ID: 918579164

View in Genome Browser
Species Human (GRCh38)
Location 1:186105007-186105029
Sequence GCCTTTAAGACCTACAGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918579164_918579165 16 Left 918579164 1:186105007-186105029 CCATTACTGTAGGTCTTAAAGGC 0: 1
1: 0
2: 2
3: 9
4: 84
Right 918579165 1:186105046-186105068 GTTATAAGAAAACAAGATGAAGG 0: 1
1: 0
2: 4
3: 90
4: 692

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918579164 Original CRISPR GCCTTTAAGACCTACAGTAA TGG (reversed) Intronic
904145470 1:28387576-28387598 CCCTTTAATACATACAGCAAAGG - Intronic
911358728 1:96851063-96851085 GCCTTTTTGACTTTCAGTAAGGG + Intergenic
911711655 1:101080418-101080440 GCCTTTGATATCTCCAGTAAAGG + Intergenic
913314009 1:117534888-117534910 GCCTTTAAGAGCTACAGGAGAGG - Intergenic
918579164 1:186105007-186105029 GCCTTTAAGACCTACAGTAATGG - Intronic
920689520 1:208135182-208135204 GCATTTAAGACCTTCAGGAAAGG + Intronic
923295145 1:232587405-232587427 GACTTTAAGACATACAGGAAAGG - Intergenic
1066591242 10:36996716-36996738 GACTTTAAGACCAGCGGTAAAGG + Intergenic
1067073005 10:43150392-43150414 GCCTAAAAGACTTACAGTACAGG + Intronic
1076774498 10:132687254-132687276 GTTTTTAAGACCTGCTGTAAAGG + Intronic
1082853502 11:57786064-57786086 GCCATTAAGTCCTACATTACTGG - Intronic
1085897046 11:80652570-80652592 GACTTTAAGACCAGCAGTAAAGG - Intergenic
1088706624 11:112469713-112469735 GCCTTTAAAAGTTACAGCAAGGG + Intergenic
1098801527 12:74965897-74965919 GCCTTGAAGACCTTCAGTAAAGG - Intergenic
1099906589 12:88778550-88778572 CCCTGTAAAACCTAAAGTAATGG - Intergenic
1103190185 12:118994460-118994482 GCTTTTAAGAACTAGAGTAGGGG - Intronic
1104240972 12:126989229-126989251 GTCATTCAGACCTACAGTACAGG + Intergenic
1113077234 13:106479167-106479189 GCCATTATGACCTAAAATAAAGG - Intergenic
1113156357 13:107327217-107327239 GCCACCAAGACCTACAGAAAGGG + Intronic
1115490904 14:33957346-33957368 GCCCTTTAGGCCTACAGAAACGG + Intronic
1115668479 14:35581410-35581432 GCTTTTAAGTCCAACAGAAAGGG - Intronic
1127018061 15:54711045-54711067 GCCTTTCAGACCTTCAATTAAGG - Intergenic
1127486351 15:59421320-59421342 ACCTTTCTGACCTACAGTGATGG - Intronic
1129971055 15:79778407-79778429 GCCTTAAAGCCCCACAGTGATGG + Intergenic
1136554315 16:30998699-30998721 ACCTTTCAGACCTCCAGGAAAGG - Intronic
1141310308 16:82907382-82907404 GTTTTTAATCCCTACAGTAAAGG - Intronic
1145405229 17:22584479-22584501 GCCTTTAACATCTACTGCAATGG + Intergenic
1146469685 17:33114059-33114081 GCCTTGAAGACCTGTAGGAAGGG + Intronic
1146665258 17:34697926-34697948 TCCTTTATCACCTACAGTTATGG - Intergenic
1150970497 17:70021660-70021682 GCATTTAAGGCCTTCAGTAAAGG + Intergenic
1155148668 18:23105088-23105110 GCATTTAAGACCCAAAGAAATGG + Intergenic
1156712552 18:39964266-39964288 GCCTATAAGACATACTGTAGGGG + Intergenic
1157564996 18:48673905-48673927 GCATTTAAGACATACAGCAGGGG - Intronic
1158343018 18:56486944-56486966 ACGTTTGAGACCCACAGTAAGGG - Intergenic
1159210066 18:65307687-65307709 GTCTTCAAGACCTGCAGGAATGG + Intergenic
1162185474 19:8901512-8901534 GAATTTAAGACCTAAAGGAAAGG + Intronic
926689192 2:15721245-15721267 GCCTTCAAGACCTACATTTCTGG - Intronic
928586456 2:32763327-32763349 TCCTTTAAGACCTGCAATAAAGG + Intronic
932267534 2:70381275-70381297 GCCACTAAGACTTACTGTAAAGG - Intergenic
935589564 2:104834130-104834152 CCCTTACAGACATACAGTAATGG + Intergenic
937934654 2:127233357-127233379 ATATTTAAGACCTACATTAATGG + Intergenic
939517958 2:143192673-143192695 TCCATTAAGACCTCCAGTCAGGG + Intronic
939692567 2:145283311-145283333 GCCTTAGAGACCTACAGCAGAGG - Intergenic
947415151 2:229887468-229887490 ACATTTAAGACCTACAGATAAGG + Intronic
1173361764 20:42350863-42350885 GCCTTCCAGGCCTTCAGTAAAGG + Intronic
1176955396 21:15097010-15097032 ACCATTAAGACCCACAGTGATGG - Intergenic
1177916765 21:27098656-27098678 ACATTTAAGAACTCCAGTAAAGG - Intergenic
1179319957 21:40281088-40281110 GCATTCCAGACCTACAGAAATGG + Intronic
1184488667 22:44796487-44796509 GGCTCTAAGACCTCCAGGAAGGG + Intronic
952762824 3:36930211-36930233 GCCTTCAAGGCCTGCAGTGATGG - Intronic
954730828 3:52660224-52660246 GCCCTGAAGGCCTACACTAAGGG + Intronic
954736098 3:52707460-52707482 GGCTTTAAGACCTAAAAGAAAGG - Intronic
956153568 3:66269164-66269186 GCCTTTTAGAACTGCTGTAAAGG - Intronic
956787254 3:72652902-72652924 GCCTTTAAAAACTAAAGTGATGG + Intergenic
962379366 3:134884967-134884989 CCCTTTAAGACCTGCAGTAAAGG - Intronic
965417199 3:168411180-168411202 GCCATAAAAAACTACAGTAAGGG - Intergenic
976350469 4:84054537-84054559 ACCTTTAAGAGCCACACTAAAGG + Intergenic
976380884 4:84397000-84397022 GCATTTATGACTTAGAGTAAGGG - Intergenic
976750948 4:88450871-88450893 TCCTTTAAGTCCTACAGGATAGG - Intergenic
976993029 4:91393129-91393151 GCCTTTCAGATCCACATTAAAGG + Intronic
980072564 4:128259420-128259442 TCCTTAAAGGCCTTCAGTAACGG - Intergenic
981297327 4:143147068-143147090 GCCTTTTACACCTGCAGTCATGG - Intergenic
982062814 4:151621699-151621721 GACTTTAAAACCCACAGTAGAGG - Intronic
984118492 4:175712280-175712302 GGCTGTAAGAGCTACAGGAAGGG - Intronic
990858472 5:60299223-60299245 GCCTTTAAAACCAAAAGTAATGG + Intronic
996337024 5:122395495-122395517 GCCTTTGCAACCTAGAGTAATGG + Intronic
997184628 5:131869384-131869406 GTATTTAAGACTTACTGTAAAGG - Intronic
999361399 5:150989360-150989382 GCTTTTAAGAGCTAGAGTAGGGG + Intergenic
1002807538 6:591435-591457 GCATTTAAGACTTCCAGGAAGGG - Intronic
1003489660 6:6610389-6610411 GCCTTTATGACCCACAGTGCAGG + Intronic
1004463745 6:15863548-15863570 GCCTGTAAGCCATAAAGTAATGG + Intergenic
1010982633 6:82386569-82386591 GCCTTTAATACCTCTAATAATGG + Intergenic
1013107932 6:107041989-107042011 ACCTTTATGACCTAATGTAATGG + Intronic
1022618989 7:31963439-31963461 GTCTTTATGTCCCACAGTAAAGG + Intronic
1023413156 7:39908128-39908150 GTATTAAAGACCTACATTAAAGG + Intergenic
1031879934 7:127186375-127186397 GCCTTTATGGTCTACATTAAGGG + Intronic
1032528440 7:132598854-132598876 TCCTTTGAGACCTAGAATAAAGG - Intronic
1035540460 8:432134-432156 GCCATTATGAAGTACAGTAAGGG + Intronic
1039223061 8:35356749-35356771 GCCATTAAGAAGTAAAGTAAGGG + Intronic
1041642423 8:60217600-60217622 GCCTTTAAGACATCCAAGAAAGG - Intronic
1043411016 8:79995482-79995504 GACTTTAACACCTCCAGTAGGGG - Intronic
1047446776 8:124927208-124927230 GCCCTTATGACCTACTGTGAGGG + Intergenic
1052126523 9:24781951-24781973 TCCTTTAAGTCATAAAGTAAAGG + Intergenic
1053569736 9:39291867-39291889 GCCTTTACTACCTACAGCAGAGG + Intergenic
1053835697 9:42132899-42132921 GCCTTTACCACCTACAGCAGAGG + Intergenic
1054091366 9:60850872-60850894 GCCTTTACTACCTACAGCAGAGG + Intergenic
1054112781 9:61126442-61126464 GCCTTTACTACCTACAGCAGAGG + Intergenic
1054127412 9:61327146-61327168 GCCTTTACTACCTACAGCAGAGG - Intergenic
1054594932 9:67055706-67055728 GCCTTTACCACCTACAGCAGAGG - Intergenic
1060991296 9:127850685-127850707 GACTTTAAGTCCTCCAGCAAAGG + Intronic
1061491838 9:130949243-130949265 GCCTATTAGACCTCCAGGAAGGG + Intergenic
1190773680 X:53535708-53535730 GGCTCTAAGACCTACAAAAAAGG + Intronic
1192631494 X:72781184-72781206 GCCTTTCAGACACACAGTAATGG - Intronic
1192650215 X:72939617-72939639 GCCTTTCAGACACACAGTAATGG + Intronic
1200714483 Y:6521617-6521639 TCCTTGAAGACCTACAGTTCTGG + Intergenic
1201019341 Y:9639539-9639561 TCCTTGAAGACCTACAGTTCTGG - Intergenic