ID: 918575533

View in Genome Browser
Species Human (GRCh38)
Location 1:186054763-186054785
Sequence CCATCTTGAGACCATGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 1, 2: 2, 3: 33, 4: 213}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918575533_918575538 12 Left 918575533 1:186054763-186054785 CCTCCTTCATGGTCTCAAGATGG 0: 1
1: 1
2: 2
3: 33
4: 213
Right 918575538 1:186054798-186054820 TGGTATCAATTCCACATGGAAGG 0: 1
1: 0
2: 0
3: 13
4: 194
918575533_918575542 29 Left 918575533 1:186054763-186054785 CCTCCTTCATGGTCTCAAGATGG 0: 1
1: 1
2: 2
3: 33
4: 213
Right 918575542 1:186054815-186054837 GGAAGGCAAGAGTAAGGGAAAGG 0: 1
1: 0
2: 11
3: 331
4: 1740
918575533_918575541 24 Left 918575533 1:186054763-186054785 CCTCCTTCATGGTCTCAAGATGG 0: 1
1: 1
2: 2
3: 33
4: 213
Right 918575541 1:186054810-186054832 CACATGGAAGGCAAGAGTAAGGG 0: 1
1: 0
2: 6
3: 24
4: 278
918575533_918575543 30 Left 918575533 1:186054763-186054785 CCTCCTTCATGGTCTCAAGATGG 0: 1
1: 1
2: 2
3: 33
4: 213
Right 918575543 1:186054816-186054838 GAAGGCAAGAGTAAGGGAAAGGG 0: 1
1: 0
2: 13
3: 150
4: 1215
918575533_918575540 23 Left 918575533 1:186054763-186054785 CCTCCTTCATGGTCTCAAGATGG 0: 1
1: 1
2: 2
3: 33
4: 213
Right 918575540 1:186054809-186054831 CCACATGGAAGGCAAGAGTAAGG 0: 1
1: 0
2: 0
3: 20
4: 242
918575533_918575536 -8 Left 918575533 1:186054763-186054785 CCTCCTTCATGGTCTCAAGATGG 0: 1
1: 1
2: 2
3: 33
4: 213
Right 918575536 1:186054778-186054800 CAAGATGGTAGCTGTTATTGTGG 0: 1
1: 0
2: 1
3: 11
4: 131
918575533_918575537 8 Left 918575533 1:186054763-186054785 CCTCCTTCATGGTCTCAAGATGG 0: 1
1: 1
2: 2
3: 33
4: 213
Right 918575537 1:186054794-186054816 ATTGTGGTATCAATTCCACATGG 0: 1
1: 0
2: 1
3: 5
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918575533 Original CRISPR CCATCTTGAGACCATGAAGG AGG (reversed) Intronic
900679572 1:3909206-3909228 CCACCCTGAGACCATCATGGTGG + Intergenic
902650405 1:17833573-17833595 CCATCAGGAGGCCATGGAGGTGG + Intergenic
903589629 1:24444817-24444839 CCCACTCGAGATCATGAAGGTGG - Intronic
904442048 1:30538416-30538438 CCATCATGGGACCCTGAGGGTGG - Intergenic
906103825 1:43279799-43279821 CCAGCCTGAGACCCTGGAGGAGG - Intergenic
906863033 1:49382380-49382402 CCATATTGAAAAAATGAAGGGGG + Intronic
907230679 1:52995758-52995780 CCATCTTGAAGCCATGAGGTGGG - Intronic
909523994 1:76601737-76601759 CGATCTAGAGACTAAGAAGGGGG + Intronic
909761841 1:79298131-79298153 CTATTTTGAGACCAGGGAGGAGG + Intergenic
912687950 1:111781727-111781749 CCATGTTGATACCATGCAGGAGG + Intronic
913091334 1:115478703-115478725 CCATCTTGAGAGCCTGATTGAGG - Intergenic
913697209 1:121338713-121338735 AGCTCTTGAGACCATGAAGAGGG - Intronic
914140349 1:144941337-144941359 AGCTCTTGAGACCATGAAGAGGG + Intronic
918575533 1:186054763-186054785 CCATCTTGAGACCATGAAGGAGG - Intronic
919561948 1:199132242-199132264 CTATCATGAGACCAGCAAGGGGG + Intergenic
919895813 1:202009260-202009282 CCTTCTTGAGACCCTGAATGGGG - Exonic
920030293 1:203033663-203033685 CCTTCTTGAGAGCAAGATGGGGG - Intronic
920170596 1:204070083-204070105 CCACCTGGAGACCAGGATGGAGG + Intergenic
920484543 1:206357043-206357065 AGCTCTTGAGACCATGAAGAGGG - Intronic
920694735 1:208173767-208173789 CCATATTGGGGCCAAGAAGGAGG + Intronic
923000327 1:230001816-230001838 ACATCTTGAGACCATGATGCTGG + Intergenic
923713731 1:236407302-236407324 ACATCTGCAGAGCATGAAGGTGG - Intronic
924248370 1:242107007-242107029 CCCTCTGGAGACCTTGAGGGAGG - Intronic
924711120 1:246530796-246530818 CCATCCTGAGCCATTGAAGGAGG + Intergenic
1063575741 10:7260451-7260473 CCATCTTGAGCCCACAAGGGAGG - Intronic
1065961825 10:30739905-30739927 CCATCTTGCGACCAGGCTGGTGG + Intergenic
1067780845 10:49205798-49205820 CCAATTTGAGACCAAGAATGTGG - Intergenic
1068536054 10:58242865-58242887 CCATCATGAGAACAGCAAGGGGG - Intronic
1071939781 10:90576337-90576359 ACATCTTGAGACCATGTAAGAGG + Intergenic
1073249362 10:102112464-102112486 CCCTCCTGAGACCCTGAGGGTGG - Intronic
1078739302 11:14051609-14051631 CCATCTTTAAACCATGAAGAGGG + Intronic
1080133559 11:28825969-28825991 CCATCTTCAAACCAAGAAGATGG - Intergenic
1082826960 11:57587023-57587045 CTATCATGAGACCAGCAAGGGGG - Intergenic
1087895919 11:103586024-103586046 CTATCATGAGACCAGCAAGGGGG + Intergenic
1090382988 11:126339727-126339749 CCACCTTCAGGCCTTGAAGGAGG + Intronic
1091207007 11:133828658-133828680 CTCTATTGAGACCATGAAGATGG + Intergenic
1091888603 12:4034522-4034544 CCTTCTTGAGAGCTTGAAGTGGG - Intergenic
1093511475 12:19934686-19934708 CCATCTGCAAACCATGAAGAGGG - Intergenic
1093605236 12:21080868-21080890 CTATCTTGAGACCAGAAAGGGGG + Intronic
1093622829 12:21312784-21312806 CCATCTTAAGACCAGCACGGTGG + Intronic
1096134235 12:49186455-49186477 TCATCTGGAGAACATGATGGGGG + Exonic
1096144665 12:49269809-49269831 TCATCTGGAGAACATGATGGGGG - Exonic
1097501406 12:60409122-60409144 CTATCATGAGAACAGGAAGGGGG + Intergenic
1098301259 12:69056279-69056301 CCTCCTGGAGACCCTGAAGGAGG + Intergenic
1098319965 12:69232976-69232998 CTATCATGAGAACATCAAGGGGG - Intergenic
1100431473 12:94535152-94535174 CCATCTTCAGCTAATGAAGGGGG + Intergenic
1102133171 12:110549828-110549850 CACTCTTGAGAACATGCAGGAGG + Intronic
1103936032 12:124477224-124477246 CCATCATGAGAACAGGACGGGGG - Intronic
1104827483 12:131723653-131723675 CCATCGGGGGACCAGGAAGGAGG - Intronic
1105683131 13:22750663-22750685 GCCTCTTGAGACCATGAAGCTGG - Intergenic
1106713537 13:32364339-32364361 GCCTCTTGGGACCATGAATGAGG - Intronic
1107540517 13:41384955-41384977 CCATCTTGAGGCCACGAGGTGGG + Intergenic
1108720695 13:53128575-53128597 CCATCTTGTGACCATGAGGATGG + Intergenic
1109176321 13:59161335-59161357 CCATCTTGAGAACCTGGAGGTGG - Intergenic
1110125984 13:71942689-71942711 CTATCTTGAGAACAGCAAGGGGG - Intergenic
1110387144 13:74926307-74926329 CCATATTGATAGAATGAAGGAGG + Intergenic
1110503834 13:76261155-76261177 CTATCATGAGACCAGGATGGGGG - Intergenic
1111444929 13:88335121-88335143 CCATCTATGGACCATGAGGGAGG + Intergenic
1111884637 13:94004859-94004881 CCATGTTGAGACCACCAGGGTGG - Intronic
1113275974 13:108730481-108730503 CCACCTTGAGCACAAGAAGGAGG + Intronic
1118343544 14:64916509-64916531 CTATTATGAGACCATGAGGGAGG + Intronic
1118681956 14:68250900-68250922 ACAGCTTGTGTCCATGAAGGTGG - Intronic
1119290010 14:73488230-73488252 CCATCATGAGAGCAGCAAGGGGG - Intronic
1119460570 14:74799048-74799070 CCATCATGAGACCGAGATGGTGG - Exonic
1119944092 14:78673641-78673663 CCATCTGCAGACCAAGAAGCAGG - Intronic
1120000948 14:79302654-79302676 CCATCATGAGAACAGGATGGGGG - Intronic
1121237805 14:92405724-92405746 CCATCATGAGAACAGTAAGGGGG + Intronic
1123218720 14:106837389-106837411 CCATCTTGTGCCCATGTAGCTGG + Intergenic
1124431706 15:29614071-29614093 CCATCTTGTGGCCATGAGGAAGG - Intergenic
1125302247 15:38268556-38268578 GGATGTTGAGACCATGTAGGGGG + Intronic
1125392087 15:39204496-39204518 TCATCTTGAGACAATTGAGGTGG - Intergenic
1127736574 15:61845851-61845873 CCATTCAGAGACCATGAAGTAGG + Intergenic
1131190347 15:90310369-90310391 CTATCATGAGAACAGGAAGGGGG + Intronic
1132436803 15:101812685-101812707 CCATCTTGAGTCCATGAAACTGG - Intronic
1133594505 16:7278318-7278340 CCATCTAGAGACACTGAAGGAGG - Intronic
1135601691 16:23789159-23789181 CCATCTTGTGCCCATGACGGGGG + Intergenic
1135683378 16:24478112-24478134 CCATCTTGAGACAGAGAATGAGG - Intergenic
1137365763 16:47858211-47858233 CCCTGTTGTGACCAGGAAGGCGG - Intergenic
1141381296 16:83579532-83579554 CTATCATGAGACCAGCAAGGGGG + Intronic
1143285307 17:5784758-5784780 CCATCTTGAGAAGATGAACCTGG - Intronic
1143369054 17:6426991-6427013 CAATCATGAGAAGATGAAGGCGG - Exonic
1143909120 17:10233366-10233388 CCATCTTGCCACCATGAGGGAGG - Intergenic
1143987876 17:10930769-10930791 GCATTTTGAGTCCATTAAGGTGG + Intergenic
1147546885 17:41408665-41408687 CCAGCTGGAGTCCCTGAAGGAGG - Intergenic
1147554170 17:41465805-41465827 CCAGGTTGAGTCCCTGAAGGAGG - Exonic
1147796952 17:43050844-43050866 CCTTCTCAAGAGCATGAAGGTGG - Intronic
1147874657 17:43612591-43612613 CCATCTAGGAATCATGAAGGAGG - Intergenic
1148909737 17:50935046-50935068 CCATATTGCTACCAGGAAGGAGG + Intergenic
1152202070 17:78952923-78952945 CCAGGCTGAGACCATGGAGGAGG + Intergenic
1156554296 18:38049627-38049649 CCCTCTTTTCACCATGAAGGGGG + Intergenic
1158516963 18:58138690-58138712 CCATCTGCAGACCAGGAAGCAGG - Intronic
1159231020 18:65606746-65606768 CCATCATGAGAACAGCAAGGGGG - Intergenic
1160222752 18:76989182-76989204 CCATCTTGGGACACTGAGGGAGG + Intronic
1161112150 19:2476511-2476533 GCATCCTGAGACCAGGAAAGAGG - Exonic
1161462396 19:4406069-4406091 CCTTCTTCAGACCAGGAAGCTGG + Intronic
1161605748 19:5214027-5214049 CCAGCTTGAGCCTATGATGGGGG - Intronic
1163695641 19:18761993-18762015 CTATCTGGAGACAATGAAGAGGG - Intronic
1164915558 19:32049368-32049390 ACATCTTTAGAACATAAAGGGGG + Intergenic
1167342615 19:48924784-48924806 CTACCTTGGGACCATGAGGGGGG - Intergenic
1168165432 19:54543796-54543818 CCATCTTGACACCTCGAAGCTGG + Intronic
925280432 2:2680728-2680750 CCAGCTTGAGTCCCAGAAGGAGG + Intergenic
926679173 2:15650923-15650945 CCTTCTTGTGCCCATGTAGGAGG + Intergenic
927434148 2:23052782-23052804 CTATCATGAGACCATCAAGGGGG - Intergenic
928251235 2:29682821-29682843 GCATCTAGAGGCAATGAAGGAGG - Intronic
930001306 2:46863510-46863532 CCATCTGTAGCCCCTGAAGGTGG - Intergenic
932785853 2:74603139-74603161 CCATTCTGTGACCAGGAAGGTGG + Intronic
935437100 2:103046543-103046565 GCCTAATGAGACCATGAAGGTGG - Intergenic
938118176 2:128616144-128616166 CCATCATGAGAACAGTAAGGGGG - Intergenic
940466212 2:154030678-154030700 CCATCATGAGAACAGCAAGGGGG - Intronic
942398347 2:175575819-175575841 CCAGCTTGAGACCATCAGGCGGG + Intergenic
943010574 2:182443473-182443495 CTATCTCGAGACCAGCAAGGGGG - Intronic
945408155 2:209476166-209476188 CCTTCTCGAGACCATGATTGTGG + Intronic
945426924 2:209717352-209717374 CCGTCTTGAGAACAGCAAGGGGG + Intronic
945738508 2:213631541-213631563 CCATCATGAGAACAGCAAGGGGG - Intronic
948212649 2:236206435-236206457 CCATCTTGTGACCATGAGGGAGG + Intronic
1170370584 20:15643885-15643907 CCATCTTAAGACCGTGAGGATGG - Intronic
1170673139 20:18453547-18453569 ACAGCTTAAGATCATGAAGGAGG - Intronic
1171951103 20:31423280-31423302 CCATCCTGAGAAGAAGAAGGGGG + Intergenic
1172181012 20:33003445-33003467 CCATCTTGTGACCATGAGAGGGG + Intronic
1172534652 20:35664181-35664203 CCACCTTCAGGCCACGAAGGCGG + Intronic
1173479369 20:43387136-43387158 CCATCATGAGAACAGCAAGGGGG + Intergenic
1173929300 20:46805451-46805473 CCATCTACAGACCAAGGAGGGGG - Intergenic
1174205198 20:48833241-48833263 CCATCTTGAGACCCTGAGATAGG + Intergenic
1176986951 21:15448348-15448370 ACATATTGAGACCAAGAAAGAGG - Intergenic
1177028656 21:15954381-15954403 CTATCTTGAGAGCATGTATGGGG + Intergenic
1177235560 21:18385593-18385615 CTACCTTGAGACCATGAGTGAGG + Intronic
1178432588 21:32529628-32529650 CCCTCTGAAGACCAAGAAGGGGG - Intergenic
1179289249 21:40004529-40004551 CCATCTTGAGGCCAGGAAGCTGG + Intergenic
1180798176 22:18617882-18617904 CCATCCTGAGAGCCTGCAGGAGG + Intergenic
1181223543 22:21377384-21377406 CCATCCTGAGAGCCTGCAGGAGG - Intergenic
1181255200 22:21558238-21558260 CCATCCTGAGAGCCTGCAGGAGG + Intronic
1181262710 22:21610132-21610154 CCATCTATAAACCATGAAGCCGG - Intronic
1182860860 22:33558156-33558178 CCATGTTGAGCCCTAGAAGGGGG + Intronic
1183146294 22:35995577-35995599 TCATCCTGAGAACATCAAGGGGG - Intronic
1183409228 22:37645277-37645299 CCACCTTGAGGACATGAAGGGGG + Intronic
1183746537 22:39695058-39695080 CCATGTTGAGAACATGTAGAGGG - Intergenic
1183941634 22:41298947-41298969 CCATCTATAAACCAGGAAGGCGG - Intergenic
949829964 3:8203648-8203670 CCACTTTGTGACCATGAAGATGG - Intergenic
950100212 3:10352176-10352198 CCAGCTTGAGACGATGGTGGTGG - Intronic
950885955 3:16362956-16362978 CTAGCTTGAGGGCATGAAGGAGG + Intronic
951411132 3:22368606-22368628 CCATCTGCAGACCAGGAAGAGGG - Intronic
951472060 3:23067283-23067305 CTATCATGAGAACAGGAAGGGGG - Intergenic
952041268 3:29264604-29264626 CCATCTTGGGACCATCAGGGTGG + Intergenic
952203488 3:31155670-31155692 CCATTTTGTGACTATGAAGGTGG - Intergenic
954978335 3:54719237-54719259 TCATCCTGAGATCATGAAAGAGG - Intronic
955366704 3:58316570-58316592 CCATCTTGAGAATATGTAGCAGG + Exonic
955547415 3:60045913-60045935 CCATCTGGAGCCCAGGAAGGAGG + Intronic
955816198 3:62845980-62846002 CTATCATGAGAACAGGAAGGGGG - Intronic
957553072 3:81731642-81731664 CTATCATGAGACCAGGAAGGGGG - Intronic
957585901 3:82131646-82131668 CTATCACGAGACCAGGAAGGGGG - Intergenic
957789021 3:84916710-84916732 CCACCTGGAGACCCAGAAGGGGG + Intergenic
958788052 3:98620567-98620589 GCATCTTCAGACCAAGAAGGAGG + Intergenic
959369533 3:105505415-105505437 CTATCTTGAGAACAACAAGGGGG + Intronic
959926021 3:111922848-111922870 CCATCTTCTCACAATGAAGGCGG + Intronic
960747332 3:120904551-120904573 CCACAATGAGGCCATGAAGGTGG + Intergenic
961942258 3:130650268-130650290 CCATGTGGAGACCGTGAAGGGGG + Intronic
964932627 3:162045576-162045598 CCATCTTGTGCCCATGTAGCAGG + Intergenic
972167682 4:36307368-36307390 ACACCCTGAGACCATGAAGATGG - Intronic
973545345 4:51975720-51975742 ATATCTTGAGACCATGAACAGGG + Intergenic
973746102 4:53965017-53965039 CCATCTGCAAACCATGAAGGAGG + Intronic
974033117 4:56794104-56794126 CCATCTTAATACCAGGAATGAGG + Intergenic
974519699 4:62967260-62967282 GCATCTTTATAACATGAAGGAGG - Intergenic
975475604 4:74820011-74820033 CCATCTTAGGACCATGATGGAGG - Intergenic
975843454 4:78500789-78500811 CCATCTTGAGATATGGAAGGAGG - Intronic
975970303 4:80026202-80026224 CCATCATGAGAACAGGATGGGGG - Intronic
977466556 4:97389591-97389613 CTATCATGAGAACAAGAAGGGGG + Intronic
981311721 4:143304172-143304194 CCATCTTGGGACCATGAGCGGGG - Intergenic
981423364 4:144576846-144576868 GCATCTGGTGACCATGAATGTGG - Intergenic
983294598 4:165850213-165850235 CTATCTTGAGAACAGCAAGGGGG + Intergenic
985826077 5:2192502-2192524 CCATCCTGGGACCCTGAGGGTGG + Intergenic
985852251 5:2397398-2397420 CCCTCCTGAAACCATGAATGGGG + Intergenic
985927929 5:3032225-3032247 CCACCGTGTGCCCATGAAGGGGG + Intergenic
986029121 5:3879321-3879343 AATTTTTGAGACCATGAAGGGGG + Intergenic
988138517 5:27205178-27205200 CCATCATGAGACCAGCATGGAGG + Intergenic
988702823 5:33692272-33692294 CCATATTCAGGCCAGGAAGGAGG - Intronic
990269378 5:54119055-54119077 CCATAGTGAGAACATAAAGGAGG - Intronic
991042484 5:62190292-62190314 CCATCATGAGAACAGCAAGGGGG - Intergenic
992906350 5:81349593-81349615 CCTTCAAGAGACCCTGAAGGTGG - Intronic
993524375 5:88946018-88946040 TCATCTTGCGACTGTGAAGGAGG - Intergenic
994900056 5:105759951-105759973 CTATCATGAGACCAGCAAGGAGG - Intergenic
995688938 5:114801521-114801543 CTATCATGAGACCAGCAAGGGGG + Intergenic
995753133 5:115474418-115474440 CCATCTTGCCTCCATGAGGGTGG - Intergenic
998000356 5:138620339-138620361 GCCTCTTGAGACCCTGTAGGAGG + Intronic
1001450761 5:171822675-171822697 CCATCTTGTGGCCAAGAGGGAGG - Intergenic
1004846338 6:19647342-19647364 CTATCTTGAGAACAGCAAGGAGG + Intergenic
1005965568 6:30724130-30724152 CCATCTTGAGGCCACGAGGTGGG - Exonic
1006020651 6:31115826-31115848 CCATTTTGAGAAGAGGAAGGAGG + Exonic
1010898330 6:81393277-81393299 CCATCATGAGAACAGAAAGGGGG - Intergenic
1012168769 6:95991602-95991624 CCTTCCTGAGCCCATGAATGTGG - Intergenic
1012753303 6:103190695-103190717 ACATCTTGAAAACATGAAAGGGG + Intergenic
1014600475 6:123405376-123405398 CCATCTTGAGATGATGGAGATGG - Intronic
1014786255 6:125623333-125623355 CCACCTTGAGGCCAGGAAGCAGG + Intergenic
1016094502 6:140019638-140019660 CTATCATGAGACCAGCAAGGGGG + Intergenic
1016540390 6:145157906-145157928 CCATCTATGAACCATGAAGGGGG + Intergenic
1017017921 6:150116468-150116490 CCTTATTGACACCATGAATGGGG - Intergenic
1017412475 6:154183277-154183299 CCATCTTGAAAAGATAAAGGTGG - Intronic
1017952464 6:159147594-159147616 CTATCATGAGAACAGGAAGGGGG + Intergenic
1018008180 6:159642672-159642694 CCATCTTCAGACCAGAATGGAGG + Intergenic
1023507583 7:40916470-40916492 ACATCTTGTGAGGATGAAGGAGG + Intergenic
1023507680 7:40917737-40917759 CCATCTGCAAACCATGAAGAGGG - Intergenic
1027342282 7:77222378-77222400 GCATCTTCAAAACATGAAGGTGG + Intronic
1028402727 7:90441900-90441922 CCATCATGAGAACAGCAAGGGGG + Intronic
1028509626 7:91610027-91610049 TCATCTTGAGATTGTGAAGGAGG + Intergenic
1028923235 7:96329458-96329480 CCATCATGTGACCAAGAAGAAGG + Intergenic
1030735177 7:113039622-113039644 CCATTTTCAGACCAAGAAGGAGG - Intergenic
1032141542 7:129335711-129335733 CTATCTTGAGACCATCATGCTGG - Intronic
1032475490 7:132208820-132208842 CCATGGGGACACCATGAAGGAGG + Intronic
1032691025 7:134286796-134286818 CTATCATGAGAACATCAAGGAGG - Intergenic
1037796559 8:22000280-22000302 AAATCTGGAGATCATGAAGGGGG + Intronic
1038757265 8:30353075-30353097 CCATCTTGAGGCCACGAGGTGGG - Intergenic
1039509902 8:38082952-38082974 CCATCTTGAGCCCATGTAGCTGG + Intergenic
1042376373 8:68057122-68057144 CCATCATGAGACCAGCAAGGTGG - Intronic
1042945915 8:74154326-74154348 CCATCTGGAGACCATGTAAATGG + Intergenic
1043293519 8:78635447-78635469 CGGTCTTTAGACCATGAAGCAGG + Intergenic
1043704848 8:83335349-83335371 ACATCATGAGAACAGGAAGGGGG - Intergenic
1045476283 8:102555564-102555586 TCATCCTCAGAGCATGAAGGGGG - Intronic
1047002778 8:120589621-120589643 CCATCTACAAACCAGGAAGGGGG - Intronic
1047034880 8:120926714-120926736 AGATCTTGAGAGCATGGAGGTGG + Intergenic
1047692641 8:127371946-127371968 GCATTATGAGAGCATGAAGGAGG - Intergenic
1047717977 8:127613416-127613438 CCATCTTGAGGCTATGAAGGTGG - Intergenic
1048402131 8:134081995-134082017 CCATCTGTAGGCCAGGAAGGGGG - Intergenic
1050643256 9:7692005-7692027 CCATCATGAGAACAGCAAGGGGG - Intergenic
1052184629 9:25577251-25577273 CCATCTGGAGACCCTGAAGATGG - Intergenic
1052384025 9:27804229-27804251 CAATCTTTAGACCCAGAAGGAGG - Intergenic
1054725576 9:68646844-68646866 CCATCTTGAGACCTTGAAGGAGG + Intergenic
1056394410 9:86168440-86168462 TCATTTTGAGACCATGAATAGGG + Intergenic
1056862808 9:90202817-90202839 CCAGCTGGATACCAGGAAGGGGG - Intergenic
1057883712 9:98812116-98812138 CCATCTTGAGAACATCAGAGTGG + Intronic
1058102816 9:100936092-100936114 CTATCATGAGAACAGGAAGGGGG - Intergenic
1059521218 9:114944150-114944172 CCATCTGCAAGCCATGAAGGGGG - Intergenic
1059738035 9:117121909-117121931 CCATCTTGAGAACAGCAAGGGGG + Intronic
1060906641 9:127313080-127313102 CCATCTTGTGACCCTGAACAGGG - Intronic
1062723821 9:138059756-138059778 CCACCTGGGGACCCTGAAGGAGG - Intronic
1185622902 X:1464459-1464481 CCATCTGGAGTCCAGGAAGCAGG - Exonic
1185827032 X:3261339-3261361 CCATCTGCAGACCAGGAAGGAGG + Intergenic
1189099638 X:38175344-38175366 CCATCATGTGGCCAGGAAGGAGG + Intronic
1190153529 X:47968132-47968154 CCATCTGCAAACCAGGAAGGTGG + Intronic
1190506949 X:51135815-51135837 CTATCATGAGAACATCAAGGGGG - Intergenic
1192418093 X:71002522-71002544 CCATCATGAGAACAGGATGGGGG - Intergenic
1192426563 X:71082260-71082282 CCATCTTGAGGCCAGGAACAAGG + Intergenic
1192799980 X:74456628-74456650 CAATTTTGAGCCCATGAAGCAGG - Intronic
1193066254 X:77263722-77263744 CTATCATGAGAACATCAAGGGGG - Intergenic
1194409717 X:93543125-93543147 CTATCTTGAGAACAGCAAGGGGG + Intergenic
1194594461 X:95839953-95839975 TCATCCTTAGACCATGAAGGAGG - Intergenic
1194819125 X:98484446-98484468 CTATCTTGAGAACAGCAAGGGGG - Intergenic
1195053799 X:101123400-101123422 CAATCTTTAGAACAAGAAGGGGG + Intronic
1196081443 X:111637159-111637181 CTATCATGAGACCAGAAAGGGGG - Intergenic
1198731593 X:139736345-139736367 TCATCTTTAGACCATGTAGCTGG + Intronic
1199688191 X:150283055-150283077 CCATCATGATAGCAAGAAGGTGG + Intergenic
1201251875 Y:12067008-12067030 CCATCTGCAGACCAGGAAAGAGG - Intergenic