ID: 918580196

View in Genome Browser
Species Human (GRCh38)
Location 1:186117691-186117713
Sequence CTTTTATTCTGGTGCAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918580196_918580198 15 Left 918580196 1:186117691-186117713 CCTTTGTTGCACCAGAATAAAAG 0: 1
1: 0
2: 1
3: 13
4: 128
Right 918580198 1:186117729-186117751 CATTCTTGAACTTAAAAATCTGG 0: 1
1: 0
2: 2
3: 20
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918580196 Original CRISPR CTTTTATTCTGGTGCAACAA AGG (reversed) Intronic
906575618 1:46886654-46886676 CTTTATTTCTGGTGTAACTAGGG - Intergenic
906596358 1:47081242-47081264 CTTTATTTCTGGTGTAACTAGGG + Intronic
906670299 1:47649400-47649422 CTTTTATTCTTATGCACCAAAGG + Intergenic
908632987 1:66130770-66130792 CTGTGATTCTGTTGCAACAGGGG - Intronic
909056016 1:70822080-70822102 TTTTTTTTTTGGTGCAACAAAGG - Intergenic
909573237 1:77141969-77141991 CTTTTATTGTGGGGGAAAAATGG - Intronic
909573368 1:77143494-77143516 CTTTTATTATGGGGGAAAAATGG - Intronic
909902317 1:81153283-81153305 CTTTTATTTTGGTGCAAGTTTGG - Intergenic
912175060 1:107144582-107144604 TTTTTTTTCTGGTGAAAGAAAGG + Intronic
918580196 1:186117691-186117713 CTTTTATTCTGGTGCAACAAAGG - Intronic
919327975 1:196133512-196133534 CTTTTACTCTGTTGCAATAAAGG - Intergenic
920060349 1:203222997-203223019 CTTTTGTTCTGGTGTAAGGATGG + Intronic
924368817 1:243324778-243324800 CTTTTATTCTACTGCAAGAGGGG - Intronic
1066244963 10:33573878-33573900 ATCTCATTCTGGTGAAACAATGG - Intergenic
1066403969 10:35101823-35101845 CTCTAATTCTAGTGCACCAAAGG + Intergenic
1067330366 10:45310103-45310125 CTTTTATTTTGTTGAAATAAAGG - Intronic
1068227667 10:54127232-54127254 CTTTTATTCCATTGCAAAAAGGG + Intronic
1071802919 10:89084549-89084571 ATGTTATTCTGATGCAACCATGG - Intergenic
1074443450 10:113498536-113498558 GGTTTATTCCGGTGCATCAATGG - Intergenic
1074747693 10:116551766-116551788 CTTTTAATCTGGTGGAAGTAGGG - Intronic
1080726844 11:34906522-34906544 TTTCTATTATGATGCAACAAGGG + Intronic
1085191779 11:74632289-74632311 TTTTTATTCTGTCCCAACAAAGG + Intronic
1086004397 11:82020269-82020291 CTTTTAATCCATTGCAACAAAGG - Intergenic
1088233561 11:107698810-107698832 TGTTTATTCTGATGCCACAATGG - Intergenic
1089431796 11:118431009-118431031 CTTTTTTTCTGGGGAAAAAAGGG - Intronic
1092601625 12:10072357-10072379 CATTTATGCTGATGCAAAAATGG + Intronic
1093271497 12:17067772-17067794 TTTTTTTTCTGGTGCAGCAGAGG + Intergenic
1098825870 12:75296600-75296622 CTTTTATGCAGGTGCATCTATGG + Intronic
1102725702 12:115062735-115062757 CTCTTTTTCAGGTGCAACCATGG + Intergenic
1103181220 12:118913574-118913596 CTTTTATTCTAGGGCTAGAAAGG + Intergenic
1104466271 12:128993457-128993479 ATTTTATTCTGGTCCACCATGGG - Intergenic
1106258152 13:28040340-28040362 CTTTTTTTCTGGTGCCTCTAGGG - Intronic
1107628895 13:42322243-42322265 CTTTAATTTTGCTCCAACAAGGG + Exonic
1107922261 13:45221333-45221355 CTTATATTCTGGAGCAAAAATGG - Intronic
1108084917 13:46777122-46777144 TTTTTATTCTACTGCAGCAAAGG + Intronic
1109105378 13:58243525-58243547 TTTTTTTTCTGGTTCAATAATGG - Intergenic
1111639683 13:90951794-90951816 ATTTTATTCTCATGCAACATTGG - Intergenic
1117562628 14:56957112-56957134 CTTATATTCTGATGCAAAAATGG - Intergenic
1118833143 14:69453823-69453845 CTTTTGTTTTTGTGCAACAGTGG + Intronic
1119082201 14:71705731-71705753 CTTTGATTCTGCTGCAGTAAAGG + Intronic
1120508573 14:85383773-85383795 CATCTATTGTTGTGCAACAAAGG - Intergenic
1126555762 15:49985873-49985895 CTTTTTTTCTGCTGTAACATGGG - Intronic
1128178097 15:65574721-65574743 CTTTTTTTCTGTTTCAGCAAAGG + Intronic
1130313726 15:82777040-82777062 CTTTTGTTCTGGTGTAAGATAGG - Intronic
1146118278 17:30163422-30163444 CTTGTATAGTGATGCAACAAAGG + Intronic
1146202612 17:30872996-30873018 CTTTTGTCATGATGCAACAATGG - Intronic
1146684422 17:34831517-34831539 CTTTTATTCTGGTGGAGCATGGG - Intergenic
1148655612 17:49281060-49281082 GTTATATTCTGGTCCAACAAGGG + Intergenic
1150263640 17:63817524-63817546 CTTTTGTTCTTGTGCTATAAAGG - Intronic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1155687871 18:28577700-28577722 ATTTTATTCTTATGAAACAATGG - Intergenic
1156439858 18:37173977-37173999 CTTTAATTCTGGAGCTAGAAAGG + Intronic
1157089232 18:44616113-44616135 CTTTTATTCATATGCAAAAAAGG - Intergenic
927281759 2:21314890-21314912 CTTTTATTTTAGTGCCTCAAAGG + Intergenic
930299920 2:49602639-49602661 CTTTTAAACTGGTGGAATAAAGG + Intergenic
933450853 2:82448886-82448908 CTTTTATGCTGTTGAAAAAAAGG - Intergenic
935845271 2:107159534-107159556 ATTAGATTCTGGTGCAAAAAAGG - Intergenic
941411877 2:165167849-165167871 GTTTTCTTTTAGTGCAACAAGGG + Intronic
945140657 2:206683254-206683276 CTTTTACTCTGGGGAAACATTGG - Intronic
1170432821 20:16292748-16292770 CTTTTAGGCTGTTGCAACAAAGG + Intronic
1170795630 20:19544526-19544548 ATTTTAGTCTGGTGCAAAAATGG - Intronic
1171213519 20:23335102-23335124 CTTTGATGCTGCTGCAACAGAGG - Intergenic
1174531237 20:51216018-51216040 CTTTTATTTTGGGGCCTCAAAGG + Intergenic
1174867752 20:54153403-54153425 TTTTTATTTTGTTGTAACAAAGG + Intergenic
1175990887 20:62788449-62788471 TTTTTTTTTTTGTGCAACAAAGG - Intergenic
1177964601 21:27712256-27712278 CCTCTCTTCTGGTGTAACAACGG + Intergenic
1178918289 21:36721900-36721922 CTTTGAGTCTGAAGCAACAAGGG + Intronic
1180032390 21:45221425-45221447 GTTTTATTCTGGGGAAAAAAGGG - Intronic
950188119 3:10957876-10957898 CTATTATTCTAGTGCAACAGAGG + Intergenic
957542792 3:81596525-81596547 CATTTTTTCTTATGCAACAAAGG - Intronic
961986057 3:131136232-131136254 CTTTGATTCTGATACAACCAAGG - Intronic
962300401 3:134236548-134236570 CTTTTACTCTTGTGCAAAAATGG - Intronic
962790057 3:138803155-138803177 TTTTTATTCTGGTGGAAGACTGG - Intronic
963075996 3:141346515-141346537 CTATTACTCTGTTGCAACAAAGG + Intronic
965439233 3:168692151-168692173 CTTTTAGTCAGGTGGGACAATGG - Intergenic
965722501 3:171677138-171677160 TTTTTATCCTGTTGAAACAATGG + Intronic
967768090 3:193304453-193304475 TGTTTATTCTGATGCACCAAAGG + Intronic
969104596 4:4795957-4795979 CTTTGATTCTGATGGAAAAATGG + Intergenic
973171213 4:47146397-47146419 CTTTCTTTCTACTGCAACAAAGG - Intronic
975190673 4:71457532-71457554 CTTTTTTTATGGTACAGCAATGG + Intronic
978071744 4:104480964-104480986 CTCTTATTCAGGTAAAACAAAGG + Intronic
978971254 4:114809060-114809082 GTTTTCTTCTGGTTCAACATTGG - Intergenic
981874760 4:149528911-149528933 TTTTTATTCTGCTGCACTAAAGG + Intergenic
981880503 4:149605681-149605703 CTTTTATTCTGGTGCTACACTGG + Intergenic
982020700 4:151201339-151201361 ATTTTATGCTGGAGCAATAAGGG - Intronic
982538942 4:156642953-156642975 CTATTATTCTTGTGAATCAATGG + Intergenic
984606569 4:181792304-181792326 CTTTTATTTTGGCTCAAAAATGG + Intergenic
985671461 5:1209002-1209024 GTCTGTTTCTGGTGCAACAAAGG + Intronic
988056124 5:26099456-26099478 ATTTTATTCTGGTGTAAAAGGGG + Intergenic
988804896 5:34731053-34731075 CTTTTACTCTGATACATCAAAGG - Intronic
988967837 5:36437930-36437952 CTTTATTGCTGGTGCAACCAAGG - Intergenic
989455183 5:41635695-41635717 CTTTTATTCTGGCTGAAAAATGG - Intergenic
989801544 5:45548003-45548025 GTTTTATTCTGGTCAACCAAAGG - Intronic
993164723 5:84337876-84337898 ATTTTATTATGGTACAATAAAGG - Intronic
995231395 5:109768403-109768425 CTTTTTTTATGGTGAAGCAATGG + Intronic
996843793 5:127877632-127877654 ATATTATTCTGGGACAACAATGG - Intergenic
999160589 5:149493390-149493412 ATTCTATTATGGTGCCACAAAGG - Intronic
1001447087 5:171794068-171794090 GGTTTATTGTGGTGCTACAAAGG + Intronic
1003341621 6:5227095-5227117 CGTTTATTTTGAGGCAACAATGG + Intronic
1004151776 6:13127213-13127235 CTTTCCTTCTGGTGTAAGAAGGG + Intronic
1008739301 6:54585797-54585819 CTTTCATTTTGGTGCCAAAATGG - Intergenic
1009844963 6:69122680-69122702 CTTTCATTTTGTTGCAAGAAAGG + Intronic
1015737465 6:136416244-136416266 CTTTTATTAAGATGCACCAATGG + Intronic
1017193921 6:151680721-151680743 CTTATATTCTAGTGGAACAAGGG - Intronic
1017224344 6:152002793-152002815 CTTTTATTTTTGTTCAGCAAAGG - Intronic
1020236198 7:6357426-6357448 TTTTTTTTTTGGTGCAATAATGG + Intergenic
1020985865 7:15133734-15133756 GTTGGATTCTGGTGTAACAAAGG - Intergenic
1024616738 7:51121486-51121508 CTTTTACTTTTGTGCACCAAAGG - Intronic
1028851621 7:95544105-95544127 AATTTACTCTGGAGCAACAAAGG + Intergenic
1030278975 7:107750675-107750697 CTTTTATACTGGTGAAATAGGGG - Intronic
1030409513 7:109157799-109157821 CTTTTCTTTTACTGCAACAAAGG + Intergenic
1031136445 7:117889509-117889531 CTTTTATTCTGTTGTATAAAAGG - Intergenic
1033187641 7:139243405-139243427 CTTTGATTCTGTTGCAGTAAGGG + Intronic
1034454082 7:151155846-151155868 CTTATTTTCTGGTGAAAAAATGG + Intronic
1035298573 7:157881819-157881841 CTTTCATTCCTGTGAAACAAAGG - Intronic
1036749243 8:11433471-11433493 CTTTTAGTTTGGTGAAATAAGGG + Intronic
1037629270 8:20638257-20638279 TTTTCATTCAGGTTCAACAAAGG + Intergenic
1040035278 8:42863901-42863923 CTCTTATTTTGGTGCAAAGAGGG - Intronic
1042985159 8:74575313-74575335 TTTTTATAGTGGTGCAAGAATGG - Intergenic
1044704194 8:94992856-94992878 CTGTTATTCTTGTGCATCATCGG - Intronic
1046659228 8:116931259-116931281 CTGTTGTTTTGGTGAAACAATGG + Intergenic
1051007424 9:12363330-12363352 CTTTTATTCTGGTCCAAATTAGG + Intergenic
1051494635 9:17706158-17706180 CTTTTATTCTGGAGTGGCAAAGG + Intronic
1051498404 9:17750641-17750663 GTCTTACTCTGGTGCAACATTGG + Intronic
1051691417 9:19716842-19716864 CTTTCAGTCTGGTCCATCAATGG + Intronic
1053269279 9:36739273-36739295 CTTTTTATCTTGAGCAACAAAGG + Intergenic
1056113057 9:83415207-83415229 CTTTCAGTCGGGTTCAACAATGG - Intronic
1058622636 9:106899454-106899476 CTCTTATCCTCGTGCCACAATGG - Intronic
1059729412 9:117042191-117042213 CTATTATTCTGTTGTAACATTGG + Intronic
1061661061 9:132130632-132130654 GTATTATTCTGCTGCAAGAAAGG - Intergenic
1188921520 X:35984167-35984189 CTTTCTTTCTGGTTCAATAATGG + Intronic
1190578046 X:51861067-51861089 TTTTTATTCTTTTGCAACATGGG - Intronic
1191259408 X:58298273-58298295 CTTTTATTTTAGTGTAAGAATGG + Intergenic
1192957400 X:76087425-76087447 CTTTTATTTTGGTGCAAGTTTGG - Intergenic
1194877800 X:99210522-99210544 CTTTTCTTATGGGGCAATAAAGG + Intergenic
1195459454 X:105107662-105107684 CTTTTTGGCTGGGGCAACAATGG + Intronic
1195943619 X:110186379-110186401 CTTTTTTTTTTTTGCAACAATGG + Intergenic
1196974710 X:121146562-121146584 CTTATTTCCTGGTGCAATAATGG + Intergenic
1198374801 X:136028080-136028102 CTCTTATGTTGGTGCAACATTGG + Intronic
1198714687 X:139544625-139544647 CTTTTTTTCTGGGGGAACACAGG - Intronic
1200971600 Y:9158461-9158483 CTTTTCTTCTTGTGCCACCAAGG - Intergenic
1201715134 Y:17036203-17036225 TTTTTATTCTGGTGTAAGCAGGG - Intergenic
1202139418 Y:21705836-21705858 CTTTTCTTCTTGTGCCACCAAGG + Intergenic