ID: 918574372

View in Genome Browser
Species Human (GRCh38)
Location 1:186038815-186038837
Sequence ATGTAATAACTGAAAGAAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 551
Summary {0: 1, 1: 1, 2: 6, 3: 41, 4: 502}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918574372_918574374 5 Left 918574372 1:186038815-186038837 CCTTCTTCTTTCAGTTATTACAT 0: 1
1: 1
2: 6
3: 41
4: 502
Right 918574374 1:186038843-186038865 AAAGATAATCGTCTACTCTCAGG 0: 1
1: 0
2: 0
3: 5
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918574372 Original CRISPR ATGTAATAACTGAAAGAAGA AGG (reversed) Exonic
901108872 1:6779436-6779458 ATGTAATAGCTGGATGATGAGGG + Intergenic
901257116 1:7839236-7839258 CTTCAGTAACTGAAAGAAGATGG - Intronic
902137057 1:14317161-14317183 ATGACAGAACTGAAAGCAGAAGG - Intergenic
904390822 1:30184640-30184662 ATGGACTAAAGGAAAGAAGATGG - Intergenic
905951056 1:41951150-41951172 AATTAAATACTGAAAGAAGAAGG + Intronic
906740053 1:48173683-48173705 ATGAAATAATGGAATGAAGATGG - Intergenic
907104242 1:51866269-51866291 ATGTAAGAACGTAAAGAAGCAGG + Intronic
907356170 1:53875876-53875898 ATTTAATAGCAGAGAGAAGAAGG - Intronic
909195276 1:72613030-72613052 ATGTAACAAATGAAAGAATAAGG + Intergenic
909209074 1:72799554-72799576 ATATAATAAATGAAAGGACAAGG - Intergenic
909218950 1:72929642-72929664 TTTTAATAACTGGGAGAAGAGGG - Intergenic
909274818 1:73669591-73669613 CCATAAGAACTGAAAGAAGAGGG + Intergenic
909355086 1:74698939-74698961 ATGTAAAAACTGAAATTACATGG + Intergenic
909503913 1:76365914-76365936 ATGTAGGAACTGGAAGGAGATGG - Intronic
909684803 1:78335864-78335886 ATGTAATAATTGGAAGAACAAGG - Intronic
909716924 1:78719514-78719536 TTGAAATAAATGAATGAAGAAGG - Intergenic
910406501 1:86896792-86896814 TTTTAAAAACTGAAAGAATAAGG - Intronic
910672696 1:89789073-89789095 ATGTCATAACTCAAACTAGAGGG - Intronic
910691562 1:89970684-89970706 ATGTAAAGACAGAGAGAAGATGG + Intergenic
910960286 1:92754984-92755006 ATGTTATATCTTAAAGAAGATGG + Intronic
911860708 1:102944481-102944503 CTGGGATAACTGAAAGAGGATGG + Intronic
911903724 1:103538257-103538279 GTATAAGAACTGAAACAAGAAGG - Intronic
912073700 1:105845975-105845997 ATATGTTAACTGGAAGAAGAAGG + Intergenic
912663020 1:111551235-111551257 ATGTAATTACTGAAAAGAAAGGG + Intronic
912904053 1:113684798-113684820 ATTAAATAACTGAAATAAAAAGG - Exonic
913130070 1:115830970-115830992 ATGGAATAACTGAAAATAAAAGG + Intergenic
913223132 1:116675408-116675430 ATGGAAGATCTGAGAGAAGAGGG + Intergenic
915170767 1:153975712-153975734 ATGGAATATCTGAAAGAAGAGGG - Intronic
915683031 1:157600813-157600835 ATGGAAAAACTGAAAAAAGCTGG - Intergenic
915683039 1:157600934-157600956 ATGGAAAAACTGAAAAAAGCTGG - Intergenic
916155823 1:161846089-161846111 CAATAATAACTGAAATAAGAAGG - Intronic
917582239 1:176391044-176391066 ATGGAAGAACTGACAGAAGTAGG - Intergenic
918106385 1:181418910-181418932 ATGTAATAATTGATTGAAGCTGG + Intronic
918574372 1:186038815-186038837 ATGTAATAACTGAAAGAAGAAGG - Exonic
918775633 1:188626364-188626386 ATGTCTGAACTGACAGAAGAAGG + Intergenic
919004904 1:191885001-191885023 AAGTACTAACTGAAATATGATGG + Intergenic
919534230 1:198766903-198766925 AAGAAATAAATGAAGGAAGAAGG + Intergenic
919535604 1:198783599-198783621 ATTTAATAGCTGAAAATAGAAGG + Intergenic
919671852 1:200345444-200345466 TTATAATAATTGAAAGAGGAAGG - Intergenic
919701306 1:200633935-200633957 ATGTAGTCAATGAAAGTAGAAGG - Intronic
920537712 1:206750285-206750307 ACGAAATAACAGAAAGAAGTAGG - Intergenic
920789888 1:209080042-209080064 ATTTAATAACATAAAAAAGATGG - Intergenic
921453880 1:215343272-215343294 ATGTAGTAACTTAAGGATGAAGG + Intergenic
921668818 1:217904167-217904189 ATATAAGACCTGAAACAAGAAGG - Intergenic
921877682 1:220217421-220217443 ATGGAAAAACAGAAAGGAGAGGG - Intronic
921943293 1:220865949-220865971 AATTAATAACAGAAAGAAGTTGG - Intergenic
922597145 1:226822871-226822893 ATGTGATGACTGAAACAAGAGGG - Intergenic
923430647 1:233916972-233916994 ATTTGATGACTGAATGAAGAAGG - Intronic
924078415 1:240366022-240366044 GTGTAAGAGCTGAAACAAGAAGG + Intronic
924119678 1:240783670-240783692 AAGTAATAACAGAAAGTTGATGG + Intronic
1063601038 10:7481814-7481836 AGTTAATGAATGAAAGAAGAGGG + Intergenic
1063975206 10:11409446-11409468 AAGTAATAATTGTCAGAAGAGGG + Intergenic
1064061918 10:12145084-12145106 GTGGAAGAAATGAAAGAAGAGGG + Intronic
1064807103 10:19147829-19147851 AAGGAATTACTGAGAGAAGACGG + Intronic
1064895513 10:20231671-20231693 ATTTAATATCTCTAAGAAGATGG + Intronic
1065902212 10:30218629-30218651 ATGTAATAACTGATTGAGGCAGG + Intergenic
1066025441 10:31353964-31353986 ATATAATAATTGAAAGAATGAGG + Intronic
1066035836 10:31482743-31482765 ATGTATTACCTGAAAAAAGTTGG + Intronic
1067516162 10:46946662-46946684 ATGTCATACCAGAAAGTAGAGGG - Exonic
1067646085 10:48105148-48105170 ATGTCATACCAGAAAGTAGAGGG + Intergenic
1067714514 10:48679253-48679275 ATGTAAAAATAAAAAGAAGAAGG - Intergenic
1067915664 10:50395522-50395544 ATGTAATAATGGAAACAAGCAGG - Intronic
1068168685 10:53364508-53364530 ATGTTATAAAAGAAGGAAGAAGG - Intergenic
1068942600 10:62694178-62694200 TTCTATTAACAGAAAGAAGAGGG - Intergenic
1068960409 10:62861574-62861596 ATGTAAGAAGTTAAAGAACATGG + Intronic
1069130833 10:64700213-64700235 ATGTAATATGTGAGACAAGATGG + Intergenic
1069210329 10:65750442-65750464 GTGTAAGAACTAAAACAAGAAGG - Intergenic
1070455172 10:76607201-76607223 ATGTAATAACATAAAAATGAGGG + Intergenic
1070472777 10:76800573-76800595 ATTTAATAAATTAAAGAAAATGG - Intergenic
1071103506 10:82066983-82067005 ATCTAATAGCTAAAAGTAGAAGG - Intronic
1071318276 10:84424843-84424865 ATGTAAGCACTGAGTGAAGATGG + Intronic
1071869944 10:89782806-89782828 GTATAATAGCTGAAACAAGAAGG - Intergenic
1072466487 10:95667363-95667385 ATGCAAAAACAGAAAGCAGATGG + Intronic
1073170197 10:101499855-101499877 TTGTAATAACTAAATGAATATGG - Intronic
1073668428 10:105560076-105560098 AAGAAATAAATGAAAGAAGAAGG - Intergenic
1074683123 10:115930874-115930896 AAGTGCTAACTGAGAGAAGATGG - Intronic
1076633477 10:131867367-131867389 CTGAAAGAACTGAAAGTAGAGGG + Intergenic
1078054690 11:7998494-7998516 TTATAAGAACTGAAACAAGAAGG + Exonic
1078246596 11:9578541-9578563 ATGCAATACCTGAAAAATGAAGG - Intronic
1078767794 11:14316409-14316431 ATGTAAAAACTGTAAAAAGGAGG - Intronic
1079165601 11:18039394-18039416 AGGTAATAACTGACAGAGCAAGG + Intronic
1079211767 11:18467433-18467455 AAGTTAAAAATGAAAGAAGATGG - Intronic
1079849245 11:25510359-25510381 ATGTAATAACTGGAAAAGAATGG + Intergenic
1080276198 11:30505842-30505864 AGGTAATAAGTGACAGAAGCAGG - Intronic
1080759905 11:35238393-35238415 AGGTAAAACCAGAAAGAAGAGGG + Intergenic
1081266698 11:41032704-41032726 ATTTAGTAACTGAAAAAAGGGGG + Intronic
1082908630 11:58343553-58343575 ATGTAATACCTGAATAAAAATGG - Intergenic
1082914851 11:58422140-58422162 ATGTAATACCTGAATGAGGAAGG - Intergenic
1084647870 11:70470692-70470714 ATGGAAAAACTGAAAGCACACGG + Intronic
1085105766 11:73841508-73841530 ACCTAATGAATGAAAGAAGACGG + Intronic
1085335039 11:75687122-75687144 ATGGATTAACTGACAGAAGTAGG - Intergenic
1086127127 11:83360430-83360452 ATGTGATAGCAGAAAGGAGAAGG - Intergenic
1086834759 11:91607086-91607108 ATGGAAGAATTGAAAGATGAGGG - Intergenic
1087147406 11:94825741-94825763 ATGGAGTAATAGAAAGAAGAAGG + Intronic
1087250863 11:95898053-95898075 ATGTAGTATTTGAAAGAAAAAGG - Intronic
1087296648 11:96384880-96384902 ATGAAATATCTGAGTGAAGATGG + Intronic
1087405001 11:97719133-97719155 ATGTAATAAGGGATAAAAGATGG + Intergenic
1087510245 11:99083251-99083273 ATTTAAAAAAGGAAAGAAGAGGG - Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1087729093 11:101758282-101758304 ATGGAATAACTGAGAGGTGAGGG - Intronic
1087973332 11:104513044-104513066 ATGTAATAACCAAGACAAGAAGG + Intergenic
1088044735 11:105434802-105434824 TTGTTATAATTGAAAGGAGAAGG + Intergenic
1088339858 11:108751761-108751783 ATGTAATAACAGAAAGATAATGG - Intronic
1090982927 11:131739263-131739285 ATGAAATAAACAAAAGAAGATGG + Intronic
1091158134 11:133392985-133393007 ATATAAGAGCTGAAACAAGAAGG - Intronic
1091209317 11:133843042-133843064 ATATACTTACTGAAATAAGAGGG + Intronic
1092834991 12:12478794-12478816 ATTTAATGACAAAAAGAAGATGG + Intronic
1093062990 12:14626927-14626949 AAGTGATAAATGAAAGGAGAAGG + Intronic
1093253539 12:16837852-16837874 ATGAAATGACTGATTGAAGAAGG - Intergenic
1093781670 12:23144475-23144497 GTGTAATAACAAAAAGAATATGG - Intergenic
1094431923 12:30379518-30379540 ATGTATAAACTGTCAGAAGAAGG - Intergenic
1095304475 12:40623526-40623548 ATATAGAAACTCAAAGAAGAGGG - Intergenic
1095381520 12:41599646-41599668 ATGTAAACACTGAAAGTAAAGGG - Intergenic
1095651655 12:44617970-44617992 ATGTAATCATTGAAAGTAGTGGG - Intronic
1095923679 12:47557201-47557223 ATGTAATAGATAAAAGCAGAGGG + Intergenic
1096017146 12:48286921-48286943 TTGTAATAGCTTAGAGAAGAGGG - Intergenic
1098085086 12:66833782-66833804 GTGTAAGAATTGAAAGTAGAGGG + Intergenic
1098332280 12:69365808-69365830 ATGAAATTACTGAAACAGGATGG + Exonic
1098361696 12:69660483-69660505 ATATAAGAACTGGAAGAAGCTGG + Intronic
1098404701 12:70111549-70111571 ATGTATAGACTGAAAGTAGATGG + Intergenic
1099143370 12:79008202-79008224 CTGGAATATCTGAAGGAAGAGGG + Intronic
1100165777 12:91916205-91916227 ATGTTATGACTGAAAAAAAAAGG - Intergenic
1100726315 12:97412664-97412686 CTGCAATAAATGAAAGAAAAGGG + Intergenic
1100792381 12:98144571-98144593 ATGTGACAAATGAAAGAAAAAGG + Intergenic
1102734516 12:115146429-115146451 ATGTAATTATTGGAAGAAAAAGG + Intergenic
1103395821 12:120606127-120606149 ATGTAATGACAGATAGCAGATGG - Intergenic
1103682424 12:122705044-122705066 ATTTTATAACTCAAAGTAGAAGG - Intergenic
1105622352 13:22080546-22080568 GTGTGAGAACTGAAAGAACATGG - Intergenic
1106656759 13:31754810-31754832 ATGGAATAACATAAAGAAGTAGG + Intronic
1107135894 13:36943702-36943724 ATAAAATAACTGAATAAAGAAGG + Intergenic
1107306533 13:39026388-39026410 CTGTAATATAAGAAAGAAGAGGG + Intronic
1107380117 13:39848087-39848109 ATCAATTAACTGAAAGAACAAGG + Intergenic
1107733192 13:43369236-43369258 ATGGAAGGACTGAAGGAAGAGGG - Intronic
1107897114 13:44976269-44976291 ATGCAAAAAATGAAAGAAGAAGG + Intronic
1108315503 13:49233147-49233169 ATGTAATAACTGAAGGAAATGGG + Intergenic
1108440065 13:50443193-50443215 ATGTAAGAACTTAAAGATCATGG - Intronic
1108932593 13:55846190-55846212 TTTTAATAACTGAAAGGAAATGG + Intergenic
1109109638 13:58300188-58300210 AAGTAATAACTAAGAGAACATGG - Intergenic
1109313132 13:60718824-60718846 GTGAAAGAACTGGAAGAAGAAGG - Intergenic
1109408533 13:61934005-61934027 AGGAAATAAGTGAAAGAAAAAGG - Intergenic
1109568198 13:64147923-64147945 ATGTTGTAACCGAAAGAAGAAGG + Intergenic
1109777344 13:67059008-67059030 ATGTAAGAAGAGGAAGAAGAGGG - Intronic
1109886752 13:68554408-68554430 ATGTGCTTACTGTAAGAAGAAGG + Intergenic
1110599364 13:77354446-77354468 ATGAATTAACTGAATGAAGCAGG + Intergenic
1110815470 13:79855982-79856004 AAGTAATCATTGAAAGATGAAGG + Intergenic
1111265777 13:85811035-85811057 ATATAAGAACTGAAACAAGAAGG - Intergenic
1114074036 14:19142921-19142943 ATGAAACAACTCAAAGAAGTAGG - Intergenic
1114088230 14:19257055-19257077 ATGAAACAACTCAAAGAAGTAGG + Intergenic
1115067252 14:29278931-29278953 ATGTAATGTGTGGAAGAAGAAGG + Intergenic
1115746796 14:36446334-36446356 AAGTAAAAACTGTAAAAAGATGG + Intergenic
1115808164 14:37075783-37075805 ATGTAATAACAGACAGATGATGG + Intronic
1116107502 14:40528645-40528667 AGGTGATCACTGAATGAAGAGGG - Intergenic
1116268031 14:42721000-42721022 TTTTATTAACTGAAAGAAAATGG + Intergenic
1116514136 14:45785749-45785771 GTTTACTAAGTGAAAGAAGAAGG - Intergenic
1116551882 14:46250761-46250783 ATATTATTACTGAAATAAGAAGG + Intergenic
1116894404 14:50301870-50301892 AGGGAATAACTAAAAAAAGATGG - Intronic
1117108847 14:52427702-52427724 ATTTAGTAACTGAAAGAACGTGG - Intergenic
1117270057 14:54134539-54134561 AGATAAAAACTGAAATAAGATGG + Intergenic
1117479111 14:56125533-56125555 AAGTAAAAACCGAAAGAAGTGGG - Intronic
1117957162 14:61131548-61131570 AGGTCAAAAATGAAAGAAGATGG + Intergenic
1119202401 14:72766315-72766337 AAGAAATAACTGAAAGATGAAGG + Intronic
1120411242 14:84158857-84158879 ATGTTTTTACTAAAAGAAGAAGG + Intergenic
1120961594 14:90130149-90130171 ATGCTAGAACTGGAAGAAGATGG + Intronic
1121382254 14:93482955-93482977 ATGTAGTAATTGAAACAGGAAGG - Intronic
1121952186 14:98181129-98181151 AAGAAATAAATGAAGGAAGAAGG - Intergenic
1125064819 15:35469819-35469841 ACATATAAACTGAAAGAAGAGGG + Intronic
1125101855 15:35922909-35922931 ATGCAATAACTGAATGATTAGGG + Intergenic
1125150727 15:36529242-36529264 ATATAACAACTAAAAGAATAAGG + Intergenic
1125292117 15:38161426-38161448 ATTTAATACCGAAAAGAAGAAGG - Intergenic
1125848675 15:42883512-42883534 ATGTAATAACTCTAAGTAGATGG + Intronic
1126212437 15:46114860-46114882 AGGTAATAACTGAAGCAAAAGGG - Intergenic
1126970298 15:54103618-54103640 ATGAATTAAATGAAAGAACAAGG - Intronic
1127178640 15:56389970-56389992 ATTTAATAACTTACTGAAGATGG - Intronic
1128396637 15:67232766-67232788 ATGTAAGAACGGCATGAAGAAGG + Intronic
1128859735 15:71057683-71057705 TTCTGATAACTGAAACAAGAAGG - Intergenic
1129096335 15:73212396-73212418 CTATAATATATGAAAGAAGAAGG - Intronic
1129430211 15:75495167-75495189 ATAGAATAAAAGAAAGAAGATGG + Intronic
1130252491 15:82309074-82309096 ATGGAAAGACTGAAAGGAGAAGG + Intergenic
1131937771 15:97525742-97525764 ATGGAAAAAAGGAAAGAAGAAGG + Intergenic
1133513371 16:6482987-6483009 ATTTAATGCCTGAAAGAACAAGG + Intronic
1134788955 16:16971160-16971182 ATCTAGAAACTGAAGGAAGATGG - Intergenic
1134810655 16:17164199-17164221 ATGAAATAACTTAAAGATTATGG - Intronic
1135020369 16:18957872-18957894 ATTTAGTCACTGAAAGAGGATGG - Intergenic
1137373815 16:47933322-47933344 GTGTCACAAGTGAAAGAAGAAGG - Intergenic
1137866583 16:51903487-51903509 AACTAATAAGTGAAAGAGGAAGG + Intergenic
1138618015 16:58187219-58187241 ATGGAAAAACTGAAACAAAATGG + Intronic
1138848138 16:60592345-60592367 TTGTATTAAGTGAAAGAAGATGG + Intergenic
1138904710 16:61317040-61317062 AGGCAAAAACTAAAAGAAGAGGG + Intergenic
1139159872 16:64491552-64491574 AATGAATAACTGGAAGAAGACGG - Intergenic
1140141288 16:72260448-72260470 ATGGAATAACTGATGGAACAGGG + Intergenic
1140563287 16:76009488-76009510 ATAGAATAAATGAAAGAATAGGG + Intergenic
1140959820 16:79900925-79900947 CTGCAATAGCTGAAAGAACATGG - Intergenic
1141248198 16:82330536-82330558 ATGTGATAAGGGAAAGAAGTAGG - Intergenic
1142787914 17:2238876-2238898 AAGAAAAAACTGAAAGCAGAAGG + Intronic
1143343849 17:6234976-6234998 ATGTAATATCTGTAAAAAAATGG + Intergenic
1143624434 17:8101394-8101416 ATTTAATAACTGAGACATGATGG + Intronic
1143707644 17:8710156-8710178 ATGTAACAGCTGGAAGAAGTAGG - Intergenic
1147436098 17:40417175-40417197 ATGCAGGAACTGAAAGAAGTGGG - Intronic
1150361367 17:64537589-64537611 ATGTAATGTCTGAAAAAAGAAGG - Exonic
1150434726 17:65144966-65144988 ATGTGAGAACAGAGAGAAGACGG - Intronic
1150515474 17:65805384-65805406 AAGTAACAACTGAAAGAAAAGGG + Intronic
1153062386 18:1007565-1007587 CTGAAAGAACTGAAAGACGAAGG - Intergenic
1153457968 18:5299243-5299265 ATTTAAGACCTGAAAGATGAGGG + Intergenic
1153505932 18:5797954-5797976 ATGTAATAACTGATTGATAATGG - Intergenic
1153659348 18:7312953-7312975 ATATGATAACTTAAAGAAAAAGG - Intergenic
1154102728 18:11490849-11490871 ATGTAATAACTGCAATCGGAAGG + Intergenic
1154943342 18:21136738-21136760 ATGTAAGAAATAAAAGAAGGTGG - Intergenic
1155794635 18:30020908-30020930 GTGTAAGATCTGAAAGAACAAGG + Intergenic
1156139924 18:34095497-34095519 ATCTAATAACTGGCAGAATATGG - Intronic
1156693659 18:39739732-39739754 ATTAAATGATTGAAAGAAGATGG - Intergenic
1156802392 18:41132431-41132453 CTGTAAAAACTAAAACAAGAAGG - Intergenic
1157016433 18:43720236-43720258 ATGGATTAACTGACAGAAGTAGG + Intergenic
1157228710 18:45892955-45892977 CTCTAATCACTGAAAAAAGAAGG + Intronic
1158144226 18:54292812-54292834 ATTTAATAAATGGAATAAGAAGG - Intronic
1158329046 18:56341233-56341255 AAGGTATAATTGAAAGAAGATGG + Intergenic
1158788514 18:60745355-60745377 GTGTAAAAACTGAAATAAAAGGG + Intergenic
1158814495 18:61078358-61078380 AAGTTATAACTAAAATAAGATGG + Intergenic
1158817197 18:61116078-61116100 ATATAAGAGCTGAAACAAGAAGG - Intergenic
1158819367 18:61141705-61141727 ATGTTATAACTAAATGAATATGG + Intergenic
1159044566 18:63356780-63356802 CTGTAATATCTGATAGACGAAGG - Intronic
1159192114 18:65059883-65059905 GTGTAATAACTGAAAGAAAAGGG - Intergenic
1159278650 18:66254374-66254396 GGGTAATACATGAAAGAAGAAGG - Intergenic
1161990907 19:7683631-7683653 ATATAATAAATGAGGGAAGAAGG - Exonic
1163807460 19:19407887-19407909 AAATAAGAACTGAAAGATGAAGG - Intronic
1164441130 19:28281742-28281764 AAGAAAAAAGTGAAAGAAGAGGG - Intergenic
1166001736 19:39881548-39881570 ATGTAGTAACTGTACGAACAGGG - Intronic
1166004518 19:39897799-39897821 ATGTAGTAACTGTACGAACAGGG - Intronic
924986909 2:280327-280349 ATGTAACAACTGCAGAAAGAAGG - Intronic
925445986 2:3927392-3927414 ACGTAATATCTGAAAAAAAATGG - Intergenic
925667412 2:6275096-6275118 ATGAACTAACTGCAAGAACAAGG + Intergenic
926174645 2:10579817-10579839 ATGGAACCACTGAGAGAAGATGG + Intronic
926427196 2:12749516-12749538 ATGTAATAAGAGAGAGAAAAGGG - Intergenic
926734448 2:16062282-16062304 ATATATTAACTGAAATAAGCAGG + Intergenic
927239155 2:20904883-20904905 TTGCCATATCTGAAAGAAGAGGG + Intergenic
927761769 2:25763070-25763092 AAATAAAAACTGAAAGAACAGGG + Intronic
928696030 2:33851179-33851201 ATGGAAAAACTGATTGAAGAAGG + Intergenic
928730523 2:34226549-34226571 AGCTAATAACTGGAAGAAGAGGG + Intergenic
929260519 2:39861954-39861976 AAGTAATTATTGAAAGAAGTAGG + Intergenic
929618178 2:43328678-43328700 ATGTAATCTGTGAAAGCAGAGGG + Intronic
929935108 2:46288878-46288900 ATGTCATGACTAAAAGATGAGGG + Intergenic
930413341 2:51055582-51055604 ATTTAATAAATGAAGAAAGAAGG - Intergenic
930947123 2:57088362-57088384 CTATAATAACTGAAAAAAGCTGG - Intergenic
931669474 2:64634243-64634265 AAGAAAAAACTGAAACAAGAAGG + Exonic
933127426 2:78626690-78626712 CTGGATTAATTGAAAGAAGATGG + Intergenic
934923548 2:98365888-98365910 ATGGATTAACTGACAGAAGTAGG - Intronic
936488432 2:112947440-112947462 ATTTAATAAGTGAAAGAAGAAGG - Intergenic
936551116 2:113440370-113440392 ATGTGAAAACTGAAAGGAAAGGG - Intronic
936642315 2:114328501-114328523 ATCTAATAACTGATTGAAGAGGG - Intergenic
936729729 2:115366394-115366416 ATATAATAAAGTAAAGAAGAAGG - Intronic
936830411 2:116638328-116638350 CTGTAGTAACTAAAAGAACATGG + Intergenic
937109394 2:119351440-119351462 ATATAAGAGCTGAAACAAGAAGG + Intronic
937998636 2:127714346-127714368 ATGAAATGCCTGAAAGAATAGGG - Intronic
938027179 2:127959884-127959906 ATGTAATAACTGAAATAAGACGG + Intronic
938488214 2:131737977-131737999 ATGAAACAACTCAAAGAAGTAGG - Intronic
938744226 2:134261710-134261732 ATGTAAGTTCTGAAAGAGGAGGG + Intronic
940021212 2:149157716-149157738 ATCTAATAGTTGAAAGAAAAGGG - Intronic
940248036 2:151641254-151641276 ATATAATAACTGAAAAGAGCAGG - Intronic
940561881 2:155308240-155308262 ATGTAATAATTTAAGGAAAATGG - Intergenic
941380150 2:164782977-164782999 ATGTAATATATGAAAAAAAATGG - Intronic
941578206 2:167262658-167262680 ATGTTATAAAGGAATGAAGATGG + Intergenic
942337196 2:174901258-174901280 ATCTCTGAACTGAAAGAAGAGGG - Intronic
943377817 2:187101944-187101966 AGGTAATAATTGAAAGAACTAGG + Intergenic
943968885 2:194376903-194376925 ATGTAATAAAAGAAAGACTATGG + Intergenic
945185691 2:207137271-207137293 ATGTAAGGACTGATAGAAGTGGG - Intronic
945618982 2:212109473-212109495 AAGTAATAGCTGAAAGAAGTGGG - Intronic
945788922 2:214278686-214278708 AGGGAATAATTGAAAGATGAAGG - Intronic
948743032 2:240060661-240060683 ATGGAAAAACTGATTGAAGAAGG - Intergenic
948964320 2:241364676-241364698 ATACAATAACTGAAATAAAATGG + Intronic
1168797185 20:619276-619298 GTGTGAGAGCTGAAAGAAGAAGG + Intergenic
1169026281 20:2374335-2374357 ATGGAAGAAATGAATGAAGAGGG + Intergenic
1169879541 20:10331535-10331557 ATGTCATAAACCAAAGAAGAAGG + Intergenic
1170083211 20:12499738-12499760 CTGTTGTAACTGAAAGAACATGG - Intergenic
1170114470 20:12842146-12842168 ATTTAAGACATGAAAGAAGATGG - Intergenic
1170734886 20:19006054-19006076 ATGTACTGATTGAGAGAAGAGGG + Intergenic
1172224143 20:33293244-33293266 ATGTAATAAATGAAAAAATTTGG + Intronic
1173068122 20:39734304-39734326 AAGTAATAAGTGGAAGATGATGG + Intergenic
1174158615 20:48534298-48534320 ATTTTTAAACTGAAAGAAGATGG - Intergenic
1174371165 20:50089149-50089171 ATGTAATAACGAAATGAAGCAGG + Intronic
1174435048 20:50500176-50500198 TTGGAATAACTGAAAGTGGAGGG - Intergenic
1174726688 20:52870077-52870099 GTGTGAGAACTGAAACAAGAAGG + Intergenic
1174910698 20:54604609-54604631 ACGTTATAATTGAAAGAATAAGG - Intronic
1174956360 20:55103113-55103135 GTTTAATAAGTGAAAGAAGAAGG + Intergenic
1175055802 20:56196820-56196842 ATGTCAGAACAGAAAGAAGCTGG + Intergenic
1177479464 21:21668499-21668521 ATGTATTTACTGAAAAAAGATGG + Intergenic
1177881173 21:26696731-26696753 TTGAAACAACTGAAAGATGAGGG - Intergenic
1178210226 21:30522345-30522367 ATTTAATAACTTAAATAAAATGG - Intergenic
1180257211 21:46639412-46639434 TTTTAGTAACTGATAGAAGATGG - Intronic
1180289687 22:10835861-10835883 ATGAAACAACTCAAAGAAGTAGG - Intergenic
1180492484 22:15865283-15865305 ATGAAACAACTCAAAGAAGTAGG - Intergenic
1181278822 22:21703874-21703896 CTGAAAGGACTGAAAGAAGAAGG + Exonic
1181885561 22:26019339-26019361 ATGTAATAAGTGGGAGAACATGG - Intronic
1183767927 22:39896541-39896563 TAGAGATAACTGAAAGAAGAGGG + Intergenic
1184164270 22:42718652-42718674 ATGAATTAACCGAAAGAAGTAGG - Intronic
950320646 3:12049541-12049563 ATAAAAAAACTGAAAGATGAGGG + Intronic
950571802 3:13805131-13805153 ATGCATTAACTGAATGAGGATGG + Intergenic
950795668 3:15509009-15509031 ACATAATAACTATAAGAAGAAGG + Intronic
951061396 3:18211052-18211074 ATATAAAAACAGAAAGTAGATGG + Intronic
951068772 3:18300560-18300582 ATATAAAAAATCAAAGAAGATGG + Intronic
951115028 3:18850911-18850933 ATGTAACAACTGAATGAAATAGG - Intergenic
951117666 3:18884482-18884504 CTATATTAACTGAAAAAAGAAGG + Intergenic
951494039 3:23305691-23305713 TTTTAATAACTGTAAGAAAAGGG - Intronic
951823610 3:26842497-26842519 ATGTAATGACAAAAAGAAGATGG + Intergenic
952111046 3:30124260-30124282 ATGTAAGGAATGAAAGTAGAAGG + Intergenic
952466106 3:33587697-33587719 AGGTTATAACTGAAAGAAATTGG - Intronic
952871269 3:37903363-37903385 CTGTAATAACAGCAACAAGAAGG - Intronic
953179261 3:40581337-40581359 ATGTAAGAACAGAATCAAGAGGG + Intergenic
953294849 3:41704618-41704640 TTGTCATAACTGAAGGGAGACGG + Intronic
953852213 3:46472984-46473006 ATGTAGTGACTGAAAGAGAAAGG - Intronic
955827776 3:62966477-62966499 AGGATATAACTGAGAGAAGAAGG - Intergenic
956245516 3:67177769-67177791 ATTTTATAATTAAAAGAAGATGG + Intergenic
956403263 3:68902341-68902363 AGGTATTATCTGAAAGAAAATGG - Intronic
956430507 3:69181333-69181355 ATGTAGTAACTGGAAGACGGTGG + Exonic
956686687 3:71835603-71835625 AGGTAAGAAATGAAAGAAAAAGG - Intergenic
957131365 3:76226248-76226270 ATGAAATAATTTAAAGATGATGG + Intronic
958061429 3:88486967-88486989 ATGGAATAAATGGAAGAAAAGGG + Intergenic
958472646 3:94540839-94540861 GAGTAAGAACTGATAGAAGAAGG - Intergenic
958906855 3:99951272-99951294 CTGTAATTACTGGTAGAAGAAGG - Intronic
959033546 3:101332966-101332988 ATGATATATCTTAAAGAAGATGG - Intronic
959518353 3:107296792-107296814 AAATAATTACTGAAAGAGGAAGG + Intergenic
959834377 3:110901202-110901224 AAGTAATAAATTAAAAAAGAGGG - Intergenic
959854550 3:111135158-111135180 ATTAAATAACTAAAACAAGATGG - Exonic
959855282 3:111147249-111147271 ATGTAAGAACTGAATTAAGCAGG + Intronic
960058126 3:113290760-113290782 AAGTAAAACCTGAAAGAAAATGG + Exonic
960325622 3:116292122-116292144 ATGAAATAAATAAAAGAAGTAGG - Intronic
962056451 3:131876747-131876769 ATGTAGTAACTGACAAAAGGTGG + Intronic
963063952 3:141247509-141247531 ATATAATAACTGATAGAATCAGG - Intronic
963554217 3:146766650-146766672 AAGTAAAAACTGAAAGGAGAAGG + Intergenic
964006952 3:151842243-151842265 TTGTAATAACTCAAAGCAGAAGG + Intergenic
964528323 3:157639835-157639857 CTTTAATAACTGACAGAATATGG + Intronic
964560990 3:157996342-157996364 ATGTAATTACTGATAAAAGTAGG + Intergenic
965045997 3:163577288-163577310 ATTTAATAACTGGATGACGAGGG - Intergenic
965275080 3:166671760-166671782 ATTTAATAACTGGAAGACTATGG + Intergenic
965298580 3:166979950-166979972 ATGGAATAAATGAATGAATAAGG + Intergenic
965421063 3:168458598-168458620 AAGCAAAAACTGAAAGAAAAGGG - Intergenic
965473470 3:169124327-169124349 TTGTAATAAGAGAAAGAAGGTGG + Intronic
965568307 3:170145060-170145082 ATGTAATAACTAAGTCAAGATGG - Intronic
966128756 3:176610560-176610582 ATTTAATAACTGAAGGAGAATGG + Intergenic
966387586 3:179417058-179417080 AAGTAAAAACTGTCAGAAGAGGG + Intronic
968010879 3:195273779-195273801 ATCTATTAAGTGAAAGAAGTGGG + Intergenic
970926068 4:21453787-21453809 ATGTGCTAGCTGAAAGGAGATGG - Intronic
971259494 4:25043402-25043424 AGGTAGAAGCTGAAAGAAGATGG + Intergenic
971325247 4:25638156-25638178 ATGTGAGTCCTGAAAGAAGATGG + Intergenic
971542558 4:27838258-27838280 AGGTAAAAACTGAACAAAGAAGG + Intergenic
971837140 4:31782164-31782186 TTTTAAAAACTTAAAGAAGAGGG + Intergenic
972429629 4:38968241-38968263 ATGTTATAATTGAAAGAAACTGG - Intronic
972955314 4:44382424-44382446 CTGTAAGAACTCAAACAAGATGG + Intronic
972971140 4:44577198-44577220 TTGTAAGAACTTAAGGAAGATGG - Intergenic
973562267 4:52149095-52149117 ATGAAATATCTGTAAAAAGATGG + Intergenic
974863137 4:67547913-67547935 CTGTACTAAGTGAAAGAAGCTGG + Intergenic
975880966 4:78907388-78907410 ATGTAATAATTTTAAAAAGAAGG + Intronic
976041620 4:80892118-80892140 CTGTAATAACTGAAAGAACATGG + Intronic
976486520 4:85611872-85611894 ATTAAATATCTGAATGAAGAAGG - Intronic
976882972 4:89952239-89952261 ATGTATTAAGTAAAACAAGATGG + Intronic
977400638 4:96527115-96527137 ATTTAAGAACAGAGAGAAGAAGG + Intergenic
977595094 4:98870485-98870507 ATATAATAGGTGAAATAAGAGGG - Intergenic
977639541 4:99341050-99341072 ATGTAATAAATCAATGAAAAAGG - Intronic
977833951 4:101626739-101626761 TTGCAATAACTCAAAAAAGAAGG + Intronic
978453136 4:108858819-108858841 ATGGAAAAAATGAAAGTAGAAGG + Intronic
979495892 4:121381413-121381435 ATGTAATGAATGAAAGAAACTGG - Intergenic
979803683 4:124943857-124943879 ATTTAATATTTGAAAAAAGATGG + Intergenic
980782674 4:137512043-137512065 ATGTTGTAAGAGAAAGAAGACGG + Intergenic
981080353 4:140633997-140634019 ATCTAATAACTGGAACAAGCGGG + Exonic
981546557 4:145899859-145899881 ATGTTCAAACTGAAAGAGGAGGG - Intronic
981670243 4:147278458-147278480 ATGTTACAACTGTAAGAACAAGG - Intergenic
982429127 4:155301768-155301790 TTGTTAAAACTGAAAGAAAATGG + Intergenic
982881772 4:160728984-160729006 ATGTAATAAGTAAACGATGATGG + Intergenic
983160653 4:164410298-164410320 ATCTTATCACTGAAAGAAAATGG + Intergenic
983352921 4:166616631-166616653 AAGTAATTACTGAAAAAGGAGGG - Intergenic
983402491 4:167282554-167282576 AAGGAAAAACTGAAAGAAGGAGG + Intergenic
984480945 4:180301223-180301245 ATGTAATAACTGTATTAAAAAGG - Intergenic
984539308 4:181017938-181017960 ATATAGTGACTGAGAGAAGAAGG - Intergenic
984552011 4:181171671-181171693 AAGAAATAAAAGAAAGAAGAGGG - Intergenic
986078960 5:4369107-4369129 ATGTGATGAGTGACAGAAGAGGG - Intergenic
987915761 5:24211761-24211783 ATTGAATAACAGAAAGCAGAAGG - Intergenic
987940071 5:24522333-24522355 GTGTGATAACTCAATGAAGATGG + Intronic
988123277 5:26994905-26994927 ATATAAAAACTGAAAGAATGAGG - Intronic
988323175 5:29727088-29727110 CAGTAATAACTCAAAGAAAAGGG - Intergenic
988847216 5:35140245-35140267 ATGTAATAAATGAAGAAAAAGGG + Intronic
988932851 5:36053915-36053937 CTGTTATAAAGGAAAGAAGATGG - Intronic
989249570 5:39294450-39294472 ATGTAAAAACTTAGAGAAAATGG + Intronic
989966551 5:50471920-50471942 ATGTAGGTAGTGAAAGAAGAAGG - Intergenic
990133886 5:52621325-52621347 ATGTAATATCTGGAAAAACATGG - Intergenic
990924980 5:61010708-61010730 TTCTTATTACTGAAAGAAGAAGG - Intronic
991164339 5:63545503-63545525 ATCTTATAACTAAAAGAAAAAGG - Intergenic
991254386 5:64598271-64598293 ATGAGACAACTGAAAGATGAGGG - Intronic
991327399 5:65450727-65450749 AGCTAATAAGTGAAAGAATAGGG - Intronic
992136636 5:73752702-73752724 CAGGAGTAACTGAAAGAAGATGG + Intronic
992398411 5:76388685-76388707 ATGAAATAGCTGAATGAAGAAGG - Intergenic
993364170 5:87016566-87016588 CTGTAAAAAGAGAAAGAAGAAGG + Intergenic
993725769 5:91364931-91364953 ATGAAATAAATGAATGAATATGG - Intergenic
993769557 5:91908817-91908839 ATGAAATAAGTAAAAGAAAATGG - Intergenic
993790356 5:92200409-92200431 AGTTAAGAACTGAAAGAAGGTGG - Intergenic
993826440 5:92692990-92693012 ATGCAATAGAGGAAAGAAGAAGG + Intergenic
993851252 5:93012672-93012694 AGCTAATAACTGGTAGAAGAAGG + Intergenic
993918836 5:93774540-93774562 ATGTAAGAACTGAAACAAGAAGG - Intronic
993998857 5:94754578-94754600 AGGTAAAAAGTTAAAGAAGATGG + Intronic
995156177 5:108915919-108915941 ATGGGAAAAGTGAAAGAAGAGGG - Intronic
995426802 5:112033127-112033149 ATGTAACTATTCAAAGAAGAAGG + Intergenic
996004466 5:118404525-118404547 ATGGATAAACTGAAAGAAGTGGG - Intergenic
996497553 5:124178424-124178446 ATGTAAAAACTCAAAAAAAAGGG - Intergenic
997867351 5:137476261-137476283 ATGTAAGAAATTAAAAAAGATGG + Intronic
998180304 5:139933384-139933406 AAGTAAAAACTAAAAGCAGAAGG + Intronic
998242694 5:140463240-140463262 ATGTAAAAATTGTCAGAAGATGG + Intronic
999265737 5:150265643-150265665 AAGAAATAACTGAATGAAGCTGG + Intronic
999628255 5:153542819-153542841 ATGTGATAAATGAAAAAAAAAGG - Intronic
999805112 5:155073811-155073833 ATGTCCTAAGTGAAAGAGGAAGG + Intergenic
999896969 5:156045036-156045058 ATGGAATAACTGTAGCAAGAAGG - Intronic
1000360828 5:160445675-160445697 ATGTATCAACTGAAAGTAAAAGG + Intergenic
1001500705 5:172231101-172231123 ATGTAATTACACAAAAAAGATGG + Intronic
1001848740 5:174944145-174944167 AGGTGAGAACAGAAAGAAGAGGG + Intergenic
1003841269 6:10122859-10122881 ATGTGATAAGTAAAAGAAGCTGG - Intronic
1004538861 6:16529639-16529661 AGGTAATAAATGAAAAAAGTTGG - Intronic
1004818541 6:19339387-19339409 AAGAGATAACTGAAAGAAAAAGG - Intergenic
1004853162 6:19721544-19721566 ATATAATCACTGAAACACGATGG - Intergenic
1005210292 6:23452927-23452949 ATGAAAAGAATGAAAGAAGATGG + Intergenic
1005219301 6:23567858-23567880 ATGTGTTAAATTAAAGAAGAAGG + Intergenic
1007289177 6:40772190-40772212 AAGAAATAAATGAAAGAAAAAGG + Intergenic
1007323927 6:41046080-41046102 CTGGAACAACTGAAAAAAGAAGG + Intronic
1008348049 6:50453899-50453921 ATGTAAGAGCTGTAAGAAAAAGG + Intergenic
1008379080 6:50822536-50822558 GTGAACTAAGTGAAAGAAGAAGG - Intronic
1010803563 6:80207371-80207393 GTGTAACAACTGAAATAACAGGG + Intronic
1011144324 6:84195686-84195708 TGGTAATAACAAAAAGAAGAAGG - Intronic
1011502732 6:88008658-88008680 ATGAGAAAACTGAAAGAAGCAGG - Intergenic
1012135678 6:95552855-95552877 AAATAATAAGTGAAAGAAGTGGG - Intergenic
1012197539 6:96362598-96362620 AAGTGATAACTGAAAGAAAGTGG + Intergenic
1012289232 6:97431546-97431568 ATACAATAACTGAAACAAAAAGG - Intergenic
1012429951 6:99153765-99153787 ATATAAGAAGGGAAAGAAGAAGG + Intergenic
1012563387 6:100615490-100615512 ATGCAAAAACTGAAATTAGAAGG - Intronic
1014080392 6:117280418-117280440 AGGTAGCAACTGGAAGAAGATGG - Intergenic
1014580743 6:123134455-123134477 ATTTCTTAACTGAAAGAAAAGGG - Intergenic
1014605587 6:123470108-123470130 ATTTAATAAATAAAAGAATAAGG - Intronic
1014700374 6:124679331-124679353 ATGTAAGTACTGACAGAAAAGGG - Intronic
1014730103 6:125022498-125022520 ATGTGCTAATTGAAAGAAAAAGG - Intronic
1015183870 6:130391412-130391434 ATGTGTTCACTCAAAGAAGAGGG + Intronic
1016077197 6:139810280-139810302 ATATAATAACAGAAACAACAAGG - Intergenic
1016191154 6:141266608-141266630 AAGTCATCACTGAAAGAAAAAGG + Intergenic
1016247736 6:142005718-142005740 AAGTAATCACTGAAAAATGAAGG - Intergenic
1016520421 6:144940701-144940723 AAGAAATAAATGAAAAAAGAAGG - Intergenic
1016531733 6:145065828-145065850 GTGTACTTACTGGAAGAAGATGG - Intergenic
1019036613 6:169065273-169065295 ACGTAATACCTGAAAAATGAAGG - Intergenic
1020475396 7:8588362-8588384 TTGTACTAACTCAAAGAAGAGGG + Intronic
1020951313 7:14681919-14681941 ATGATTTAACTGAAAGAGGAAGG + Intronic
1021617534 7:22518346-22518368 ATGAAATGACTGAAAGTTGATGG + Intronic
1022456850 7:30565116-30565138 GTATAATAACTCAAAGAAAAGGG + Intergenic
1022555130 7:31286457-31286479 ATTTAACTACTGAAAGAAAAGGG - Intergenic
1023235908 7:38086793-38086815 ATATGATAAATTAAAGAAGATGG - Intergenic
1023332612 7:39134498-39134520 ATGTAAAGACAGAATGAAGAAGG - Intronic
1023460965 7:40396526-40396548 ATGTAATAAGTGAAGCTAGAAGG - Intronic
1023466428 7:40460777-40460799 ATAAAAGAACAGAAAGAAGAAGG - Intronic
1023595078 7:41821172-41821194 ATATAAGAACTGAAATAAGAAGG - Intergenic
1023846317 7:44122770-44122792 ATGTAAGAACTTGAAGGAGATGG - Intronic
1024435625 7:49351366-49351388 ATGTAAAAACTGTAACAAAATGG - Intergenic
1024721401 7:52140879-52140901 ATTTTACAACAGAAAGAAGATGG - Intergenic
1024805314 7:53132538-53132560 TTCTTATAAGTGAAAGAAGAAGG + Intergenic
1027807820 7:82852024-82852046 ATGGAAGAAAGGAAAGAAGAAGG + Intronic
1029379979 7:100207002-100207024 CTGTACTAAGTGAAAGAAGCTGG - Intronic
1029922014 7:104275186-104275208 ATGTAATGAATCAAAGGAGATGG - Intergenic
1030238148 7:107290137-107290159 ATGTTACATGTGAAAGAAGAGGG - Intronic
1030324160 7:108202586-108202608 ATGGAATAAGTAAATGAAGAGGG - Intronic
1030975989 7:116123771-116123793 ATGTAAGAACTTAGAGAAGAAGG - Intronic
1031044217 7:116869445-116869467 ATTTAGTAAATGAATGAAGATGG - Intronic
1031142074 7:117953797-117953819 AAAAAATAACTGAAAGAAAAAGG - Intergenic
1031282885 7:119826952-119826974 ATATAATCATTGTAAGAAGAGGG - Intergenic
1031316419 7:120262863-120262885 ATGTAAAATATGAAAAAAGATGG - Intergenic
1033028205 7:137798296-137798318 TTGTGAGAACTGAAAGAGGAAGG + Intronic
1033151629 7:138919752-138919774 ATGTCATAAATGAGAGAAAATGG - Intronic
1033483519 7:141764871-141764893 AAGTAAGAAGAGAAAGAAGAAGG - Exonic
1033650973 7:143343390-143343412 ATGTGAAAGCTGAAACAAGAAGG + Intronic
1033983316 7:147192706-147192728 ATGTAATAAGAGAAAGGAAAGGG - Intronic
1035429757 7:158810376-158810398 ATCTAGTAAGTGAAAGAAGTGGG + Intronic
1036969919 8:13344096-13344118 ATGTATTGAATGAAAGAAAAAGG - Intronic
1037270431 8:17123746-17123768 AAATAATAACTGAAAAAAGTAGG + Intergenic
1037801058 8:22036274-22036296 TTGTGATAACTAAATGAAGATGG + Intronic
1039685790 8:39801003-39801025 ATGGAGTAATTGACAGAAGATGG - Intronic
1041073645 8:54149183-54149205 TTGTAATGACTGAAAGATGAAGG - Intergenic
1041441584 8:57902668-57902690 ATGTAAGAACTTAAATAATACGG + Intergenic
1041688789 8:60669257-60669279 ATCTAATAACTGCCAGAAGATGG - Intergenic
1041914966 8:63129502-63129524 GTGTAAGAACTAAAAGAAGGCGG - Intergenic
1042332409 8:67594611-67594633 ATGAAATAAATGAAGCAAGAAGG - Intronic
1042796167 8:72665452-72665474 ATTTAAAAAGTGAAAGAAAATGG + Intronic
1042891839 8:73621051-73621073 TTGAAATAAGTGAAAGTAGAAGG - Intronic
1043308019 8:78821253-78821275 ATGTAAGAACAGAAAGAGAAAGG - Intergenic
1044762164 8:95531516-95531538 ATGTGACAACTGAAAGCAAAAGG - Intergenic
1045226306 8:100249482-100249504 AAGTAGTAAGTGAAAGAAGTGGG + Intronic
1045450953 8:102324628-102324650 ATGTAAGAAACAAAAGAAGATGG + Intronic
1045582126 8:103493297-103493319 ATGCTATAAATGAAAGATGAAGG + Intergenic
1045823252 8:106366903-106366925 ATGTAATACATGAAAGAAGATGG - Intronic
1045883646 8:107070174-107070196 TTTAAATAACTGCAAGAAGATGG + Intergenic
1047986816 8:130243903-130243925 ATGTAATCTCTCAAAGAAGGTGG + Intronic
1048499208 8:134960517-134960539 ATGTATTCCCTGTAAGAAGAGGG - Intergenic
1048542939 8:135359368-135359390 ATGGAACAACTGAAGCAAGATGG - Intergenic
1048935936 8:139357128-139357150 ATGAAATAAAGGAAAGAAAAGGG - Intergenic
1049029146 8:140020968-140020990 ATGTAAAAACAAAAAGATGAAGG - Intronic
1049901873 9:176763-176785 ATGTGAAAACTGAAAGGAAAGGG + Intronic
1050941023 9:11457968-11457990 ATGTAAGAACTAAAACCAGACGG - Intergenic
1052428350 9:28334182-28334204 ATGAAATATAAGAAAGAAGATGG + Intronic
1053744907 9:41187051-41187073 ATGTGAAAACTGAAAGGAAAGGG + Intronic
1054482364 9:65678168-65678190 ATGTGAAAACTGAAAGGAAAGGG - Intronic
1054683441 9:68244218-68244240 ATGTGAAAACTGAAAGGAAAGGG - Intronic
1054826598 9:69579741-69579763 ATGTTATAATTGAAATAAGATGG + Intronic
1055316744 9:75041607-75041629 ATCTAATGACTGAAAGATTATGG + Intergenic
1055867985 9:80839017-80839039 AAGAAATAACTGAAATATGAAGG + Intergenic
1055963577 9:81843631-81843653 ATCTAATAAGTGAAAGAATTGGG - Intergenic
1056648418 9:88435628-88435650 ATGTAATATCAGAAAAAGGAAGG - Intronic
1056700509 9:88902086-88902108 ATTTAATAACAGAAAATAGATGG - Intergenic
1056999286 9:91492750-91492772 ATGGAGTAGCTGAAAGATGAAGG + Intergenic
1058260466 9:102823241-102823263 ATGAAATAAATAAAAGTAGATGG - Intergenic
1058397583 9:104572542-104572564 TGGAAATAACAGAAAGAAGAAGG + Intergenic
1058595534 9:106611363-106611385 ATGAAAGAACTGGAAGAAGGAGG + Intergenic
1059369809 9:113818933-113818955 GTGGAGTAACTGAAATAAGAGGG + Intergenic
1060019235 9:120114856-120114878 ATGTCATAATTGAAAGAAAGGGG - Intergenic
1060332750 9:122688981-122689003 ATATAACAAGTGAAAGAAAATGG - Intergenic
1060428268 9:123524949-123524971 TTTTAATAACTGAAAAATGAGGG + Intronic
1062069309 9:134546999-134547021 CTGTCATAACTGGAAGAAGAGGG - Intergenic
1062727690 9:138085034-138085056 ATTTAAAAACTGACAGAAAAGGG + Intronic
1186253298 X:7692329-7692351 ATGTGAAAACAGAGAGAAGACGG + Intergenic
1186323020 X:8451266-8451288 AGGGAATCACTGAAAGATGAAGG + Intergenic
1186421627 X:9431579-9431601 ATGTAATTCCTGAGAGAAAATGG + Intergenic
1187078403 X:15959742-15959764 AGATAATAAATGAAAGAAGAAGG + Intergenic
1187084929 X:16032171-16032193 ATAGAATAACTAAAAGTAGAAGG - Intergenic
1187254691 X:17631542-17631564 ATTAAATAACTGAATGAAGGTGG + Intronic
1187468212 X:19544421-19544443 AGGTAATAACTGGCAGAACAGGG + Intronic
1188852225 X:35145853-35145875 CTGTAAAAAGTGAAAGAAGCAGG + Intergenic
1188970497 X:36609533-36609555 ATGGAATCAATGAAGGAAGAAGG - Intergenic
1189134237 X:38532599-38532621 CTGGAATAACATAAAGAAGAAGG - Intronic
1189824532 X:44904051-44904073 ATGTAGAAACTGAAAGCAGAAGG + Intronic
1190780890 X:53593704-53593726 ACGTAATAGCTCTAAGAAGAGGG - Intronic
1190850897 X:54240507-54240529 ATGTAGTAACTGGATCAAGATGG + Intronic
1191011499 X:55763912-55763934 AAGTAATAAGTGAGAGATGATGG + Intergenic
1191162817 X:57350631-57350653 AACTATTAACTGAAAGAAAAGGG + Intronic
1191951544 X:66598766-66598788 ATGTATTAACTGAAGAAATACGG + Intronic
1192894556 X:75427834-75427856 ATTTAATAACTTTAAGAATAAGG - Intronic
1193218975 X:78899756-78899778 ATAAAATAAATGACAGAAGAAGG + Intergenic
1193365041 X:80622400-80622422 ATGGACAAACTGAAAGAAGTAGG - Intergenic
1194394437 X:93363888-93363910 ATTTGACAACTGAAAGGAGACGG + Intergenic
1194493079 X:94575671-94575693 AGGTTTTAACTGAAAGCAGAAGG + Intergenic
1194654684 X:96558316-96558338 ATGAGATGACAGAAAGAAGAAGG + Intergenic
1195937982 X:110143459-110143481 ATGTAAAAACTGAGAAAAGGAGG - Intronic
1197145463 X:123167345-123167367 ATGTATTAACTGAGACAGGAAGG - Intergenic
1197169895 X:123420736-123420758 AAGTAATAACTTAAAGATTATGG + Intronic
1197284393 X:124578952-124578974 ATCTAATTGGTGAAAGAAGATGG - Intronic
1198062421 X:133060448-133060470 TTGAAACAACTGTAAGAAGAAGG - Intronic
1198239551 X:134770076-134770098 AAGAAATAACTGAAATATGATGG - Intronic
1198270864 X:135055069-135055091 AGGTAATAAGTGTAAGATGATGG + Intergenic
1199143647 X:144339379-144339401 GTTTAATAAGTGAAAGAAGAAGG + Intergenic
1199581464 X:149364678-149364700 ATAAAACAGCTGAAAGAAGATGG + Intergenic
1200826910 Y:7655743-7655765 ATGTAAAAACTGAAAAGAGAAGG - Intergenic
1200985630 Y:9301603-9301625 ATGTAAAAACTGAAAAGAGAAGG - Intergenic
1202106988 Y:21382218-21382240 ATGTAAAAACCGAAAAGAGAAGG - Intergenic
1202124908 Y:21559095-21559117 ATGTAAAAACTGAAAAGAGAAGG + Intergenic
1202154100 Y:21870285-21870307 ATGTAAAAACTGAAAAGAGAAGG - Intergenic