG - Intergenic
1114976449 14:28106613-28106635 AGATTTTTGAATCATAAACTTGG - Intergenic
1114984226 14:28206939-28206961 GGATTCTTATTTCTTAAACTGGG - Intergenic
1119957587 14:78816308-78816330 GGATTTTTGTATCTTCTTTCAGG + Intronic
1120838725 14:89064098-89064120 CAATTTTTGTATCTTTTTCTTGG - Intergenic
1123914575 15:25009980-25010002 GGATTTTAGTAAATTTTACTAGG - Intergenic
1125348362 15:38742222-38742244 GGAGTTTTGTGTCTAACACTGGG - Intergenic
1125624661 15:41097767-41097789 GTATTTTTGTATTTTAGGCTGGG - Intronic
1126178609 15:45763052-45763074 GGATTCATGTGTCTGATACTTGG + Intergenic
1126712613 15:51476801-51476823 GAATTTTTGTTTCTTAAAATAGG - Intronic
1128427797 15:67559863-67559885 AGCTTTTTCTATCTTATACATGG - Intronic
1128612592 15:69086062-69086084 GAATTTTTTAACCTTATACTTGG + Intergenic
1130951879 15:88598107-88598129 GTATTATTGTATTTTATAGTCGG + Intergenic
1131915350 15:97259418-97259440 AGATTTTTTTATCTTTTTCTAGG - Intergenic
1132048043 15:98581833-98581855 TGATTTTTTTTTCTTATATTTGG + Intergenic
1134428968 16:14182911-14182933 GAATTTTTTTTTCTTATAGTAGG + Intronic
1134516368 16:14890553-14890575 GCTATTTTGTATCTTAGACTGGG + Intronic
1134704042 16:16289205-16289227 GCTATTTTGTATCTTAGACTGGG + Intronic
1134963501 16:18422909-18422931 GCTATTTTGTATCTTAGACTGGG - Intronic
1134967796 16:18505508-18505530 GCTATTTTGTATCTTAGACTGGG - Intronic
1135053667 16:19212835-19212857 GGATTTTTGTATTTGGTGCTTGG + Intronic
1135233160 16:20728775-20728797 GACCTTTTATATCTTATACTAGG + Intronic
1141931116 16:87203544-87203566 GGAATTTTGCATCCTATATTAGG - Intronic
1142107375 16:88311746-88311768 AGGTTTTTGTGTCTTAAACTTGG + Intergenic
1143935256 17:10477194-10477216 GGATTTTTATAAATTTTACTGGG + Intergenic
1145016401 17:19401278-19401300 TGATTTTTGTCTCTTATGCAGGG - Intergenic
1145371290 17:22308378-22308400 GGTTTTTTGTATTTTAAACATGG + Intergenic
1147486937 17:40824911-40824933 GGATTTTTATATTTTCCACTGGG - Intronic
1147628742 17:41916758-41916780 GGATTTGTGTACCTTTTTCTGGG - Intronic
1150990331 17:70250432-70250454 GGATTTTTTTTTTTTTTACTAGG - Intergenic
1151137298 17:71959110-71959132 AGATTTTTCTTTCTTATGCTAGG - Intergenic
1152613567 17:81327958-81327980 AGATTTTTGTATCTATTCCTGGG + Intronic
1153150428 18:2086491-2086513 GGATTTTTGTTACTTCTACCTGG - Intergenic
1153517513 18:5917807-5917829 GGATCTTTGCATCTGTTACTTGG + Intergenic
1155774508 18:29742347-29742369 GAATGTTTGTTTCTTATATTTGG + Intergenic
1156676959 18:39538858-39538880 GGAATTTTGTTTCTTAAACTTGG - Intergenic
1159229301 18:65585050-65585072 GGATTGCTGTATCATATATTAGG + Intergenic
1159373634 18:67562685-67562707 GGATTTTAGAATCATAAACTTGG - Intergenic
1161551219 19:4913660-4913682 GGATTTTGGTTTCTGAGACTGGG + Intronic
1161828481 19:6585839-6585861 TGATTTTTGTATTTTTTAATAGG + Exonic
1161872672 19:6882400-6882422 GGCTTTCTGTATCTTACAATGGG + Intergenic
927251665 2:21000264-21000286 GGATTGTTGGATATTATATTTGG + Intergenic
927897301 2:26791992-26792014 GGATTTTTGTCTGTTTTATTAGG - Intronic
928505163 2:31944012-31944034 GGATTTTTGAGTCTCAGACTAGG - Intronic
928891461 2:36208525-36208547 GGCTATTTGTATGTTTTACTTGG + Intergenic
929832294 2:45356913-45356935 GGAGTTTGGGATCTTATTCTAGG - Intergenic
930045755 2:47170950-47170972 GTATTTGTATATCTTAAACTTGG - Intronic
931051686 2:58422783-58422805 GGATTTTTCTTTTTCATACTAGG + Intergenic
931052688 2:58431471-58431493 GGGTTTTTGGATCTATTACTTGG + Intergenic
931803987 2:65787091-65787113 AGAGTTTTGTATCTTTTATTTGG - Intergenic
932928954 2:76011012-76011034 TGAGTTTTGTATATTATTCTGGG + Intergenic
932966116 2:76476786-76476808 GGATTATTTTATCTTTTACATGG - Intergenic
933073028 2:77886308-77886330 GGTTTTTTATTTCTTAAACTAGG - Intergenic
933129363 2:78654318-78654340 GGATTTTTGTAAGTTTTATTTGG - Intergenic
933276888 2:80293664-80293686 GGATTTTTGCAACTTAAACAAGG - Intronic
934095900 2:88603567-88603589 AGATTTTTGCATCTGCTACTTGG - Intronic
935135740 2:100299854-100299876 TCAGTTTTGTATTTTATACTGGG - Exonic
935344864 2:102097961-102097983 TGATTTTATTTTCTTATACTGGG - Intronic
938887545 2:135667767-135667789 GGATTTTTCTTTCTCAAACTTGG + Intronic
939146028 2:138415843-138415865 GGATTTTGGAATTTTATATTTGG + Intergenic
940743086 2:157534635-157534657 GGATTTTTGATATTTATACTTGG - Intronic
941594875 2:167463722-167463744 GCATTTTCATATCTTTTACTTGG - Intergenic
942639505 2:178047038-178047060 GGATTTTTTTTTTTTTTACTTGG + Intronic
942856240 2:180552702-180552724 GGATCTTTGAATATTATAGTTGG - Intergenic
943787675 2:191896660-191896682 GGTTTTTTGTTACTTATTCTGGG + Intergenic
945661442 2:212690642-212690664 GGATTTTTTTAACTTATATATGG - Intergenic
946653488 2:221919558-221919580 GGAATTTTCTTTCTTAGACTCGG - Intergenic
947987122 2:234458201-234458223 GGATTATTGATTCATATACTAGG + Intergenic
1168917454 20:1501948-1501970 GGAACTTTTTATCTTATGCTGGG - Intergenic
1170170767 20:13409395-13409417 CAATTTTTGTTTCTTTTACTAGG + Intronic
1172547443 20:35772505-35772527 GGCTTTTTTTATCCTATTCTGGG + Intronic
1172922381 20:38495966-38495988 GTATTTTTATTTCTTATTCTGGG + Intronic
950803827 3:15579178-15579200 GGATTTTTGGATATTGTATTTGG - Intronic
951928331 3:27935202-27935224 GCATTTTTGCAGCTTATCCTTGG + Intergenic
955471243 3:59288555-59288577 GCATTTTTGTCTGTTTTACTTGG + Intergenic
955651682 3:61201562-61201584 GGATTGTTTTAGCTTTTACTGGG + Intronic
956861836 3:73332034-73332056 TGATTTTTGTTTATAATACTAGG + Intergenic
957483625 3:80830113-80830135 ATAGTTTTGTATCCTATACTTGG + Intergenic
957510670 3:81183907-81183929 AGATTTTTGTATCTGAAAGTAGG - Intergenic
958569014 3:95855741-95855763 GCATTTTTTTATCTTAGACTAGG + Intergenic
959185604 3:103043132-103043154 GAATTTTTGTATCTTTTTCTGGG + Intergenic
960533439 3:118791142-118791164 TTACTTTTGTATCTTATACAAGG - Intergenic
963585899 3:147187641-147187663 AATTTTTTGTATCTTATACATGG + Intergenic
965209402 3:165766285-165766307 GGATTTTGCTATCTTTTTCTAGG + Intergenic
965901720 3:173648874-173648896 GGATGGTTGGATCTTATAGTAGG - Intronic
970978453 4:22069661-22069683 AGAATTTTCTTTCTTATACTTGG - Intergenic
971188547 4:24404565-24404587 GGATGTTAGTACCTTATACTGGG - Intergenic
971318577 4:25587147-25587169 GGTTTTTTGTATTTTTTAGTAGG + Intergenic
971440645 4:26681232-26681254 GGCTCTATGTATCTTAAACTGGG - Intronic
972136966 4:35904436-35904458 TTAATTTTGTGTCTTATACTTGG + Intergenic
972430774 4:38979452-38979474 GAATTTTGATATATTATACTTGG + Intronic
972444012 4:39126416-39126438 GTTTTTTTGTATCTTCTCCTGGG + Intronic
972731454 4:41798978-41799000 GGATTTTTTTATATTATAAAAGG + Intergenic
972981114 4:44702907-44702929 GAATATTTATATCTTGTACTTGG - Exonic
973151545 4:46894464-46894486 TGATTTTTGTATATGATACAAGG - Intronic
976329679 4:83815008-83815030 GCATTTTTTTCTCTTTTACTTGG - Intergenic
976943438 4:90735129-90735151 TGATTTTTGTATGTTAAACCAGG + Intronic
978113694 4:104993468-104993490 GGATTATTGTGTCTTGTAGTGGG - Intergenic
978829418 4:113066419-113066441 TCATTTTTGTATCTTGTATTTGG - Intronic
982247584 4:153369272-153369294 GTTTTTTTGTATCTTAATCTAGG + Intronic
982606330 4:157521090-157521112 GGATATTTATATCTTATTCCTGG - Intergenic
984253752 4:177365420-177365442 TGATTATTGTATTGTATACTTGG - Intergenic
984313834 4:178100378-178100400 GGATTTCTGTTGCTTAGACTTGG + Intergenic
984594439 4:181651620-181651642 ACATTTTTGTAACCTATACTAGG + Intergenic
987569058 5:19631813-19631835 GGATTTCTGTCTCTTTTACTTGG + Intronic
987725333 5:21691519-21691541 GGATAGTTGTATCTGATACATGG + Intergenic
990137304 5:52661664-52661686 GGATTTCTTTCTCTTCTACTTGG + Intergenic
995896292 5:117015047-117015069 ATATTTTTGTATTTTATTCTGGG + Intergenic
998033674 5:138894740-138894762 GGATTTTTGAATATTATTCCAGG - Intronic
998035310 5:138910185-138910207 TGATTTCTGTATCTTAAAATTGG + Intronic
1000788731 5:165578620-165578642 GAAATTTTGTTTCTTATACTAGG - Intergenic
1000916819 5:167092846-167092868 AGATATTTGTATCTCTTACTGGG - Intergenic
1000978493 5:167790991-167791013 AGATTTTTGAATCATATTCTGGG - Intronic
1001527404 5:172438448-172438470 GGCTTTTTGTCTCTTTTACCGGG - Intronic
1003845175 6:10166414-10166436 GGATTTTTGTATTTTTCAATAGG - Intronic
1005023098 6:21436340-21436362 GGATTTTTTTTTCTTATATAGGG - Intergenic
1006731183 6:36237251-36237273 GTATTTTAGTTTCTTGTACTAGG + Intergenic
1007901021 6:45412910-45412932 TGATTTTTGTATTTTATTTTAGG + Intronic
1008450497 6:51645251-51645273 TGATATTTGTATATTATAATAGG - Intronic
1012229381 6:96742534-96742556 GGATTTTTTTTTTTTTTACTTGG - Intergenic
1012561884 6:100591334-100591356 GGATATTTGTATCTTTTATATGG - Intronic
1012667087 6:101985244-101985266 GTATTTTTGTATTGTATTCTAGG + Intronic
1014574663 6:123055611-123055633 GGATTTTGGTATGATATATTAGG + Intronic
1015250643 6:131124231-131124253 AGATTTCTGTCCCTTATACTTGG + Intergenic
1015393108 6:132705738-132705760 AGATGTTATTATCTTATACTTGG + Intronic
1018691866 6:166352927-166352949 GGCTTTTTGTTTTTTCTACTTGG + Intergenic
1020808395 7:12820426-12820448 GAATTTTTCCGTCTTATACTTGG - Intergenic
1021032736 7:15758878-15758900 GAGTTTTTGTTTCATATACTTGG - Intergenic
1022553670 7:31269458-31269480 GGACGTTTGTATATCATACTTGG + Intergenic
1024820744 7:53327198-53327220 GTATTTCTGAATCTTATACAGGG + Intergenic
1026062728 7:67040514-67040536 AGATTTTTGTATTTTCTACCAGG + Intronic
1026715621 7:72786901-72786923 AGATTTTTGTATTTTCTACCAGG - Intronic
1027007056 7:74703815-74703837 TCATTTTTGTATATTATACAAGG + Intronic
1027611254 7:80363718-80363740 AGATTTCTGTATCTTATAATAGG + Intergenic
1027712826 7:81629116-81629138 GTATTTTTGTTGCTTATAATTGG - Intergenic
1027754902 7:82201392-82201414 GTATTTTTGTAAGTGATACTAGG - Intronic
1027999098 7:85468191-85468213 GGATATTTATTTCTTTTACTCGG - Intergenic
1028049980 7:86173565-86173587 AAATATTTGTATATTATACTAGG + Intergenic
1028817536 7:95164405-95164427 GGATTTTTTTCTCTTATAATTGG + Intronic
1029314792 7:99701478-99701500 GGATTTCTGGATCTTATGATAGG + Intronic
1030440359 7:109581421-109581443 TAATTTTTGTATCTTTTTCTTGG + Intergenic
1030726178 7:112927189-112927211 GGAGTTTTAAATATTATACTGGG - Intronic
1032929422 7:136649190-136649212 GGAATTTTGTACCTTATCTTAGG - Intergenic
1033538415 7:142333364-142333386 GGAATATTCTATCTTAAACTTGG - Intergenic
1033852019 7:145508202-145508224 CGAATTTAGTATCTCATACTAGG + Intergenic
1033872740 7:145777157-145777179 GGATTTATCTATCTTAGAATTGG - Intergenic
1038998457 8:32952556-32952578 GAATTTTAGTATCTTACACTTGG + Intergenic
1040378380 8:46848581-46848603 GGGATTTTGGATCTTATACATGG + Intergenic
1040756014 8:50776620-50776642 TGAGTTTTCTAACTTATACTTGG - Intronic
1042588640 8:70372120-70372142 GGCTTTTTGTGTTTTATTCTGGG - Intronic
1043045568 8:75319252-75319274 GGTTTTATGTAGATTATACTAGG - Intergenic
1043407935 8:79957770-79957792 GGATTTTTCTAGTGTATACTGGG - Intronic
1044052534 8:87525389-87525411 GGATTTCTGTATCTTATAATTGG - Intronic
1046331544 8:112722045-112722067 GGATTTTTTTTTCATATAATGGG - Intronic
1046480244 8:114807717-114807739 GGATTGTTGTATCATCAACTGGG + Intergenic
1047082369 8:121477288-121477310 GGTTTTTTGTATGTTATGCCAGG + Intergenic
1047402627 8:124559113-124559135 GGATTTGTGTGTCTTTTGCTGGG + Intronic
1048752871 8:137699606-137699628 GGATTATTGTGTCTTGCACTTGG + Intergenic
1048887009 8:138916783-138916805 GGATTTTTGTTTTTTTAACTGGG - Intergenic
1050029411 9:1369567-1369589 AGATATTTGTATATTATTCTAGG - Intergenic
1050218004 9:3350347-3350369 AGATTTTGGTATCTTATGATGGG - Intronic
1050502218 9:6310789-6310811 GTATTTTTATATTTTATAGTAGG - Intergenic
1055384823 9:75749069-75749091 TAATTTTTGTATCTTTTAGTAGG - Intergenic
1055718253 9:79142405-79142427 TGATTTTTTTTTCTTTTACTTGG - Intergenic
1061654491 9:132078668-132078690 GGATTTTTGTTTTTTCAACTTGG - Intronic
1187563986 X:20430092-20430114 GGATTTTTGTACTTTATTTTTGG + Intergenic
1187996161 X:24929177-24929199 GGATCCTTGGATCTAATACTTGG + Intronic
1188488383 X:30708646-30708668 ACATTTTTGTATGTTATAGTAGG + Intronic
1189859753 X:45260339-45260361 TGATTTTTGTTTCCTATAATGGG - Intergenic
1190718275 X:53123543-53123565 GGATTAAAGTATCTGATACTCGG + Intergenic
1191974975 X:66861721-66861743 TGATTTTTGTATCATATTGTAGG + Intergenic
1192619888 X:72668817-72668839 GGACTTTTGAGTCTTATCCTTGG - Intronic
1193622317 X:83771077-83771099 GGATATTTGTATCTTTCTCTAGG + Intergenic
1194992525 X:100560232-100560254 GGAATGTTTTTTCTTATACTGGG - Intergenic
1195267221 X:103194185-103194207 GGACTTTGGTATCTTATTCCTGG - Intergenic
1196303662 X:114074797-114074819 GGTTTTTTTTTTCTTATATTCGG + Intergenic
1197677824 X:129348916-129348938 GGATATTTGTATCTTTCTCTAGG - Intergenic
1202061603 Y:20894982-20895004 TGAACTTTATATCTTATACTTGG - Intergenic